ID: 931396895

View in Genome Browser
Species Human (GRCh38)
Location 2:61895726-61895748
Sequence GCAGGCAGTACTGGCCCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931396895_931396901 5 Left 931396895 2:61895726-61895748 CCGTTAGGGCCAGTACTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 931396901 2:61895754-61895776 GACTCACCCAGTGACCTAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 104
931396895_931396907 27 Left 931396895 2:61895726-61895748 CCGTTAGGGCCAGTACTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 931396907 2:61895776-61895798 GAAGCTTACCAGGAAACAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 191
931396895_931396904 17 Left 931396895 2:61895726-61895748 CCGTTAGGGCCAGTACTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 931396904 2:61895766-61895788 GACCTAGCAGGAAGCTTACCAGG 0: 1
1: 0
2: 0
3: 6
4: 88
931396895_931396906 24 Left 931396895 2:61895726-61895748 CCGTTAGGGCCAGTACTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 931396906 2:61895773-61895795 CAGGAAGCTTACCAGGAAACAGG 0: 1
1: 1
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931396895 Original CRISPR GCAGGCAGTACTGGCCCTAA CGG (reversed) Intronic
900139904 1:1135226-1135248 GCAGGCAGTGGGGGCCCTCAGGG + Intergenic
900429195 1:2593924-2593946 GCAGGGAATACTGTCCCCAAGGG + Exonic
900518152 1:3092954-3092976 GCAGGAAGCACTGGGCCTGAGGG - Intronic
901202117 1:7472895-7472917 CCAGGCGGTCCTGGCCCCAAAGG + Intronic
901882303 1:12201303-12201325 GCAGGCTGTACTGGGCCTCTGGG + Intronic
903649272 1:24913198-24913220 GCAGCCAGGACAGGCCCTGAGGG - Intronic
903674469 1:25055428-25055450 GCAGGGACGACAGGCCCTAATGG - Intergenic
905550378 1:38833217-38833239 GGAGGCAGAACTGGGCCTTAGGG - Intergenic
917901586 1:179548120-179548142 GCAGGCACTACTGGCCATCGGGG + Intronic
919766254 1:201129173-201129195 GCAGGCAGTGCTGGCTCTGAGGG - Intergenic
921570596 1:216773830-216773852 TCAGGCAGTACAGCCCCTGATGG + Intronic
923748060 1:236721400-236721422 GCCTGCAGTACTTGCCCTTATGG + Intronic
1067563088 10:47317604-47317626 GCAGTCAGAACTGGCCCTGGTGG + Intergenic
1068000733 10:51331246-51331268 GCAGGCAGTCCTGGCCGCAGTGG - Intronic
1072805672 10:98422744-98422766 ACGGGCAGTTCTGGCCCTACAGG + Intronic
1073452474 10:103618017-103618039 TCAGGCAGCACTGGCCCAAGTGG + Intronic
1074696040 10:116050967-116050989 GCTGCCAGTACTGGCCCCAGTGG - Intergenic
1081771966 11:45655730-45655752 ACAGGCAGGACTGGCCCACATGG + Intronic
1082999059 11:59275201-59275223 GCAGGCAGAACTGTCCCGAGAGG + Intergenic
1084573818 11:69975983-69976005 GCGGGAAGGACTGGCCCTTAGGG + Intergenic
1091800309 12:3320880-3320902 GCAGGGACTACTGGCCTTTAAGG + Intergenic
1092161399 12:6317320-6317342 GGAGGCAGTACTGGACATAGGGG - Exonic
1094459768 12:30682967-30682989 GCAGCTACTACTGGCACTAAAGG - Intronic
1094675025 12:32611778-32611800 GCAGGCAGTAGTGGCCCATCTGG + Intronic
1096172917 12:49487861-49487883 GCTGGCATTACTGGGCTTAATGG + Intronic
1096793542 12:54060139-54060161 GCAGGCAGAGCTGACCCTAGAGG - Intergenic
1097275163 12:57808145-57808167 GCAGACAGCACTGGCCTTCATGG - Intronic
1097406686 12:59198073-59198095 GAAGTCAGTACTGGTCCTAGAGG + Intergenic
1099260583 12:80375833-80375855 GCAGGCTGTTCTGCCCCTTATGG - Intronic
1104752775 12:131250612-131250634 GCAGGCAGCCCTGGCTCTCAGGG + Intergenic
1105604943 13:21919517-21919539 GAGGGCAGGACTGGCCCTGAAGG + Intergenic
1110362866 13:74647410-74647432 TCACACAGTACTGGCCATAAAGG + Intergenic
1117107247 14:52410440-52410462 GAATTCAGTACTGGGCCTAAAGG - Intergenic
1125624137 15:41092547-41092569 GCAAGCTGTAATGGCCCAAAAGG + Intronic
1129102890 15:73282960-73282982 GCAGGCAGTAACAGCCCTCATGG + Exonic
1131259350 15:90880562-90880584 GCAGGCACTTCTGGCCCCATGGG + Intronic
1131791606 15:95971745-95971767 GCAGGCAGCACCAGCCCTGAGGG - Intergenic
1132087823 15:98922529-98922551 GCAGGCAGGCCTGGGTCTAAGGG - Intronic
1133691353 16:8218634-8218656 GCAGGCACTATTCTCCCTAAAGG + Intergenic
1137486419 16:48895191-48895213 GCAGGCAGGACTGGATCTCATGG + Intergenic
1139696652 16:68679983-68680005 GTAGGCAGTACTTTCCCTAAGGG - Intronic
1140602407 16:76492923-76492945 GCAAGCACAACTGGCCTTAAAGG - Intronic
1144730018 17:17520763-17520785 GCAGGCAGCCCTGGCCCAAAGGG + Intronic
1148103383 17:45106301-45106323 GCAGGCAGGTCTGGCCCTGCAGG - Exonic
1148128201 17:45247605-45247627 GGAGGCAGGACTGGCGCAAATGG - Intergenic
1148334321 17:46831633-46831655 GCAGGCAGGTCAGGCCCAAAAGG + Intronic
1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG + Intergenic
1150121286 17:62605346-62605368 GGAGGCAGTAATGTCCCTATAGG - Intronic
1154106660 18:11529369-11529391 GCAGGAAGTACTGTGTCTAATGG - Intergenic
1156588662 18:38461074-38461096 GAAGCCAGTACCAGCCCTAAAGG - Intergenic
1158382842 18:56953569-56953591 TCAGGCAGTCCCTGCCCTAAAGG + Intronic
1160674868 19:384594-384616 GTAGCCAGGACTGGCCCTGAAGG - Intergenic
1161167938 19:2798521-2798543 GCACACAGCGCTGGCCCTAAGGG - Intronic
1162743636 19:12786947-12786969 TCTGGAAGTCCTGGCCCTAAGGG - Intronic
1163741601 19:19017299-19017321 GCAGGCAGAGCTGCCCCTGATGG - Intronic
925300995 2:2812319-2812341 GCAGGCATTACTGGCTGTACTGG + Intergenic
931396895 2:61895726-61895748 GCAGGCAGTACTGGCCCTAACGG - Intronic
931952742 2:67383298-67383320 GATGTCAGTACTGCCCCTAAGGG - Intergenic
932046638 2:68356809-68356831 GCAGGGAGTGCTGTCCCTAGTGG + Intergenic
932949702 2:76278775-76278797 GTCAGCAGTACTGGCACTAAGGG - Intergenic
937040584 2:118817654-118817676 GGATGCAGGACTGGCCCTGAGGG - Intergenic
937365363 2:121257304-121257326 CCAGGCAGTACTGTCCCTCCCGG + Intronic
937487575 2:122331809-122331831 ACAAGCAGTACTTGCCCGAAGGG + Intergenic
938877254 2:135545263-135545285 GCAGAGAGTACTTGCCCTTATGG + Intronic
943529162 2:189057327-189057349 GCAGGAACTCCTGGCCCCAAGGG - Exonic
947873060 2:233450362-233450384 GGAGGCAGTCCTCGCCCTGATGG - Intronic
948823379 2:240561404-240561426 GCAGGCAGGACTGGGCCTGGAGG - Exonic
1172021962 20:31920823-31920845 GCAGGCAGCACTAGCTCTCAGGG - Intronic
1172139678 20:32713583-32713605 CCAGTCAGTACTGACCCTGAAGG + Intronic
1174594161 20:51670217-51670239 GCAGTCAGTACTGTCCCTGCTGG + Intronic
1175353922 20:58346915-58346937 GAAGGCAGTCCTTGCCCTCAAGG - Intronic
1175423759 20:58851834-58851856 GCAGGCTGTAGTGGGGCTAAAGG + Intronic
1176069365 20:63218043-63218065 GGAGGCAGCACTGGCCCTGCGGG + Intergenic
1180214012 21:46313541-46313563 GCAGGCATAACTGGCCCTGATGG + Intronic
1181037946 22:20178942-20178964 GAAGGCAGTCCTGTCCCTCAAGG - Intergenic
1181312961 22:21955409-21955431 GAAGGCAGTTCTGGCCTAAAAGG + Intergenic
1181346068 22:22221481-22221503 GAAGGCAGTTCTGGCCTAAAAGG + Intergenic
1183521328 22:38297729-38297751 TCAGGCTGTCCTGGCCCTCAAGG + Intronic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
951203763 3:19903820-19903842 CCAGGCAGTATTGGCTCTAGAGG - Intronic
953484851 3:43285979-43286001 GAATGCAGTGCTGGCCTTAAAGG - Intergenic
953662116 3:44898950-44898972 GCAGGCAGAACTTGCCATGAGGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
956496236 3:69829850-69829872 TCAGGCATCACTGGCCCTAAGGG - Intronic
956847780 3:73198996-73199018 GAAAGCAGTACTGACCCCAAAGG - Intergenic
962343199 3:134602108-134602130 CCAGGCAGTGCTGGCTCTCAGGG + Intronic
963332237 3:143927355-143927377 GCAGGGAGTTCTGGCCCAAGAGG - Intergenic
966933735 3:184692017-184692039 GCAGGCAGTGCTGGGCCTGGGGG + Intergenic
984594120 4:181648117-181648139 GCATGCAGCACTGGCCATATTGG + Intergenic
986715320 5:10519565-10519587 GCAGGCTGCACTACCCCTAAAGG - Intronic
1000374312 5:160565297-160565319 GGAGGAAGTGCTGGCCCCAAGGG - Exonic
1001543363 5:172554616-172554638 ACAGGCATTACCGGGCCTAATGG - Intergenic
1006003721 6:30986741-30986763 GGTGGCAGTGCTGGCCCTACTGG - Exonic
1006900261 6:37495695-37495717 GCAGGCAGCACTCACCCTTAGGG - Intronic
1006933773 6:37703464-37703486 GGAGACAGCCCTGGCCCTAAGGG + Intergenic
1010654594 6:78497092-78497114 GCAGACAGTACATGCCCAAAGGG + Intergenic
1016384146 6:143514702-143514724 GCAGGCAGGTCTTTCCCTAAAGG - Intergenic
1017521873 6:155209606-155209628 GAAGGCAGTGCTGACCCGAAAGG - Intronic
1019610921 7:1936233-1936255 GCAGGCCCTGCTGGCCCTCATGG + Intronic
1024702839 7:51923421-51923443 GCAGTCACTACTGTCTCTAAAGG + Intergenic
1029420979 7:100471847-100471869 GAAGGCAGTACCGGACCCAAGGG + Intronic
1031583494 7:123505635-123505657 GCAGGCAGAAGTGTCCCAAACGG + Intronic
1041197181 8:55411812-55411834 TCAGGCAGTGCTGGGCCTGAGGG - Intronic
1042677544 8:71338729-71338751 GCAGGCAGTACTGTCCTTTGTGG - Intronic
1045729878 8:105225141-105225163 GCAGGTTGTACTGGCTCTGAAGG - Intronic
1046632682 8:116636915-116636937 GCAGTCAGTCCTGGCCCACATGG - Intergenic
1047262729 8:123276229-123276251 GAGGGCAGTACTGCCCCTCAGGG - Intergenic
1048569471 8:135639680-135639702 GCAGGCTGTACAGGGCCTCAGGG + Intronic
1048745794 8:137613753-137613775 GCAGGCAACACTGGCTCTAGAGG - Intergenic
1048975153 8:139667260-139667282 CCAGGCAGTTCAGTCCCTAAAGG + Intronic
1049315216 8:141962423-141962445 GCAGCCAGTACAGGAGCTAATGG + Intergenic
1056850863 9:90082512-90082534 GCGGGCAGTGCTGGCCCAAGAGG - Intergenic
1061042473 9:128148196-128148218 GCAGGCAGGACAGGGCCTGAGGG + Intergenic
1062703256 9:137919163-137919185 GCAGGCAGCACTGGCCAGGAGGG + Intronic
1192089299 X:68136097-68136119 GTAGCCAGTAGTGGCCCTATTGG - Intronic
1199852147 X:151732387-151732409 GCAGGCAGTATTGGCAAGAAGGG + Intergenic
1200057067 X:153467213-153467235 GCAGCCACTACTGGCCCTGGAGG - Intronic