ID: 931390641

View in Genome Browser
Species Human (GRCh38)
Location 2:61840532-61840554
Sequence ATGATGTCATTAATGAGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931390639_931390641 -4 Left 931390639 2:61840513-61840535 CCTAAATCAGGCTCTGAAAATGA 0: 1
1: 0
2: 71
3: 3048
4: 4463
Right 931390641 2:61840532-61840554 ATGATGTCATTAATGAGACAGGG 0: 1
1: 0
2: 2
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931390641 Original CRISPR ATGATGTCATTAATGAGACA GGG Exonic
901805032 1:11733205-11733227 ATGAGGTCTTTAAAGAGAGAAGG - Intergenic
906375423 1:45292814-45292836 TTTATGTATTTAATGAGACAGGG - Intronic
906788815 1:48640852-48640874 ATGATGTCCTTCATGAGATGGGG - Intronic
907526726 1:55058117-55058139 AAGATGTCATCAATGAGGCCTGG + Exonic
910324192 1:85985734-85985756 ATGAGGTCATTGAAGAGTCAGGG + Intronic
910479002 1:87638212-87638234 ATGAAGACATACATGAGACAAGG + Intergenic
911502739 1:98708719-98708741 ATGAAGCCTTGAATGAGACAGGG - Intronic
913011295 1:114686398-114686420 ATGTTGTCATAAATCAGAAAAGG - Intronic
913340036 1:117749506-117749528 CTGATGTCAATATAGAGACATGG - Intergenic
915826671 1:159085429-159085451 ATAGTGTCATTACAGAGACAGGG + Intronic
917174659 1:172220142-172220164 ATGATGTCATTGAAGAGAAAGGG + Intronic
917518836 1:175731621-175731643 ATGATTTCATTAAGGAGGCACGG + Intronic
919809968 1:201402799-201402821 GAGATGCCATTGATGAGACAGGG + Intergenic
920044747 1:203126133-203126155 ATGCTGTCAATAGTTAGACAGGG + Intronic
924380103 1:243455057-243455079 ATGCTGTAATTCATAAGACAAGG + Intronic
1062976697 10:1688779-1688801 GTGATGTCAGTGATGAGACAGGG - Intronic
1063162747 10:3431527-3431549 ATGAAGACCTGAATGAGACAAGG - Intergenic
1064476654 10:15697491-15697513 ATAATGTCATGAATAATACAGGG + Intronic
1064547336 10:16463895-16463917 ATGGGGTTATTATTGAGACAAGG - Intronic
1065846708 10:29749987-29750009 AAGAAGTCATTCATGAGATATGG + Intergenic
1066639833 10:37544678-37544700 ATGCTCACATTAATGAGAGAAGG + Intergenic
1068081890 10:52329240-52329262 CTGATGTCCTTAATGTCACATGG + Intergenic
1068327510 10:55513272-55513294 TTGATGTCATCAATGAGGCAGGG - Intronic
1068574605 10:58671104-58671126 ATGATCTCATTAAAGAGACAAGG - Intronic
1068614016 10:59091750-59091772 AGGATGTGAAAAATGAGACAAGG - Intergenic
1073939806 10:108683362-108683384 AAAATGATATTAATGAGACAAGG - Intergenic
1077759101 11:5071420-5071442 ATAATGTCAATAATGTCACATGG - Intergenic
1078712163 11:13804047-13804069 ATGAAGTCAAGAATAAGACATGG + Intergenic
1080053916 11:27885436-27885458 ATGATGCCCAAAATGAGACAAGG - Intergenic
1080655732 11:34256594-34256616 ATCAAGTCGCTAATGAGACATGG + Intronic
1081299082 11:41428220-41428242 CTGATGTCTTTCATGAGACTGGG - Intronic
1082694851 11:56349782-56349804 ACCAAGTCATTAATTAGACATGG - Intergenic
1085836086 11:79958128-79958150 ATAATCTCATTTATGAAACACGG - Intergenic
1087294750 11:96358005-96358027 ATGATGTCATTATCTAGACTGGG + Intronic
1087949325 11:104200782-104200804 ATGATTCAGTTAATGAGACAAGG + Intergenic
1087996922 11:104820891-104820913 ATGATGTCTTCAATGAGAACAGG + Intergenic
1089337712 11:117736426-117736448 ATGATGTCATTTCTGAGATTTGG - Intronic
1090325555 11:125883482-125883504 AGGATGTAATTAGTCAGACAAGG + Intergenic
1093064546 12:14643152-14643174 ATGATGTCTTGAATGGGAAATGG + Intronic
1093102316 12:15041913-15041935 ATGATGTTATAAGGGAGACATGG + Intergenic
1093678900 12:21977315-21977337 GTGATGACATTGATGACACAGGG - Intergenic
1093678963 12:21978137-21978159 GTGATGACATTGATGACACAGGG - Intergenic
1095123638 12:38448120-38448142 ATAATGGAATTAATGAGATATGG - Intergenic
1095161586 12:38923768-38923790 ATGAGATAATTAATGAGATACGG - Intergenic
1097421158 12:59381450-59381472 GTGATGACATTAAAGAGACTGGG - Intergenic
1097422591 12:59398713-59398735 ATGGGGTCATTATTGAGAGAAGG + Intergenic
1097961897 12:65539904-65539926 ATTATGTCATAAATGTAACAGGG - Intergenic
1098677026 12:73302446-73302468 ATGATGTAATGAATGAAAGATGG + Intergenic
1099144065 12:79016704-79016726 ATGATGTCATGGAGGAGGCATGG + Intronic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1100690673 12:97035494-97035516 GTGATGTCCTTCATGAGATAGGG + Intergenic
1102366170 12:112337306-112337328 ATGATATACTTGATGAGACAAGG + Intronic
1103247528 12:119470806-119470828 ATGATGTCAATAATAGCACAGGG - Intronic
1103347078 12:120258286-120258308 ATGATGACATTAATCAGACCAGG - Intronic
1104292072 12:127479457-127479479 AGGATGTGATTAATGACACCAGG - Intergenic
1106745490 13:32701031-32701053 TTGATGTAATATATGAGACAGGG + Intronic
1107344088 13:39440605-39440627 TTGCTGTCATTTTTGAGACAGGG + Intronic
1108066189 13:46579900-46579922 ATGAAGTTAATAATGTGACAAGG - Intronic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111528096 13:89499737-89499759 ATAATGTCCTAAATTAGACAAGG + Intergenic
1111653489 13:91123536-91123558 ATGATGCCATTGCTGAGATAAGG - Intergenic
1112568451 13:100571062-100571084 ACCATGGCATTAAAGAGACAGGG + Intronic
1113053852 13:106245783-106245805 AGGATCTCAATATTGAGACAAGG + Intergenic
1113433749 13:110272731-110272753 AAGATGTCAACAGTGAGACAAGG + Intronic
1115343733 14:32319851-32319873 ATGATGTCATTAGTATGAGAAGG + Intergenic
1120018238 14:79498523-79498545 ATGTTGGAATTACTGAGACAAGG - Intronic
1120757695 14:88259461-88259483 ATGATTTACTTACTGAGACAAGG + Intronic
1121679000 14:95777100-95777122 ATTAGGTAATTAATGAGAAAGGG + Intergenic
1121928029 14:97947152-97947174 GTTATGTCATAAATGAAACATGG - Intronic
1123431709 15:20223532-20223554 GTGATGCCATTCATGAGGCAGGG - Intergenic
1124156997 15:27234777-27234799 ATTACGTCATTCATGAGAGAGGG - Intronic
1124866423 15:33496478-33496500 AGGATGTCATGAATGAGGAATGG - Intronic
1125865601 15:43045078-43045100 GTAATGTCATTAATAAAACAAGG + Intronic
1127299878 15:57642815-57642837 ATCAAGTCATTAATGAGCTAAGG - Intronic
1133255260 16:4512636-4512658 TTGAAGTCATTGATGAGGCAGGG + Exonic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1136852943 16:33627708-33627730 TTGATGCCATTCATGAGGCAGGG + Intergenic
1138308774 16:56005298-56005320 ATGATATCATAAATGAGACAAGG - Intergenic
1140423196 16:74837703-74837725 ATGTTGTTATTTTTGAGACAGGG - Intergenic
1141351564 16:83303064-83303086 ATGATGGCATCAGAGAGACAAGG + Intronic
1141896844 16:86963772-86963794 ATGAGGTCATTAATCTGATATGG - Intergenic
1203114540 16_KI270728v1_random:1476128-1476150 GTGATGCCATTCATGAGGCAGGG + Intergenic
1147869798 17:43579132-43579154 CTGAAGTGATTAATGAGGCAGGG + Intronic
1149701972 17:58662822-58662844 AAAATGTCATTAATGTGACCGGG + Intronic
1152763740 17:82123826-82123848 ATGTTGAGATTTATGAGACATGG + Intronic
1153499896 18:5737817-5737839 ATGTTGACATTAAGGAGAAATGG - Intergenic
1153600564 18:6777288-6777310 ATGATGCCATTACTGAGACTGGG + Intronic
1153716514 18:7855277-7855299 ATGTAGTGATTAAGGAGACATGG + Intronic
1155078427 18:22383525-22383547 TTGATGACATTATTGAGACTTGG + Intergenic
1155744593 18:29338151-29338173 ATGATGTCTAAAATGAGACAAGG + Intergenic
1156139894 18:34094942-34094964 AAGATGTCATTTATGAAACCAGG - Intronic
1158348752 18:56542614-56542636 ATGATGTCACTAAAGGGAGAAGG - Intergenic
1158503826 18:58028275-58028297 ATTATGTCATTCTTGAGACAGGG - Intergenic
1159266608 18:66088394-66088416 ATGTTGTCATTTATGAGAATTGG - Intergenic
1159844229 18:73439723-73439745 TGGATGCCAGTAATGAGACAGGG - Intergenic
1163613641 19:18313522-18313544 TTGGTGTCTTTTATGAGACAGGG + Intronic
1163770338 19:19187179-19187201 AAGAGGACATTAATGAGACCGGG + Intronic
1165640472 19:37381045-37381067 ATGATGACATTGATAAGATAGGG - Intronic
925864021 2:8208922-8208944 TTGATGTCAGTAATGAAACTGGG + Intergenic
926093715 2:10066583-10066605 CTGATGCCAGGAATGAGACAGGG - Intronic
927419628 2:22916671-22916693 TTGAAGTCAATGATGAGACATGG + Intergenic
929592308 2:43155268-43155290 ATGCTGTCATTAACTAGCCAAGG + Intergenic
931390641 2:61840532-61840554 ATGATGTCATTAATGAGACAGGG + Exonic
931728158 2:65130440-65130462 GTGATGTCATCAGTGAGACGTGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
932502444 2:72195275-72195297 ATGCTGTCATCAGTGAGAAATGG - Intronic
932808815 2:74806546-74806568 TAGATGTCACTAATGAGACAAGG - Intergenic
933056930 2:77682219-77682241 AAGATGTCATCTATGAGAAATGG - Intergenic
933618986 2:84515629-84515651 ATTATGTCATTTTGGAGACAAGG + Intergenic
933927059 2:87103363-87103385 AAGATGTCATCTATGAGAAATGG - Intergenic
937484463 2:122300048-122300070 ATTTTCTCATTAATGAAACAGGG - Intergenic
938052100 2:128183330-128183352 ATGATGTCTTCAATGTTACAGGG - Intronic
940657360 2:156504596-156504618 ATGATATAATTAAAGATACAAGG + Intronic
941435936 2:165472266-165472288 ATAATTGCATTAATGAAACATGG - Intronic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
943802928 2:192085168-192085190 ATGATGTTAATACTGAGACCTGG + Intronic
943978511 2:194514423-194514445 ATCATGTCATTCGTGAGTCAAGG + Intergenic
944140914 2:196455489-196455511 ATAAAGTCATAAATGAGATAAGG - Intronic
944575655 2:201088733-201088755 ATTAATTCATTTATGAGACAGGG - Intergenic
945170700 2:206991787-206991809 AAGATCTCTTTAATGAGACAGGG - Intergenic
945534388 2:210995483-210995505 ATGAGCTCATTAAAGATACATGG - Intergenic
946855639 2:223947210-223947232 CTGATGAGATTAATAAGACATGG + Intergenic
948038176 2:234876597-234876619 ACCATGTCATTAATGAAATAAGG - Intergenic
1169140564 20:3225194-3225216 ATGTTTTTTTTAATGAGACAGGG - Intergenic
1169451000 20:5710975-5710997 ATAATCTCATTAATTAGATAGGG + Intergenic
1174282351 20:49448340-49448362 ATGATGTCATCATTGTGTCAAGG - Intronic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1176416224 21:6476425-6476447 TTGTTGTCATTGTTGAGACAGGG - Intergenic
1177264048 21:18761204-18761226 ATGATGTCCGTAATAAGATATGG - Intergenic
1177699392 21:24616267-24616289 TTGCTGTAATTAATGTGACAGGG - Intergenic
1179348792 21:40587128-40587150 ATAATCTCATCAATGAAACAAGG + Intronic
1179691724 21:43084759-43084781 TTGTTGTCATTGTTGAGACAGGG - Intergenic
1181893323 22:26084191-26084213 GGGTTGTCATTCATGAGACATGG + Intergenic
950944368 3:16929329-16929351 ATGTTGTCATTATGGAGAGAAGG - Intronic
950996457 3:17502768-17502790 ATAATGCCAGTATTGAGACAGGG - Intronic
951319999 3:21233091-21233113 ATGATGTCATTCATTGGCCAAGG - Intergenic
951699747 3:25483821-25483843 ATTTTATCATTAATGTGACAGGG + Intronic
951813921 3:26731691-26731713 AAGATGTCATTTATAAGACAAGG - Intergenic
951959679 3:28302824-28302846 ATGAGGTCACAAATGAGACCTGG - Intronic
952557464 3:34549158-34549180 ATCATGTCATTAACCAGGCATGG - Intergenic
955739167 3:62071577-62071599 AAAATATCATTAATGAGACAAGG - Intronic
956687687 3:71846098-71846120 ATGTTGTCATTAATTATAGATGG + Intergenic
956858001 3:73294681-73294703 ATGAGGTCATTACTGAGGCTTGG - Intergenic
958083245 3:88773861-88773883 TTGAAGTCATTCATGAGCCAAGG + Intergenic
959223269 3:103549416-103549438 ATGTTGTTTTTAATAAGACAAGG + Intergenic
961808129 3:129503681-129503703 ATGAGGTCAGTCATGAGAAAAGG + Intronic
962693470 3:137924906-137924928 ATGATATTATTAATGAGGTAAGG - Intergenic
962719906 3:138163390-138163412 ATGATCTTATTAATGTGACTGGG - Exonic
963425659 3:145119203-145119225 ATAATGTAATTAAAGGGACAAGG + Intergenic
963432104 3:145220660-145220682 ATTATGCCATGAATGGGACAAGG + Intergenic
963820184 3:149882748-149882770 ATCATGTTTTTAATGAGCCATGG + Intronic
964289854 3:155165673-155165695 ATTAAGTCATTCCTGAGACAAGG + Intronic
964507450 3:157415063-157415085 ATGGTGTCATTTATGAGAAAAGG - Intronic
968572764 4:1350910-1350932 ATGATGTTGTTTTTGAGACAGGG + Intronic
970032276 4:11690040-11690062 ATAATGTTATTAATAAGTCATGG + Intergenic
971352583 4:25866343-25866365 ATCATTTCATTAAAAAGACAAGG + Intronic
971464833 4:26945995-26946017 ATGATGTCATTAATGTTAGTTGG + Intronic
971908772 4:32765886-32765908 ATGGTGTCATTGAATAGACAAGG - Intergenic
972067942 4:34974949-34974971 ATGATGTCACTGAAGAGAGATGG - Intergenic
973005814 4:45005551-45005573 ATGTTGGAATTAATGAGACAAGG - Intergenic
973921470 4:55690208-55690230 AAGCTTTCATAAATGAGACAAGG + Intergenic
974068680 4:57104303-57104325 ATGATGTCCTGACTGAGACAGGG - Intronic
976383927 4:84433778-84433800 ATGATGTAATTAATTATAGATGG + Intergenic
979896130 4:126159726-126159748 TTGATGTCATTCAAGATACAAGG - Intergenic
980535121 4:134110001-134110023 ATTATGTCATTCATTTGACAAGG + Intergenic
981168634 4:141594134-141594156 ATTATGTCATTGAGGATACAGGG - Intergenic
983758685 4:171377169-171377191 ATGATGTCATAAGTGATCCAGGG - Intergenic
984939379 4:184918042-184918064 AGGAGGTCATTTATGAGAAAAGG + Intergenic
985338585 4:188922867-188922889 ATAAAGTCATTAATGAGGTAAGG + Intergenic
986231357 5:5867260-5867282 AGGAGGTCATTAATGACTCAAGG - Intergenic
987378006 5:17255339-17255361 ACTATGTCATTAATGTGAAATGG - Intronic
988659057 5:33244642-33244664 ATTGTGTTGTTAATGAGACAAGG - Intergenic
991048951 5:62252539-62252561 GTGATGCCATTCATGAGGCAGGG - Intergenic
991505910 5:67323875-67323897 ATTCTGACAATAATGAGACATGG - Intergenic
992007991 5:72498312-72498334 ATTATGTAATTAATGAGATTGGG - Intronic
993112513 5:83676084-83676106 GTGATATAATTAATGAGGCAGGG - Intronic
994655440 5:102587003-102587025 CTGAGTTCATTAATGATACATGG - Intergenic
996764231 5:127019687-127019709 GTGATGTCATCAAGGAAACAGGG - Intronic
999104300 5:149056418-149056440 AGCATGTCTTTCATGAGACATGG - Intronic
999121608 5:149214029-149214051 ATGATGTCAGGAAATAGACATGG + Intronic
1000250009 5:159485362-159485384 ATGATGTTATTAAAAAGAAAGGG - Intergenic
1003189212 6:3858471-3858493 ATGATTCCATTAATGTGAAATGG - Intergenic
1003711188 6:8592141-8592163 ATCATGGCATTGATGAGATAAGG + Intergenic
1004990826 6:21136598-21136620 ATGAAATAATTAATGAGTCATGG - Intronic
1005802164 6:29437794-29437816 ATGATGCCATTAATGTTACAGGG - Intronic
1006045430 6:31291759-31291781 AAGACCTCAATAATGAGACAAGG - Intronic
1007943943 6:45808406-45808428 AGCCTGTCATTAATGAGACAGGG - Intergenic
1008720512 6:54344394-54344416 ATGATGTCCTTGATGTGTCAGGG + Intronic
1008824413 6:55675720-55675742 GTGATGTCATTAAGGTTACATGG - Intergenic
1009503295 6:64443852-64443874 ATGAGGTCATAACTGAGACTGGG - Intronic
1009780920 6:68268522-68268544 ATTATGTCAATAATGATCCAAGG - Intergenic
1009795407 6:68460076-68460098 ATTATAAAATTAATGAGACAAGG - Intergenic
1010358165 6:74960429-74960451 ATGATGGCATTGATGTGAAAGGG - Intergenic
1010567160 6:77430368-77430390 ATGATGCTATAAATGAGAGAAGG - Intergenic
1010573496 6:77506202-77506224 ATGATGTAAATAATAACACATGG - Intergenic
1011993990 6:93561646-93561668 ATAATTTCATTCATGAAACAAGG - Intergenic
1012188691 6:96253944-96253966 ATGATTTTTTTTATGAGACAGGG - Intergenic
1012376909 6:98573180-98573202 ATAATGTCATTAGTGACAAACGG + Intergenic
1012394099 6:98775996-98776018 ATGTTTTCATTTATGAGATAGGG - Intergenic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1012947557 6:105484081-105484103 ATGAATTCATCAATCAGACAAGG - Intergenic
1013453653 6:110310188-110310210 ATGATTTCATAAGTGATACATGG - Intronic
1014061008 6:117072123-117072145 ATGATGTGATGAATGCAACAGGG - Intergenic
1014622857 6:123691146-123691168 AAGATCTAAATAATGAGACACGG - Intergenic
1014898399 6:126932228-126932250 ATGATGCCACTAATAAGACAGGG - Intergenic
1014953116 6:127582834-127582856 ATTTTGTAATTATTGAGACATGG + Intronic
1016228639 6:141773547-141773569 ATGATGTCATTTATGAGGAAAGG - Intergenic
1017437313 6:154428522-154428544 ATTATGTTAATAATGAGACATGG + Intronic
1019167240 6:170106872-170106894 ATAATGTCCTTAAGGAGACAGGG - Intergenic
1019190372 6:170247403-170247425 CTGATGTCATCAATCACACACGG - Intergenic
1020763552 7:12294784-12294806 AAGAAATCATTAATGAGAAAAGG - Intergenic
1022263570 7:28731291-28731313 ATGAGGTCATTGATAAGAGAAGG + Intronic
1022888577 7:34672883-34672905 ATTATTTCAATAATGGGACAAGG - Intronic
1024723663 7:52168143-52168165 ATGGTTTCATTCATGAGAGAAGG + Intergenic
1026047188 7:66914554-66914576 AATATTTCATTAATGAGACCCGG + Intergenic
1028563270 7:92198954-92198976 ATGATGTCATTAACCAAATAGGG + Exonic
1029645214 7:101850750-101850772 CTGATGTGTTTTATGAGACATGG + Intronic
1032330726 7:130976538-130976560 ATGATTTCATGAATATGACACGG + Intergenic
1032577758 7:133073545-133073567 GTGGTGTCATTAATGAGGTAAGG - Intronic
1032828733 7:135599487-135599509 ATGACTTTATTAATGAGGCATGG - Intronic
1034829020 7:154293073-154293095 ATGAAGTAATAAATGAGATATGG - Intronic
1035066996 7:156113364-156113386 ATGGGGACATTAATGGGACACGG - Intergenic
1037643160 8:20767044-20767066 ATGATGTTAGAAATCAGACATGG - Intergenic
1038235994 8:25755736-25755758 AAGATGTCATTTTTGAGATAAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041636416 8:60151269-60151291 ATGAAGGAATTAAGGAGACAAGG - Intergenic
1041660795 8:60399068-60399090 ATAAAGTCATTACTGAGACGTGG - Intergenic
1043749613 8:83919450-83919472 AAGATGTCATTAGTAAGACATGG - Intergenic
1044237239 8:89845092-89845114 ATGTTGTCAATATTGTGACATGG + Intergenic
1044249163 8:89986021-89986043 ATGACATCAGTAATGAAACAAGG + Intronic
1045466806 8:102477571-102477593 TTGTTGTCATTTTTGAGACAGGG - Intergenic
1048025967 8:130586923-130586945 ATGATGTCTTTGATGGGGCATGG - Intergenic
1051249631 9:15146325-15146347 ATGATGTCATTAAAAAGGCAGGG + Intergenic
1052832445 9:33227562-33227584 TTGTTGTCATTTTTGAGACAGGG + Intronic
1055192698 9:73545899-73545921 TTGATGTCAGCAATGAGAAAAGG - Intergenic
1056072165 9:82998666-82998688 ATGATTTAATTTATGAGCCAAGG + Intronic
1056738500 9:89231284-89231306 CTGAGGTCAGTAATAAGACAAGG + Intergenic
1202630892 M:15451-15473 TTAATGTCATTAAGGAGAGAAGG - Intergenic
1185937213 X:4271351-4271373 ATGATGAAATGAATGTGACAAGG + Intergenic
1186157204 X:6737954-6737976 ATGATGAGATTAATGAGAAGAGG + Intergenic
1187435553 X:19265605-19265627 CTGAAGTCATTAAGTAGACAGGG - Intergenic
1187987351 X:24828722-24828744 TAAATGTCATTCATGAGACAAGG - Intronic
1189090953 X:38082097-38082119 ATAATGTCAATAATGTGAGAAGG + Intronic
1189268502 X:39734269-39734291 ATGATGTCATATATGTGAAACGG - Intergenic
1189299713 X:39943680-39943702 ACGATGTAATTGAAGAGACAGGG + Intergenic
1190276733 X:48904028-48904050 ATCATATCATTAATGATCCAGGG - Exonic
1192108417 X:68339341-68339363 ATGATATCAAGAAGGAGACAAGG + Intronic
1193998486 X:88396559-88396581 ATGATGTCTATGAAGAGACATGG - Intergenic
1194497704 X:94637468-94637490 ATGATGCCAATAATGACCCACGG - Intergenic
1194820029 X:98494007-98494029 ATTATTTAATGAATGAGACAGGG + Intergenic
1195097384 X:101516278-101516300 ATAAAGTTATTAATTAGACATGG - Intronic
1195724839 X:107903794-107903816 ATGATGATATTAATGATGCAAGG - Intronic
1199004457 X:142678647-142678669 ATGATCTCATAGATGAGAAATGG + Intergenic
1199467485 X:148155509-148155531 ATTATGTCATTTATCTGACAAGG - Intergenic
1199834369 X:151573979-151574001 ATGTTGTCTGTAATGAGGCAAGG + Intronic
1201550826 Y:15214750-15214772 ATGATGAGATTAATGAGAAGAGG + Intergenic