ID: 931396142

View in Genome Browser
Species Human (GRCh38)
Location 2:61889545-61889567
Sequence CCGCGAGGTGGGGTGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 362}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931396131_931396142 4 Left 931396131 2:61889518-61889540 CCCTCCTTTAACTCCGGCTGGAT 0: 1
1: 0
2: 0
3: 24
4: 99
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396126_931396142 17 Left 931396126 2:61889505-61889527 CCACCCGGAGGTGCCCTCCTTTA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396135_931396142 -9 Left 931396135 2:61889531-61889553 CCGGCTGGATCTATCCGCGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396133_931396142 0 Left 931396133 2:61889522-61889544 CCTTTAACTCCGGCTGGATCTAT 0: 1
1: 0
2: 0
3: 0
4: 33
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396128_931396142 13 Left 931396128 2:61889509-61889531 CCGGAGGTGCCCTCCTTTAACTC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396123_931396142 26 Left 931396123 2:61889496-61889518 CCACCGCGCCCACCCGGAGGTGC 0: 1
1: 0
2: 7
3: 54
4: 550
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396127_931396142 14 Left 931396127 2:61889508-61889530 CCCGGAGGTGCCCTCCTTTAACT 0: 1
1: 0
2: 0
3: 16
4: 129
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396124_931396142 23 Left 931396124 2:61889499-61889521 CCGCGCCCACCCGGAGGTGCCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396132_931396142 3 Left 931396132 2:61889519-61889541 CCTCCTTTAACTCCGGCTGGATC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362
931396125_931396142 18 Left 931396125 2:61889504-61889526 CCCACCCGGAGGTGCCCTCCTTT 0: 1
1: 0
2: 1
3: 6
4: 96
Right 931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG 0: 1
1: 0
2: 3
3: 29
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931396142 Original CRISPR CCGCGAGGTGGGGTGGGCGC CGG Intronic