ID: 931395815

View in Genome Browser
Species Human (GRCh38)
Location 2:61887587-61887609
Sequence CGAGTTGAAATAGAAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931395815 Original CRISPR CGAGTTGAAATAGAAAAATC TGG (reversed) Intronic
905495563 1:38382882-38382904 GTAGTTGCAATGGAAAAATCAGG + Intergenic
907463113 1:54617561-54617583 TGAGATGAAATTGGAAAATCTGG - Intronic
908150595 1:61297572-61297594 AGAGTTAAAATAGGAAACTCAGG - Intronic
909508119 1:76418155-76418177 CAAGCTGAAATAGCAAAACCTGG - Intronic
910345130 1:86227880-86227902 CAAATTGAAATAAAAACATCTGG - Intergenic
911586535 1:99697501-99697523 GAAGTTAAAATAGGAAAATCTGG - Intergenic
915115070 1:153592925-153592947 CGAGTTGAAAGAAACAACTCAGG + Intergenic
915432454 1:155877266-155877288 CTACTAGAAATAGAAAAATTAGG - Intronic
917693782 1:177496684-177496706 TGAGTTGAAAAAGAAAAAAAGGG + Intergenic
917935930 1:179867037-179867059 TGAGTTAAAATATAAAGATCTGG + Intronic
918028583 1:180779588-180779610 CTAGTAGAAATACAAAAATTGGG + Intronic
918284901 1:183042628-183042650 GGAGTGGATATAGAAAAATAGGG + Intronic
921991036 1:221367352-221367374 AGATTTAAAATAGAAAAATAGGG - Intergenic
924074565 1:240319934-240319956 GGAGTTGAAATAGTACAATTCGG + Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064970954 10:21066470-21066492 CGATTTAAAATGGAAAAACCAGG + Intronic
1065906765 10:30261802-30261824 GTAGATGAAATAGAAAAATATGG + Intergenic
1071145238 10:82561733-82561755 AGAATTGGAATAGACAAATCTGG - Intronic
1071423220 10:85522887-85522909 GAAGTTGAAATCCAAAAATCTGG - Intergenic
1073168301 10:101477948-101477970 AGAGATAAAATAGAAAAATCAGG - Intronic
1073726571 10:106238385-106238407 CGTCTTAAAATAGAAAAATTTGG - Intergenic
1074035300 10:109732684-109732706 AGAGATGAAATAGGAAACTCTGG + Intergenic
1075852548 10:125601067-125601089 CTGGTTGAAATAGAAGACTCAGG + Intronic
1075942289 10:126401191-126401213 AGAGTTGATACAGAAAAGTCAGG - Intergenic
1076336633 10:129710951-129710973 CAGGTTGAAATAGATAAACCTGG - Intronic
1076639600 10:131905225-131905247 AGAGTTAAAATAGTAAAACCAGG + Intronic
1080361998 11:31525916-31525938 TGAGTTTAAAGAGAAAAATACGG - Intronic
1080694998 11:34595828-34595850 CCTACTGAAATAGAAAAATCTGG - Intergenic
1082254314 11:50015588-50015610 TAAGTTAAAACAGAAAAATCTGG - Intergenic
1083562143 11:63681559-63681581 GGAGGGGAAATAGAATAATCCGG - Exonic
1086744462 11:90407747-90407769 CTACTTGACATTGAAAAATCTGG - Intergenic
1088439771 11:109856936-109856958 AGAGTTGAAATGAAACAATCTGG - Intergenic
1090111669 11:123917167-123917189 TGAGTGGAAAAAGAAAAATGTGG + Intergenic
1093410434 12:18858726-18858748 AGAGTGGAAACAGAAAAATCTGG + Intergenic
1097675436 12:62597290-62597312 GGAATTAAAAGAGAAAAATCAGG - Exonic
1101047709 12:100827386-100827408 CAAGTTTAAATAGAAAGACCAGG - Intronic
1104069855 12:125335186-125335208 GGTGTTGAAAAAGAAAAGTCAGG - Intronic
1106025322 13:25950401-25950423 CTACCTGAAAAAGAAAAATCAGG + Intronic
1106749393 13:32744567-32744589 CGAGGTTAAATAGAAACCTCTGG + Intronic
1106974743 13:35196196-35196218 CCAGTTGAAATAGCAGAATGTGG + Exonic
1107347652 13:39479598-39479620 CGATTTCCAAAAGAAAAATCTGG - Intronic
1108280760 13:48859194-48859216 AGAGATTAAAAAGAAAAATCAGG + Intergenic
1108775110 13:53756487-53756509 AGTGTTGAAGTAGAAAAATATGG + Intergenic
1109863335 13:68228481-68228503 AGTGTTGATATAGAAAAATCTGG + Intergenic
1115532298 14:34338684-34338706 TTAGTTCAAAGAGAAAAATCTGG + Intronic
1118354883 14:65004962-65004984 CAATATGAAAAAGAAAAATCTGG - Intronic
1121358792 14:93236140-93236162 CTACTAAAAATAGAAAAATCAGG - Intergenic
1124259001 15:28170233-28170255 AGAATAGAAATAGAAAAATAAGG + Intronic
1127115349 15:55721041-55721063 CCAACTGAAATAGAAAATTCAGG - Intronic
1127274638 15:57431504-57431526 CCAGATGAAATTGAAAGATCAGG - Intronic
1130659620 15:85820394-85820416 CGAGCTGAAATAGAAAATTATGG - Intergenic
1134611793 16:15614943-15614965 CTACTAAAAATAGAAAAATCAGG - Intronic
1134895755 16:17885433-17885455 AGAGTTAATATAGGAAAATCAGG - Intergenic
1137327273 16:47453854-47453876 AGGGTTGAAAAAGAAAAATCAGG + Intronic
1139790688 16:69431894-69431916 TGAGTTGAGAAAGAAAAATCAGG + Intronic
1140377945 16:74460319-74460341 CTACTAGAAATACAAAAATCAGG - Intronic
1142869663 17:2811877-2811899 CTAGTAAAAATACAAAAATCAGG - Intronic
1146631586 17:34473999-34474021 GGAGCTGAAATACACAAATCTGG - Intergenic
1147782436 17:42953278-42953300 CTACTAAAAATAGAAAAATCAGG - Intronic
1149314371 17:55424474-55424496 AAGGTTGAAATAGAAATATCTGG + Intergenic
1150989973 17:70245990-70246012 CAATTTGAAATACAAAAAACAGG - Intergenic
1151243982 17:72780110-72780132 TGAGTTGAAATAGAAAAAGAAGG - Intronic
1152079938 17:78180539-78180561 CCTGAGGAAATAGAAAAATCTGG + Intronic
1153038084 18:783497-783519 TGAGTTGAATTGGAAAAACCAGG + Intronic
1153085093 18:1276340-1276362 GGAGATGCAATAAAAAAATCAGG - Intergenic
1154050306 18:10949575-10949597 CCAGATGGAATAGAAAAATGTGG - Intronic
1155158635 18:23178209-23178231 CTGGTTGAAAAAAAAAAATCAGG - Intronic
1157267783 18:46243627-46243649 AGAATTGAAATGGAAAATTCAGG - Intronic
1164569383 19:29360659-29360681 CGAGTTGAAGTAGTAAAAGTGGG - Intergenic
1165977017 19:39685064-39685086 CCACATAAAATAGAAAAATCTGG - Intergenic
1167237509 19:48323811-48323833 CTACTTGAAACAGGAAAATCAGG - Intronic
1167798183 19:51724286-51724308 TGAGGTGGAAGAGAAAAATCAGG - Intergenic
931395815 2:61887587-61887609 CGAGTTGAAATAGAAAAATCTGG - Intronic
932772586 2:74508711-74508733 AGAGTGGTAATAGAAAAAGCAGG + Intergenic
933803067 2:85978317-85978339 GGAGCTGAAATAGAAAGATGCGG - Intergenic
934056770 2:88257931-88257953 CTGGTTGGAATAGAAAAACCAGG + Intergenic
934168421 2:89318715-89318737 ATAGATGAAACAGAAAAATCAGG - Intergenic
934198866 2:89863867-89863889 ATAGATGAAACAGAAAAATCAGG + Intergenic
935183034 2:100706980-100707002 CAAGTTGCAATAGAAAACCCAGG - Intergenic
937732037 2:125244695-125244717 TGATTTGAAATAAATAAATCAGG - Intergenic
939741911 2:145918378-145918400 AGAGTTAAGATAGGAAAATCAGG + Intergenic
939842109 2:147201771-147201793 GGAGTAGAACTAGAAACATCAGG + Intergenic
942423436 2:175833409-175833431 CTTGTTGAAATAGAAATGTCAGG - Intergenic
944016028 2:195039184-195039206 GGGGTTGATATAGAAATATCAGG + Intergenic
944481820 2:200164945-200164967 CTAGTTGAATTAGAATAATTAGG + Intergenic
1169051772 20:2584583-2584605 TGAGTTGAAATGGAAAGTTCAGG - Intronic
1169127542 20:3140706-3140728 AAAGTTGAAAAAAAAAAATCTGG - Intronic
1172742936 20:37183493-37183515 CGAGTTAATACAGAAAGATCTGG - Intronic
1174259423 20:49282965-49282987 CGAGTGGAAAGGGAACAATCTGG + Intergenic
1175359846 20:58400482-58400504 AGAGGTGATATAGAAAAAACTGG - Intronic
1176877400 21:14146473-14146495 ATAGTTGAAATGGAAAAATGAGG - Intronic
1177207944 21:18031911-18031933 CAAGTAGAAATAGAATAATTTGG - Intronic
1177898981 21:26890295-26890317 CTAGTTGATAAAGAAAAACCTGG + Intergenic
1177973005 21:27813635-27813657 TGAGTTTAAATATAAAAACCTGG + Intergenic
1180591750 22:16944529-16944551 CAAGGTGAAAGGGAAAAATCTGG - Intergenic
1181338993 22:22163760-22163782 CAAGTTGAAAAAGGAGAATCAGG - Intergenic
1182532744 22:30973354-30973376 GGATTTGAAGTAGAAAAAACAGG - Intergenic
949988535 3:9558947-9558969 CTAGTAAAAATAGAAAAATTAGG - Intergenic
953196325 3:40737851-40737873 GGAGTAGAAATAAAAAAAACAGG - Intergenic
956515530 3:70042576-70042598 CTAGTGGAAAGAGAAAAATAAGG - Intergenic
957726671 3:84074803-84074825 TGTAATGAAATAGAAAAATCAGG + Intergenic
957941779 3:87015178-87015200 TGAGTTTAAATATATAAATCTGG - Intergenic
957963403 3:87290050-87290072 TCAGTTAAAAAAGAAAAATCTGG + Intergenic
959001376 3:100968083-100968105 GGAGTTCTAATAGAACAATCTGG + Intronic
960317320 3:116194168-116194190 CTAGTTTACATGGAAAAATCTGG - Intronic
962625204 3:137219258-137219280 AGAGGGGAAAGAGAAAAATCTGG + Intergenic
963507800 3:146209021-146209043 CGAGTGGATAAAGAAAAATGTGG + Intronic
968709207 4:2100731-2100753 GGAGTAAAAATAGATAAATCAGG + Intronic
969155153 4:5203716-5203738 TGGGTTGGAATAGAAAAATTAGG - Intronic
970677334 4:18465803-18465825 CGACTTGTAAAAAAAAAATCTGG + Intergenic
970939511 4:21615131-21615153 AGAGTGAAAGTAGAAAAATCAGG + Intronic
971912936 4:32819596-32819618 AGAGTGGAAATAGAAAACTGGGG - Intergenic
973817986 4:54635962-54635984 CTAGTTGAAATAGGATAGTCAGG - Intergenic
978312986 4:107406666-107406688 AAAGTTACAATAGAAAAATCAGG - Intergenic
981494396 4:145375465-145375487 GGAGGGGAAATAGAATAATCTGG - Intergenic
981540469 4:145841452-145841474 GGAAAGGAAATAGAAAAATCAGG + Intronic
981802305 4:148672560-148672582 GGAAGTGAAATAGAAAAATGTGG + Intergenic
983682540 4:170370448-170370470 CTAATAGAAATAGAAAATTCAGG - Intergenic
989168530 5:38453302-38453324 TGAATTGAAATAGACAAAGCAGG + Intronic
992762934 5:79967477-79967499 CAAGTGGAAATAGAAACATCTGG + Intergenic
993288114 5:86028061-86028083 CTAATAGAAATAGAAAAATTTGG - Intergenic
993748835 5:91640238-91640260 AAAGTTGGAATAGAAACATCTGG + Intergenic
994795966 5:104300016-104300038 CGAGTATAAATAGAATACTCAGG + Intergenic
995401097 5:111742623-111742645 CGTGGTGAAAAAGAAAAGTCGGG - Intronic
996483558 5:124003332-124003354 TGAAGTGCAATAGAAAAATCTGG + Intergenic
997444138 5:133929026-133929048 CCAGTTAAAATAGAGAAATAGGG + Intergenic
997800426 5:136855206-136855228 GGAATTGAAAGAGAAAAAACAGG + Intergenic
999423785 5:151468091-151468113 CTAGTAAAAATAGAAAAATTAGG + Intronic
999620155 5:153464778-153464800 AGAGTGGAAAGAGAAAAATTAGG - Intergenic
1000057577 5:157621057-157621079 CCAGTTTAAATAGAAAAAGAGGG + Intergenic
1000524728 5:162343099-162343121 TTAATTGAATTAGAAAAATCAGG + Intergenic
1002855398 6:1032850-1032872 TGAGTTGAAATAGCCAAAGCAGG + Intergenic
1003763065 6:9203848-9203870 GGAGGAGAAAGAGAAAAATCAGG + Intergenic
1005883438 6:30076481-30076503 AGAGTTGAAATAGATAATACCGG - Intergenic
1009555367 6:65157387-65157409 AGTATAGAAATAGAAAAATCTGG - Intronic
1011444679 6:87425282-87425304 GGAGATGATATAGAAAAATACGG - Intronic
1012542978 6:100383008-100383030 GTAGTTGAAATAGCAAAACCAGG + Intergenic
1013283482 6:108660704-108660726 CTAGTTAAAATACAAAAATTAGG + Intronic
1013442798 6:110188583-110188605 GGAGCTGAATTAGAATAATCTGG - Intronic
1015787839 6:136936354-136936376 CCAGTTGAAAGAGAAAACTATGG - Intergenic
1016121191 6:140343179-140343201 GGAGTTGAAATAGGAAAAACAGG + Intergenic
1016298965 6:142608309-142608331 CGAATAGAAATAGGGAAATCAGG + Intergenic
1017523332 6:155221088-155221110 CAAGATGAAAGAGAAAAGTCTGG - Intronic
1019842432 7:3461547-3461569 CGAATTCAAGTATAAAAATCTGG + Intronic
1020513275 7:9086230-9086252 CAAGAAGAAATAGATAAATCTGG + Intergenic
1020912418 7:14148542-14148564 TGAGTGGAAATAAAAATATCAGG - Exonic
1021738924 7:23665884-23665906 CGATTTGAGAGAGAAGAATCAGG - Intergenic
1022923084 7:35036293-35036315 CTAGTTGACTTAGAAAAATTAGG + Intronic
1024889543 7:54184500-54184522 TCAATTGAAATAGAAAAACCTGG - Intergenic
1026992676 7:74596158-74596180 CAACTGAAAATAGAAAAATCAGG + Intronic
1027736386 7:81937941-81937963 ACAGTTGAAATAGAAACAACTGG + Intergenic
1032072491 7:128817084-128817106 ATATTTGAAGTAGAAAAATCAGG - Intronic
1033055958 7:138054482-138054504 TGAGTATACATAGAAAAATCTGG - Intronic
1034053890 7:148014154-148014176 CGAGTTGACAAACGAAAATCTGG + Intronic
1034720857 7:153290987-153291009 CGAGTTGAAATTTTAAAAACTGG + Intergenic
1037026365 8:14043176-14043198 GGAGTTGAACTAGAAAAATGAGG + Intergenic
1039513996 8:38116060-38116082 CTAGTGAAAATAGAAAAATTAGG + Intronic
1039770462 8:40681185-40681207 CGAGTTGACATTGAAATATGGGG - Intronic
1040042260 8:42927980-42928002 CTAGTAAAAATAGAAAAATTAGG + Intronic
1041040773 8:53843675-53843697 TGATTTTAAATAGAAAACTCGGG + Intergenic
1042038050 8:64559580-64559602 TGAGTTAAAATAGAGAAACCAGG - Intergenic
1044871365 8:96623291-96623313 CGTGTTGAAATGGAAAAATGTGG - Intergenic
1045692581 8:104774776-104774798 TGAGTTAAAAAAAAAAAATCTGG + Intronic
1049998926 9:1055659-1055681 CGAGTAGAAAAAGAAAAAAAAGG - Intronic
1050154090 9:2647502-2647524 CCAGCTAAAATAGAAAAAGCAGG + Exonic
1053166807 9:35850385-35850407 AGAAGTGACATAGAAAAATCAGG - Intronic
1053452989 9:38208976-38208998 GGAGTTTAAATAGAAGAATGAGG - Intergenic
1055237684 9:74143592-74143614 AGATTTAAAATAGAAAAATAAGG - Intergenic
1058303595 9:103408019-103408041 CAAGTAGAAAGGGAAAAATCTGG + Intergenic
1059878172 9:118659516-118659538 AGTGTAGAAGTAGAAAAATCAGG + Intergenic
1060236371 9:121866357-121866379 ACATTTGAAAAAGAAAAATCCGG + Intronic
1188593275 X:31865056-31865078 TGAGTTGAAGTAGAATAATAAGG - Intronic
1188867186 X:35327718-35327740 CAAGTTGAGAGAGAAACATCTGG - Intergenic
1190092712 X:47453545-47453567 CGAGTTGAACTGGAAATATGTGG + Intronic
1195067402 X:101250217-101250239 TGAGTTCAGAGAGAAAAATCAGG - Intronic
1196320804 X:114338056-114338078 TGAGTTGATATAGAAAAGTCAGG - Intergenic
1196328025 X:114432004-114432026 CAACTAGAAAGAGAAAAATCTGG + Intergenic
1196513553 X:116543716-116543738 GGAATTGAAATAGAAATATGTGG - Intergenic
1196785694 X:119419737-119419759 GGAATTGAAATGGAAAACTCTGG - Intronic
1197474119 X:126898868-126898890 CTAAGTGAAATAGAAAAACCTGG + Intergenic
1197576798 X:128222975-128222997 AGAGTTGAATTAGAAGAATCAGG + Intergenic
1198581371 X:138068365-138068387 CTATATGAAATAGACAAATCAGG + Intergenic
1199154456 X:144530178-144530200 CGAGATGACATAGACAAATGGGG - Intergenic
1199346040 X:146741685-146741707 CCAGTTGAAATAAAACAATATGG - Intergenic
1200802518 Y:7399481-7399503 CGAGTGGAAAAGGAAAAATTTGG - Intergenic
1201145538 Y:11063311-11063333 AGAGAAGAAAAAGAAAAATCTGG + Intergenic