ID: 931384595

View in Genome Browser
Species Human (GRCh38)
Location 2:61786687-61786709
Sequence TCCAACTGGCTGATGTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931384593_931384595 7 Left 931384593 2:61786657-61786679 CCGAAGGCATATTTGCGGAATGC No data
Right 931384595 2:61786687-61786709 TCCAACTGGCTGATGTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931384595 Original CRISPR TCCAACTGGCTGATGTGTAA AGG Intergenic
No off target data available for this crispr