ID: 931392320

View in Genome Browser
Species Human (GRCh38)
Location 2:61854601-61854623
Sequence ACTGGGAGCCTCCTTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931392320_931392328 30 Left 931392320 2:61854601-61854623 CCAATCAGAAGGAGGCTCCCAGT 0: 1
1: 0
2: 2
3: 15
4: 152
Right 931392328 2:61854654-61854676 AATAAAAGCCCAGAGTTGGGTGG 0: 1
1: 1
2: 4
3: 43
4: 350
931392320_931392325 26 Left 931392320 2:61854601-61854623 CCAATCAGAAGGAGGCTCCCAGT 0: 1
1: 0
2: 2
3: 15
4: 152
Right 931392325 2:61854650-61854672 GACCAATAAAAGCCCAGAGTTGG 0: 1
1: 0
2: 0
3: 11
4: 165
931392320_931392326 27 Left 931392320 2:61854601-61854623 CCAATCAGAAGGAGGCTCCCAGT 0: 1
1: 0
2: 2
3: 15
4: 152
Right 931392326 2:61854651-61854673 ACCAATAAAAGCCCAGAGTTGGG 0: 1
1: 0
2: 3
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931392320 Original CRISPR ACTGGGAGCCTCCTTCTGAT TGG (reversed) Intergenic
902633541 1:17720014-17720036 ACCAGGAGCCTCCTTCTCAGAGG - Intergenic
903105309 1:21073441-21073463 GGTGGGAGCCTCCTGATGATTGG - Intronic
906683945 1:47750551-47750573 ACTGGCTGCCTTCTTCTGAATGG + Intergenic
907471035 1:54673601-54673623 TCTGGAAGCTTCCTGCTGATGGG + Intronic
907838646 1:58135263-58135285 TCCAGGAGCCTCCTTCTGAGAGG + Intronic
909691286 1:78410175-78410197 ACTGGCAGCCTTCTTCTTCTGGG - Intronic
911501519 1:98692141-98692163 ACTAGTAGCCTCCTGTTGATTGG + Intronic
912393792 1:109323831-109323853 ACTGGGAGCTGCCTGCTGAGGGG + Intronic
914462501 1:147898060-147898082 CCTGGGAGCCTCCATCTTGTGGG - Intergenic
916018915 1:160776081-160776103 GCTGGGAGCCTCCTAGTCATGGG - Intergenic
918062787 1:181076599-181076621 TCTGGAAACCTCCTTCTGAAGGG + Intergenic
918303518 1:183225458-183225480 ACTGAGAGCCACCTTTTCATAGG - Intronic
920095060 1:203481152-203481174 GCTGGGAGCCTCCTTGGGACAGG + Intronic
923672515 1:236052777-236052799 TGTGGGAGCCCCCTTGTGATAGG + Intronic
924187776 1:241514197-241514219 ACTGGTAGTCTCATACTGATTGG - Intronic
1062834769 10:628529-628551 CCTGGGAGCCTCGCTCTGATGGG + Intronic
1066453940 10:35556626-35556648 GCATGGAGCTTCCTTCTGATAGG + Intronic
1068852444 10:61759448-61759470 ACCGTCAGCCTCCTTCTGAGTGG + Intronic
1069511812 10:69048138-69048160 ACTGGGAGCCTCTCTCTGAGTGG + Intergenic
1070328561 10:75402939-75402961 TCTGGGAGCCTCGGTCTGTTGGG + Intergenic
1074351694 10:112743975-112743997 ACTGGGACCCTCCCTGTGAAAGG + Intronic
1075582955 10:123635940-123635962 CCTGGGAGTCTCCTTCTGTTGGG - Intergenic
1075584786 10:123649844-123649866 TGTGGGAGCCCCCTTCTGATTGG + Intergenic
1075636472 10:124034325-124034347 ACTGTGAGCCTCCTTCTAGCTGG + Intronic
1076795029 10:132794206-132794228 AATGGGCGCCCCCTGCTGATGGG + Intergenic
1077754183 11:5007692-5007714 AATGGGTGCCTGCTGCTGATTGG + Intergenic
1079238954 11:18708995-18709017 CCAGGGAGCCTGCTTCTGACTGG - Intronic
1079593797 11:22215271-22215293 ACTCAAAGACTCCTTCTGATTGG - Intronic
1080714311 11:34783982-34784004 ACTGGGAGTCTCTGTCTGTTGGG - Intergenic
1084359003 11:68657471-68657493 ACTGGGACCCTCCCTAGGATGGG + Intergenic
1089189744 11:116645101-116645123 TCGGGGAGGCTCCCTCTGATGGG - Intergenic
1091082211 11:132681544-132681566 ACTGAGAGCCTCTTTCACATCGG + Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1095970695 12:47900221-47900243 AGAGGGAGCCTCCTTCTGAGAGG + Intronic
1096720679 12:53519225-53519247 ACTGGGAGCTTCCTAAGGATAGG - Intronic
1096954969 12:55516684-55516706 ACAGAGAGACTCCATCTGATTGG + Intergenic
1097148639 12:56959464-56959486 ACTGTTAGCTTCCTTGTGATGGG - Intergenic
1099017723 12:77364694-77364716 ATTTGGAGGCTCCTTCTGAAAGG + Intergenic
1099667320 12:85648942-85648964 ACAGGGAGCCTCTTTCCTATTGG + Intergenic
1103087299 12:118071415-118071437 ATTGTGAGCCTCCTTCTGCTGGG - Exonic
1103500272 12:121396347-121396369 ACTGGGAGCTTGCTTATGCTAGG + Intronic
1104320127 12:127742978-127743000 AATGGGTGCCTGCTGCTGATTGG + Intergenic
1104835566 12:131787691-131787713 ACTGGGACCCTCCTGCTCCTGGG + Intronic
1109566348 13:64120899-64120921 ACTGGGAGCCACCTCCCAATAGG - Intergenic
1118297823 14:64586345-64586367 AGTGTGCTCCTCCTTCTGATGGG - Intronic
1118983212 14:70732612-70732634 ACCGGCGGACTCCTTCTGATGGG - Exonic
1119535688 14:75400877-75400899 ACTGAGATCCTTCTTCTGAAAGG - Intergenic
1120236997 14:81903653-81903675 ACTTGGAGCCTGCTTCTGTGGGG + Intergenic
1120932650 14:89864915-89864937 ACTGAGGGCATCCTGCTGATTGG - Intronic
1121563633 14:94892918-94892940 ACTGGGAACGTCCATCTGAGTGG + Intergenic
1123683700 15:22782458-22782480 ACTCTGGGCCTCCTTCTGCTGGG - Intronic
1125918400 15:43509739-43509761 CCTGTGAGCCACGTTCTGATTGG - Intronic
1128402700 15:67300278-67300300 AGTGGGAGCCTCTTTCACATTGG + Intronic
1130605511 15:85313009-85313031 ACTAGCAGCCTCCTACTGGTGGG - Intergenic
1130974856 15:88766316-88766338 ACTGGGAGCTTACTTCAGAGTGG - Intergenic
1135663839 16:24318858-24318880 CCAGGGAGCCTCCTACTGGTGGG - Intronic
1136627918 16:31472966-31472988 GCTGGGACCTGCCTTCTGATTGG - Intronic
1137260402 16:46823162-46823184 ACTGGAAGGCTACTTTTGATTGG - Intronic
1144504411 17:15817764-15817786 CCTGGAAGCCTCTTTCTGATAGG + Intergenic
1144634164 17:16893432-16893454 CCTGGAAGCCTCTTTCTGATAGG + Intergenic
1144660999 17:17070984-17071006 ACTGGGAGGCTCCTCATCATGGG + Intronic
1145168264 17:20633277-20633299 CCTGGAAGCCTCTTTCTGATAGG + Intergenic
1145200241 17:20938351-20938373 CCTGGAAGCCTCGTTCTGATAGG + Intergenic
1146164353 17:30576242-30576264 CCTGGAAGCCTCTTTCTGATAGG + Intergenic
1146533923 17:33633482-33633504 ACAGGGAGCCTGTTTCTGCTGGG + Intronic
1147041824 17:37725403-37725425 GCTGTCAGCCTCCCTCTGATAGG - Intronic
1148992698 17:51680357-51680379 ACTGCCAGCTTCCTTCTGAATGG + Intronic
1151247009 17:72802894-72802916 ACTGGGAGCCACCTTCAGGCTGG + Intronic
1152600211 17:81258528-81258550 ACGGGGAGCCTCCTGCTGGCTGG + Intronic
1154135883 18:11777834-11777856 GCTGGTAGTCTCCTCCTGATGGG - Intronic
1156360226 18:36378223-36378245 ACTGGGAGTCTCCTGCTGCAAGG - Intronic
1156828086 18:41457361-41457383 AATGGGGGCCTCCTTCTCCTTGG - Intergenic
1156992816 18:43430439-43430461 AATGGGAGCTTGCTGCTGATAGG + Intergenic
1157699608 18:49752722-49752744 GCTGGGAGCCTGTCTCTGATTGG - Intergenic
1160384172 18:78485039-78485061 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384200 18:78485164-78485186 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384229 18:78485332-78485354 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384239 18:78485375-78485397 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384274 18:78485541-78485563 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384325 18:78485791-78485813 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384335 18:78485834-78485856 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384377 18:78486043-78486065 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384387 18:78486086-78486108 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384396 18:78486127-78486149 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384406 18:78486170-78486192 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384439 18:78486338-78486360 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384449 18:78486381-78486403 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384458 18:78486422-78486444 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384468 18:78486465-78486487 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1160384497 18:78486597-78486619 ACCTGCAGCCTCCTCCTGATGGG + Intergenic
1163272117 19:16260635-16260657 AGTGGGTGCCTCCTTCAGAGTGG + Intergenic
1163902767 19:20120240-20120262 ACTGTGAACCACCTTCTGTTGGG - Intronic
1164714475 19:30381417-30381439 ACAGGGTGCCTCATTCAGATGGG + Intronic
1166049277 19:40248446-40248468 ACAGGGAGACTCCTTCTCAGAGG + Intronic
1168468038 19:56619785-56619807 ACGTGGAGCCTCATTCTTATGGG - Intronic
926117432 2:10222257-10222279 ACTGGGAGGAGCCATCTGATGGG + Intergenic
931012178 2:57929616-57929638 ACGGAGAGACTCCTTCTGTTTGG - Intronic
931392320 2:61854601-61854623 ACTGGGAGCCTCCTTCTGATTGG - Intergenic
932092207 2:68816400-68816422 ACTAGGAGCTTCTTTCTGATGGG - Intronic
932219340 2:69987848-69987870 ACTGGGTGCCACCTTCAGGTAGG + Intergenic
933164711 2:79063530-79063552 ACTGTGAGTCTCCTTAAGATGGG + Intergenic
935450294 2:103201271-103201293 ACTGGGAGGCACCCTCTGGTAGG + Intergenic
938398552 2:130968361-130968383 AGGGAGAGCCTCCTTCTGAATGG - Intronic
941118574 2:161501669-161501691 GCTGGGAGCCTCTTTCTTCTTGG + Intronic
948225855 2:236308952-236308974 AGTGGGAGCCTCCAGCTGTTGGG + Intergenic
948419614 2:237848858-237848880 ACTGGGAGACACCTCCTGGTAGG - Intergenic
1169388009 20:5167396-5167418 AGTGGGGTCCTCCTTCTGTTTGG + Intronic
1172426036 20:34856755-34856777 ACTGGGAGGCTTCTCCTGAGGGG + Intronic
1172663613 20:36584204-36584226 ACTGGGAGCCTCCTGGTCAGGGG - Intronic
1174514779 20:51083328-51083350 GCTGAGAGCCTCCTTGTGCTAGG + Intergenic
1175767109 20:61599297-61599319 ACTGGGGACCTCCTTCTGCTGGG + Intronic
1177426755 21:20933421-20933443 ACTGGGGGGCTCCTTCTTATAGG + Intergenic
1177528190 21:22325639-22325661 ACTGGGTGGCTACTTTTGATTGG + Intergenic
1178263271 21:31119358-31119380 GAGGGGAGCCTCCTTCTCATGGG - Exonic
1178359930 21:31940688-31940710 TCTTGTAGCTTCCTTCTGATTGG - Intronic
1179162781 21:38911555-38911577 ATTGGGGGCCTCCTTCTCAGAGG + Intergenic
1181776396 22:25162920-25162942 ACTAAGAGCCTGTTTCTGATTGG + Intronic
1182835838 22:33340668-33340690 ACTGGGAGCCTTCTCCTGGGGGG + Intronic
951452704 3:22856951-22856973 CCTGGGAGACTGCTTCTGCTGGG + Intergenic
953481230 3:43254171-43254193 ACTGGCAGCTTCCCTCTGGTTGG + Intergenic
954801872 3:53191936-53191958 AATGGCAGCCTCCTTCCCATGGG + Intronic
955484767 3:59424328-59424350 AGTGGGTCCCTCGTTCTGATGGG + Intergenic
958553596 3:95645749-95645771 ACTGGGAGACTCCTTCCAGTAGG + Intergenic
960974994 3:123164670-123164692 ACTGGGAGCCTCCTGCGGGCAGG - Intronic
962885077 3:139617170-139617192 ACTGGGAGCGTCCCCCTGAGTGG + Intronic
963311783 3:143717583-143717605 CCTGGCTGCCTCCTTTTGATGGG + Intronic
965474054 3:169132083-169132105 TATGGGAGCACCCTTCTGATTGG - Intronic
970381762 4:15515333-15515355 ACTGAGAGCCTCCTTGTGCCAGG - Intronic
972658408 4:41089171-41089193 ACAGTCAGCATCCTTCTGATTGG + Intronic
973583735 4:52370831-52370853 CCAGGGAGCCTCCTTCTAACTGG - Intergenic
974160441 4:58131513-58131535 AATGTGACCCTCCTGCTGATTGG - Intergenic
975949907 4:79757493-79757515 AATGAAAGTCTCCTTCTGATGGG - Intergenic
978747167 4:112207947-112207969 ACTGGGGGCATCTTGCTGATCGG - Intergenic
979284800 4:118910231-118910253 ACTTGTAGCCTCCTTGTGACAGG + Intronic
980146192 4:128986946-128986968 ACAGAGAGACTCCTTCTGACTGG + Intronic
983543364 4:168935963-168935985 ACTGGGAGACACCTCCTGACTGG + Intronic
987065416 5:14285342-14285364 ACTGTGAGCCGCCTTCTGATTGG + Intronic
987681485 5:21142861-21142883 GCTGGGAGCCACCATCTGAGTGG + Intergenic
989156517 5:38349633-38349655 ATTGGGAGCCTGGGTCTGATCGG - Intronic
989287464 5:39719377-39719399 ACCAGGAGCCTCCATATGATTGG + Intergenic
997187629 5:131898341-131898363 ACTGGGAGACACCTTCTAGTAGG - Intronic
1000410165 5:160929359-160929381 ACAGAGAACCTCCTTCTCATGGG + Intergenic
1000987706 5:167879041-167879063 ACTGTGACCCTCCTAATGATGGG - Intronic
1001340257 5:170837037-170837059 ACTGGGAGAATCCTTCTGTGGGG - Intergenic
1002400804 5:178990778-178990800 CCTGGGAGCCTCCTCCAGCTCGG + Intronic
1005672417 6:28120475-28120497 ATTGGGAGCCTCCTTTTGTCTGG + Intergenic
1007375970 6:41456926-41456948 GCTGGGAGCCCCTTTCTGCTGGG + Intergenic
1007905579 6:45457312-45457334 ACTTGCAGCCTTCTTCTGTTGGG - Intronic
1008040384 6:46791353-46791375 ACTGGGGGCCTGCTTCTGATGGG - Intergenic
1015376784 6:132518853-132518875 TCTAGCAGCCTCCTTCTTATTGG + Intergenic
1025061707 7:55814034-55814056 ACAGAGAGACTCCTTCTGTTTGG + Intronic
1026302634 7:69110950-69110972 CTGGGGAGCCTCATTCTGATAGG + Intergenic
1026824055 7:73570398-73570420 ACCAGGAGACTCCTTCTGAAAGG + Exonic
1030703005 7:112662001-112662023 ACTAGGAGACACCTCCTGATAGG - Intergenic
1033449933 7:141453628-141453650 AAAGGGAGCCTCCCTCTGCTGGG + Intronic
1037369805 8:18163486-18163508 ACAGAGAGACTCCTTCTGCTTGG + Intergenic
1042557900 8:70049379-70049401 GCTGGGAGCCTCCCTCTGGAAGG + Intergenic
1045671709 8:104561766-104561788 ACTGGGAGTCCCCTTTTTATTGG + Intronic
1053937543 9:43179862-43179884 AGTGAGAGCTTTCTTCTGATGGG + Intergenic
1059860313 9:118452894-118452916 ACTGGTATTCTCCTTCTTATTGG - Intergenic
1061389045 9:130307154-130307176 ACTGGGAGCCTCCTGGTGCGAGG + Intronic
1061933003 9:133842947-133842969 CCTGGGTGCCGCCTTCTAATTGG + Intronic
1062046340 9:134426204-134426226 ACTGAGGTCCTCCTTCTGAAAGG + Intronic
1062092903 9:134687891-134687913 ACTGGGATCCACCCTCTGGTGGG + Intronic
1062121328 9:134835535-134835557 GCTGGGAGCCTCCCTCTCCTTGG + Intronic
1187521370 X:20017699-20017721 AATGGGAGCTTCTTTCTGATAGG - Intronic
1189167214 X:38872029-38872051 TCTGGTAGCTTCCCTCTGATTGG - Intergenic
1196825776 X:119739181-119739203 AATGGGAACCACCTTGTGATAGG + Intergenic
1199477296 X:148259846-148259868 ACTGGGAGACACCTTCCAATAGG - Intergenic
1201503984 Y:14677516-14677538 CCTGGGAGCTGCCTTCTAATAGG + Intronic