ID: 931396912

View in Genome Browser
Species Human (GRCh38)
Location 2:61895808-61895830
Sequence CAGTCTGTGCATCTGGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931396908_931396912 1 Left 931396908 2:61895784-61895806 CCAGGAAACAGGAGGAAGCCACA 0: 1
1: 0
2: 2
3: 53
4: 382
Right 931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG 0: 1
1: 0
2: 2
3: 10
4: 213
931396905_931396912 17 Left 931396905 2:61895768-61895790 CCTAGCAGGAAGCTTACCAGGAA 0: 1
1: 0
2: 2
3: 22
4: 158
Right 931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG 0: 1
1: 0
2: 2
3: 10
4: 213
931396903_931396912 24 Left 931396903 2:61895761-61895783 CCAGTGACCTAGCAGGAAGCTTA 0: 1
1: 0
2: 0
3: 4
4: 69
Right 931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG 0: 1
1: 0
2: 2
3: 10
4: 213
931396902_931396912 25 Left 931396902 2:61895760-61895782 CCCAGTGACCTAGCAGGAAGCTT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG 0: 1
1: 0
2: 2
3: 10
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931396912 Original CRISPR CAGTCTGTGCATCTGGTAAT AGG Intronic
900918783 1:5657784-5657806 CACTCTGCTCATCTGGAAATGGG + Intergenic
903133849 1:21296656-21296678 CAGTCTCTGCATCTGTAAAATGG - Intronic
903424559 1:23244290-23244312 CAGTCTCCTCATCTGGAAATTGG + Intergenic
903695732 1:25205352-25205374 AGGTCTGTGCGTCTGGCAATGGG - Intergenic
904540944 1:31232892-31232914 CAGTATGTCCATCAGTTAATGGG + Intronic
904685289 1:32255264-32255286 CAGTCTTTGCATCTGTAAAATGG + Intronic
905684663 1:39900352-39900374 CAGTTTTTCCATCTGTTAATGGG + Intronic
906015067 1:42569220-42569242 CAATCTGTCCATCTGGCAAAGGG + Intronic
906405231 1:45536762-45536784 CAGTCTGAGCATCTGACAAAAGG + Intergenic
907161856 1:52376639-52376661 CAGGCTGTACAGGTGGTAATGGG - Intronic
907996895 1:59642104-59642126 CATTCTAAGCATCTGTTAATGGG + Intronic
908830250 1:68171406-68171428 CAGTCTATCCATCTGGCAAAGGG + Intronic
910218050 1:84862464-84862486 CAGTTTCTCCATCTGGTAAATGG + Intronic
910395733 1:86791874-86791896 TTGTCTGTTCATCTGTTAATAGG - Intergenic
910554149 1:88511725-88511747 CAGTCTTTGCATCTGAGAAGTGG - Intergenic
913542412 1:119834638-119834660 CTGTTTGTCCATCTGGGAATTGG + Intergenic
914964239 1:152239214-152239236 CAGTCTGTGCATATCTTTATAGG + Intergenic
915537762 1:156547812-156547834 CAGTCTTTTCATCTGAAAATGGG - Intronic
916039700 1:160951448-160951470 CAGTCAGTGCCTCTGCTCATAGG - Intronic
918547722 1:185704344-185704366 CATTGTGTGCATGTGGTAACAGG + Intergenic
918616117 1:186546201-186546223 CAGTCTATCCATCTGGCAAAGGG - Intergenic
920316508 1:205079337-205079359 CAGTCTCTCCATCTGGAAAATGG + Intergenic
920398687 1:205663789-205663811 CAGTTTGTCCATCTGAAAATGGG - Intronic
920974111 1:210769636-210769658 CAGTCAGTGCATGGGATAATTGG - Intronic
922971814 1:229748134-229748156 CAAACTGTACATCTGGTAAGGGG + Intergenic
1064963040 10:20987561-20987583 CAGTCTGTGGCTCTGGTGGTGGG - Intronic
1065608857 10:27450166-27450188 CAATCTGTGTATTTGGTAAATGG + Intergenic
1065763139 10:29001906-29001928 CATTGTGTGCTTCTGGTGATGGG - Intergenic
1066141677 10:32509643-32509665 CAAACTGTACATCTGATAATGGG + Intronic
1066300895 10:34094536-34094558 CTGTCTGTGCAACTGGTAGGAGG + Intergenic
1066784458 10:38987795-38987817 CAGTCTGTACATCTGACAAAGGG - Intergenic
1067526021 10:47039116-47039138 CTGTCTGTCCTTCTGCTAATGGG - Intergenic
1068170432 10:53386386-53386408 AAGTCTGTGAATTTGATAATGGG + Intergenic
1070783695 10:79151241-79151263 CAGTGTCTGCATCTGGCAAGTGG + Intronic
1071417040 10:85451005-85451027 CAGTCTCTTCCTATGGTAATGGG + Intergenic
1075544159 10:123341714-123341736 CAGTCTCTGCATCTGTAAAATGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078638773 11:13076546-13076568 GAGTGTGTGCTTCTGGGAATGGG - Intergenic
1079581788 11:22074132-22074154 CAAACTGTACATCTGATAATCGG + Intergenic
1080615277 11:33940296-33940318 CAGTTTCTTCATCTGGTAAATGG - Intergenic
1080747119 11:35118118-35118140 CACTCTGTGCCTCAGTTAATAGG + Intergenic
1083142898 11:60736265-60736287 CAGTCTCTTCATCTGGCAAATGG - Intronic
1084535455 11:69753702-69753724 CAGAATCTGCATCTGGAAATGGG + Intergenic
1085883175 11:80491692-80491714 CAGCCTATGCATGTGGTAGTTGG + Intergenic
1086199993 11:84190697-84190719 CAGATTGTGCATCTCCTAATAGG - Intronic
1086327327 11:85716554-85716576 CAGTCTTTGGATATGCTAATAGG - Intronic
1086828478 11:91529248-91529270 CAGTCTGTGTGTCTGTTTATGGG - Intergenic
1088758520 11:112907360-112907382 AAGTCTGTGCCTTTGGAAATTGG + Intergenic
1088787313 11:113193837-113193859 CATCCTGTGCTTCTGGTTATAGG - Intronic
1092316833 12:7425571-7425593 CAGTCTGTCCATCTGACAAAGGG + Intronic
1093185092 12:16010747-16010769 CTGTCTATGGATCTGCTAATGGG + Intronic
1100060784 12:90573191-90573213 CAGTCTATGCATCTCCTTATAGG + Intergenic
1101090492 12:101280165-101280187 AAGTCTGGGCATCTGGGAATCGG + Exonic
1102007121 12:109596103-109596125 CAGTCTCCTCATCTGGGAATGGG - Intronic
1102480044 12:113216616-113216638 CAGGCTGTGCATGTGGGAATAGG + Intronic
1103464980 12:121134927-121134949 CAGTTTCTGCATCTGTTCATAGG + Intronic
1103538410 12:121649529-121649551 CAGTCTGTACCTCTGGCACTGGG - Intergenic
1103953660 12:124565445-124565467 CAGTCTTTGCATCTGTTCAATGG + Intronic
1104339287 12:127932291-127932313 CTGTCTGTGCAGCTGGGAACGGG + Intergenic
1104974184 12:132545014-132545036 CAGTTTGTGCTTCTGTAAATAGG - Intronic
1107024028 13:35781332-35781354 CAGTCTATGGACCTGGAAATTGG - Intronic
1108448556 13:50535544-50535566 CAGTGAGTACATCTGGTCATAGG + Intronic
1108522835 13:51260601-51260623 CAGTGTGTGCATCTGCAAAATGG - Intronic
1108590915 13:51912225-51912247 CAGTGTGTGCAGCAGGTATTCGG + Intergenic
1109418889 13:62083619-62083641 CAGTGTGTGCTTCTTATAATTGG - Intergenic
1109635319 13:65107868-65107890 CAGTCTGTGTGTCTTTTAATTGG + Intergenic
1109983848 13:69948752-69948774 TACTCTGTGCATTTGTTAATAGG - Intronic
1110278521 13:73665241-73665263 CTGTGTGTGCAACTGATAATAGG + Intergenic
1111123646 13:83884154-83884176 CACTCTCTACATGTGGTAATGGG - Intergenic
1112296613 13:98193035-98193057 CAGTCTGGTTGTCTGGTAATTGG - Intronic
1114463706 14:22905146-22905168 CAGTCTGTGCCACTGGCCATTGG - Exonic
1116787796 14:49307265-49307287 CAGGCTTTGCATGTGGTACTGGG - Intergenic
1117457679 14:55914052-55914074 CAGTCTGTCCTCCTGGTGATAGG + Intergenic
1120731767 14:88011249-88011271 CAGCCTGTCCATCTGGATATTGG + Exonic
1122103351 14:99431299-99431321 CAGTTTCTCCATGTGGTAATGGG - Intronic
1122822339 14:104353850-104353872 CAGTCTGTCCATCTGTCAAATGG + Intergenic
1126344537 15:47678875-47678897 CAGTTTATCCATCTGGAAATGGG - Intronic
1127228831 15:56966615-56966637 CAGTCCGTGTATCTGGTAGTCGG - Intronic
1127245329 15:57166942-57166964 CATTTTGTGCTTCTGCTAATGGG + Intronic
1127413693 15:58734983-58735005 CAGTCTCTGCATGTGGGAACAGG - Intronic
1129798004 15:78392564-78392586 CAGTCGGTGCATCAGGAAGTAGG + Intergenic
1131765067 15:95667058-95667080 AAGTCTGCACATTTGGTAATAGG + Intergenic
1135814268 16:25617902-25617924 CAGTCTCTGCATCTGGCAATGGG - Intergenic
1137542582 16:49375183-49375205 GAGTCTATGCATTTGGGAATTGG - Intronic
1137769793 16:51006865-51006887 CAGTCTTTGCATCTGCAAAATGG + Intergenic
1138329193 16:56199638-56199660 CAATTTGTTCATCTGTTAATTGG + Intronic
1139281606 16:65775194-65775216 CTGTCTCTGCATCTGATGATCGG + Intergenic
1145414410 17:22703309-22703331 CAGTCTCTGCACCTGTTAAATGG + Intergenic
1146637646 17:34518183-34518205 CAGTGTCTGCATCTGTTAAATGG + Intergenic
1148083738 17:44981714-44981736 CAATCAGGCCATCTGGTAATGGG + Intergenic
1149056741 17:52375939-52375961 CAGGTTGTGCATCTGGCATTTGG - Intergenic
1150922271 17:69496164-69496186 CAGCCTGTCCATCCGCTAATTGG - Intronic
1152409717 17:80117295-80117317 CAGTCTGCTCATCTGGGAAATGG - Intergenic
1153296074 18:3548065-3548087 CAGTCTCTGTAACTGCTAATCGG - Intronic
1155118812 18:22797712-22797734 TAGCCTGTGAATCTGGTAGTGGG + Intergenic
1155679405 18:28471482-28471504 CAGTCTGTTCATTTTGTGATAGG + Intergenic
1156705735 18:39879293-39879315 CAGTCTCTGCATCCTGTAAAAGG + Intergenic
1156852332 18:41742915-41742937 GAGTTTGTGCATCTTTTAATGGG - Intergenic
1159848110 18:73490486-73490508 CAGTCTTTTCATCAGGAAATTGG + Intergenic
1160578538 18:79870561-79870583 CAGACTGTGCATCTGCTCACTGG + Intronic
1161511042 19:4671098-4671120 CAGTCTGTGTATTTGTTAATAGG + Intergenic
1161842192 19:6689207-6689229 CAGGATGTGCATCTGTAAATTGG - Intronic
1163117400 19:15196770-15196792 CAGTTTTTGCATCTGGAAAATGG - Intronic
1163186938 19:15645445-15645467 CAGTCTCTTCATCTGGAAAATGG + Intronic
1164917946 19:32066876-32066898 CAGTCTCTGCATCTGTAAAATGG + Intergenic
1167737422 19:51304390-51304412 CTTTCTGTGCATCTAGCAATGGG - Intergenic
1168115386 19:54219385-54219407 CAGTTTGTGCATCTGTGAAATGG - Intronic
1168120137 19:54247457-54247479 CAGTTTGTGCATCTGTGAAATGG - Intronic
1168181588 19:54665644-54665666 CAGTTTGTGCATCTGTGAAATGG + Intronic
924965354 2:71602-71624 CTGTCTGTTCAGCTGGTAATGGG - Intergenic
926199867 2:10787011-10787033 CATTCTGTGCATCTGGCCCTGGG - Intronic
926217622 2:10915064-10915086 CATTCTGATCATCTGGTAAATGG + Intergenic
928503297 2:31921075-31921097 CAGTCTGTGCTACTGGGGATTGG - Intronic
928664131 2:33533574-33533596 CAGTTTCTGCATCTGGAAAATGG - Intronic
929640950 2:43579288-43579310 AAGTCTGTGTATATGGTGATTGG - Intronic
929830860 2:45345212-45345234 CAGTCTGTTCATCTGTAACTTGG + Intergenic
931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG + Intronic
937393575 2:121514767-121514789 CATACTGGGCATCTGGAAATGGG - Intronic
941207868 2:162596794-162596816 CAAACTGTCCATCTGGTAAGGGG + Intronic
941321478 2:164060822-164060844 CAGTCTCTGTCTCTGGTATTAGG + Intergenic
942716973 2:178904152-178904174 CAAGCTGTGCATTAGGTAATAGG - Intronic
943348478 2:186769675-186769697 CAGTCTGTGCAGCTGGTGATAGG + Intergenic
943885097 2:193206535-193206557 CATTTTGTACATCTGGTACTGGG - Intergenic
947924162 2:233906435-233906457 CAGTCTCTGCTTCTGGCACTGGG + Intergenic
1169843816 20:9968123-9968145 CTGCCTGTGCCTCTGTTAATAGG - Intergenic
1173016516 20:39230760-39230782 CTGTCTGTGAAGCTGCTAATAGG + Intergenic
1173114568 20:40228489-40228511 CAATGTGTGCATTTGGTATTTGG + Intergenic
1173370428 20:42429900-42429922 AAGTCTGTGCATTTGGGAGTGGG + Intronic
1173821925 20:46025235-46025257 CAGTCTCTCCATCTGTAAATTGG + Intronic
1174483024 20:50844614-50844636 CAGTCTCTGCCTCTGTAAATGGG - Intronic
1175525773 20:59632335-59632357 CAGTCTCTGCCCCTGGTAATTGG + Intronic
1175649523 20:60707148-60707170 CAGTCTTTGCCTCAGGTATTTGG + Intergenic
1178395595 21:32240174-32240196 CAGTCCATGCATCATGTAATTGG - Intergenic
1178583872 21:33857229-33857251 CAGTGTTGGCATCTGGAAATGGG + Intronic
1178735124 21:35142205-35142227 CAGTCTTTGCATCTGTGAAGTGG - Intronic
1180588533 22:16915399-16915421 CCGTCTGTGCTTGTGGGAATGGG - Intergenic
1181886950 22:26029007-26029029 CAGTCTGTCAACCTGGTAAATGG - Intronic
1182353005 22:29709397-29709419 CAGGCTCTGCAGCTGGTTATGGG - Intergenic
1184551084 22:45204443-45204465 CAGTCTGTGCACCAGGTCCTGGG - Intronic
1184786000 22:46672322-46672344 CCGTCTGAGCAGCTGGTCATGGG + Intronic
1185021278 22:48377701-48377723 CAGTCCTTGAATCTGGTGATGGG + Intergenic
949931170 3:9079575-9079597 CAGTCTGTGCATCTGCAAAATGG - Intronic
950459613 3:13113400-13113422 CAGCCTGTGCATCTGTGAAGTGG + Intergenic
951062984 3:18232200-18232222 CAGTCTTTGAACTTGGTAATAGG - Intronic
951410121 3:22353268-22353290 CAGCCTGTGCTTCTGTTACTTGG - Intronic
951733483 3:25836738-25836760 CAATCTATGCCTCTGGTAACAGG + Intergenic
954070843 3:48141776-48141798 CTGTCTGTCCATCTGGAAAATGG + Intergenic
955315783 3:57937874-57937896 CAGTCTTTCTATCTAGTAATTGG - Intergenic
955503089 3:59604520-59604542 AAGCCTGTGAAGCTGGTAATAGG - Intergenic
955773566 3:62410607-62410629 CAGTTTTTTCATCTGGTAAGTGG + Intronic
957956047 3:87188764-87188786 CAGACTCTGTATCTGCTAATTGG - Intergenic
958973880 3:100643581-100643603 CAGTCTGTGCATCTGGGTTAAGG - Exonic
959227655 3:103605736-103605758 CAGTCTGTGTATCATTTAATTGG - Intergenic
960604756 3:119493864-119493886 TAGTCTGTGAATCTAGCAATAGG + Exonic
962497685 3:135958813-135958835 CATTCTGTGAAACTGGAAATCGG - Intergenic
963309633 3:143695102-143695124 GAGACTGTGCACCTGGTAACCGG - Intronic
963973566 3:151455834-151455856 GAGTATGTTCAACTGGTAATTGG - Intronic
969312098 4:6359654-6359676 CAGGCTGTGCCTCTGGTAGCAGG - Intronic
969932984 4:10650789-10650811 CAATCTATGCATCTGGCAAAAGG + Intronic
970736896 4:19182012-19182034 CAATCTGTCCATCTGGAAAAGGG + Intergenic
973050493 4:45589681-45589703 CAATCTGTCCATCTGGCAAAGGG + Intergenic
973832577 4:54776415-54776437 CAGTCTTTTCATCTGTTAAATGG - Intergenic
975662497 4:76701460-76701482 CTGTCTCTGCATCTGTTAAATGG + Intronic
977088685 4:92640964-92640986 GTGTGTGTGCATCTAGTAATAGG + Intronic
987120935 5:14765785-14765807 CCCTCTGTGCATCAGTTAATGGG - Intronic
989531710 5:42514978-42515000 CAGTCTGTGCTCCTGATAAAAGG - Intronic
991408036 5:66320564-66320586 CAGTCTCTGCATCTGTGAAATGG + Intergenic
992036079 5:72778143-72778165 CAGTCTGTGCATGTCTTTATAGG - Intergenic
992465536 5:77000353-77000375 AACATTGTGCATCTGGTAATAGG + Intergenic
997654596 5:135545669-135545691 CAGAGTGTGCATCTGCTTATTGG + Intergenic
997843302 5:137262349-137262371 CAGTCTGTGCCTTTGGTATGTGG - Intronic
1001048551 5:168395233-168395255 CAGGCTGTGCCTCTGGACATGGG - Intronic
1001161323 5:169318114-169318136 CAAACTATGTATCTGGTAATGGG + Intergenic
1002566850 5:180116959-180116981 CAGTCTGCTGATCTGGGAATTGG + Intronic
1008785620 6:55163867-55163889 CAATCTGTCCATCTGATAAAGGG + Intronic
1008898913 6:56588780-56588802 CAGTCTGTGCATATGTCAAAAGG + Intronic
1010300457 6:74254145-74254167 CAGTCTGAGCATCTGACAAAAGG - Intergenic
1010499602 6:76581025-76581047 CAGTTTGTGCATCTGTCAAATGG - Intergenic
1014601365 6:123417325-123417347 CACTCTGTGATTTTGGTAATAGG - Intronic
1016905300 6:149144025-149144047 TAATATGTGCATCTGGGAATAGG + Intergenic
1018088259 6:160323710-160323732 TAGTCTGTGAATCTGGGAAATGG - Intergenic
1018535374 6:164813363-164813385 CAGTATGTGCTTCTGGAACTGGG + Intergenic
1019586829 7:1809683-1809705 CAGTCTTCGCATCTGGAAAACGG - Intergenic
1021878704 7:25072837-25072859 TATTCTATGCATCTGGGAATAGG + Intergenic
1022519988 7:31000099-31000121 CAGTCTGTCCTTCTGGTTATGGG - Intergenic
1026973323 7:74480827-74480849 CGGGCTGTGCATCAGGTACTAGG - Intronic
1030423282 7:109337376-109337398 CAGTCTGTGTATTTTGTTATTGG - Intergenic
1030730694 7:112984542-112984564 CATTCTGTTTATTTGGTAATAGG + Intergenic
1030851716 7:114495096-114495118 CAGTTTGTGTATGTGGTAAGGGG - Intronic
1031125187 7:117765418-117765440 CAGTCTGCTCACCTGTTAATAGG - Intronic
1031305659 7:120123299-120123321 CAGCCATTGCATCTGGCAATAGG - Intergenic
1031781893 7:125978605-125978627 GTGTCTGTGTATGTGGTAATGGG - Intergenic
1034696847 7:153061301-153061323 TAGTCTGAGCACCTGATAATGGG - Intergenic
1036775829 8:11612653-11612675 CAGTCTCTTCATCTGGAAATAGG + Intergenic
1038241518 8:25812579-25812601 CACTCTGTTCATCTGGGATTAGG - Intergenic
1038380821 8:27091686-27091708 CAGTCTGAACATGTGGTTATTGG + Intergenic
1038961439 8:32524572-32524594 CAGGCTGTTCATCTGGCAACTGG - Intronic
1039903397 8:41768435-41768457 CAGTATGTCCATCAGCTAATAGG - Intronic
1042018300 8:64341918-64341940 CAGTTTCTGCATCTGTTAATTGG - Intergenic
1042139834 8:65666906-65666928 CAGTATGTGTATCTGGGTATGGG - Intronic
1043274412 8:78375430-78375452 TGGTCTATGCATCTGCTAATTGG - Intergenic
1043567106 8:81560731-81560753 CAGTCTGTGCTTCTGTAAAATGG - Intergenic
1043704056 8:83326928-83326950 CAGTCTATCCATCTGATAAATGG + Intergenic
1044712309 8:95069934-95069956 CAGCCTATGCATCTGGTATGTGG - Intronic
1045177123 8:99737421-99737443 CAGTCTGTAGATGTGGTGATAGG + Intronic
1049395957 8:142400840-142400862 CAGTCTCTCCATCTGGGAAATGG + Intronic
1051692058 9:19725274-19725296 CACACTGTACATCTGGTAAGTGG + Intronic
1052247654 9:26356581-26356603 CAGTCTCTGCATGTGGGGATGGG - Intergenic
1053309670 9:37009326-37009348 CAGTCTCTTCATCTGCAAATGGG + Intronic
1054932087 9:70645821-70645843 CAATCTGTGCATCTGACAAAGGG + Intronic
1054981045 9:71206486-71206508 CAGTCTGTCCATCTGACAAAGGG - Intronic
1056034170 9:82585951-82585973 AAGTCAGTGCATCTATTAATTGG - Intergenic
1057141330 9:92728372-92728394 CAGGCTCTACATCTGGAAATGGG - Intronic
1057278517 9:93692115-93692137 CAGTCTGTGAATCAGGAAGTGGG + Intergenic
1057560355 9:96123308-96123330 CAGTTTGTGCATCTGTTTAATGG - Intergenic
1059989456 9:119851433-119851455 CAGTCTCTTCATCTGTTAAATGG - Intergenic
1061294523 9:129669706-129669728 CTGTCGGTGCATCTGTTCATAGG + Intronic
1061326084 9:129865578-129865600 CAGTCTGTCCATCTGTGAAGTGG - Intronic
1062191290 9:135249163-135249185 CAGTCTCTGCATCTGTGAAGTGG - Intergenic
1186603453 X:11063987-11064009 CAGTTTGTTCATCTGTAAATTGG + Intergenic
1188082769 X:25864405-25864427 CAGTCTGTGCATTTCTTCATAGG + Intergenic
1192721533 X:73703585-73703607 CAGTCTGTGTCTCTTTTAATTGG - Intergenic
1194898753 X:99480181-99480203 CAGACTATGCATCTGGCAAGGGG + Intergenic
1197623294 X:128776525-128776547 CAGTCTATGCATATGTTTATAGG + Intergenic
1198502614 X:137267006-137267028 CAGTCTGTAGATTTGGTAGTAGG + Intergenic
1201669669 Y:16504735-16504757 CATTCAGTGAAACTGGTAATAGG - Intergenic