ID: 931417069

View in Genome Browser
Species Human (GRCh38)
Location 2:62091483-62091505
Sequence TGGAGTCAATCCAGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 1, 2: 1, 3: 2, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931417064_931417069 30 Left 931417064 2:62091430-62091452 CCAGGAATGCTGTTGCCATTGTA 0: 1
1: 1
2: 2
3: 22
4: 198
Right 931417069 2:62091483-62091505 TGGAGTCAATCCAGAACTGCTGG 0: 2
1: 1
2: 1
3: 2
4: 96
931417066_931417069 15 Left 931417066 2:62091445-62091467 CCATTGTATACTGATGGCATTTG 0: 2
1: 2
2: 4
3: 10
4: 169
Right 931417069 2:62091483-62091505 TGGAGTCAATCCAGAACTGCTGG 0: 2
1: 1
2: 1
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931417069 Original CRISPR TGGAGTCAATCCAGAACTGC TGG Intronic
903362337 1:22784459-22784481 TTGAGTCAAGCCAGAACAACTGG + Exonic
908793254 1:67803992-67804014 TGGAGTCCAGGCAGAACGGCTGG + Intronic
912457116 1:109805493-109805515 TGGAGTCACTCCAGAGCTCTAGG + Intergenic
918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG + Intergenic
920614608 1:207477902-207477924 TGGATTCCATCCATATCTGCTGG - Exonic
924852710 1:247846667-247846689 TGTTTTCAAGCCAGAACTGCTGG - Intergenic
1067171630 10:43911732-43911754 CAGAGGCAATCCAGATCTGCTGG - Intergenic
1068300191 10:55128905-55128927 TGCAGTAAATACAGAACTCCTGG + Intronic
1068385151 10:56317185-56317207 TGGACTCCACCCAGAACTGGTGG - Intergenic
1075904839 10:126072203-126072225 TGGAGGTGATCCAGAAATGCAGG + Intronic
1078706265 11:13746981-13747003 TGCAGTAAATCCAGAAATGAGGG + Intergenic
1082749484 11:57001292-57001314 TGGAGTCTATCCTGAACCACTGG - Intergenic
1084749801 11:71197148-71197170 GGGAGTCAAAGCAGAACTGAAGG + Intronic
1087025435 11:93644851-93644873 AGTAGGCATTCCAGAACTGCTGG + Intergenic
1087461878 11:98456337-98456359 GGGAGCCAATGCAAAACTGCTGG - Intergenic
1088029515 11:105229323-105229345 TGGTGTCATTCCACAACTTCTGG + Intergenic
1089933546 11:122339695-122339717 TGGAGCCAATACAGAAATACAGG + Intergenic
1090864151 11:130681691-130681713 TGGAGAAAATCCAGAACAGTGGG + Intronic
1091552439 12:1546732-1546754 TGCTGTCATTTCAGAACTGCGGG + Intronic
1098480649 12:70955704-70955726 TTGAGTCCATCCAGGAGTGCAGG - Intergenic
1099302760 12:80918461-80918483 TGAGGTCAATACAGAACTGGAGG - Intronic
1105427383 13:20305997-20306019 TGGAGTCACCCCAAAAGTGCTGG + Intergenic
1105614960 13:22003294-22003316 TGGAGAGAAACCAGAACTGAAGG - Intergenic
1107512529 13:41099089-41099111 TGAAGTTAATCCAGAACTGTTGG + Intergenic
1108702434 13:52955094-52955116 TGGAGACAACCCTGAGCTGCTGG - Intergenic
1119507178 14:75182917-75182939 AGGACCCAATCCAGAACTGACGG - Intergenic
1121502104 14:94446262-94446284 TGGAGTTGATCAAGACCTGCTGG + Intronic
1123951516 15:25282339-25282361 TGGGCTCATTCCAGAACTGGGGG - Intergenic
1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG + Intergenic
1128673675 15:69593730-69593752 TGGTCTCACTGCAGAACTGCGGG + Intergenic
1129316773 15:74749963-74749985 TGGAGCCAATGCGGATCTGCAGG - Exonic
1132814272 16:1818411-1818433 TGGAGTCAAACCAGGGGTGCAGG - Intronic
1136069379 16:27778836-27778858 TGTGGCCAACCCAGAACTGCAGG - Exonic
1141339218 16:83187599-83187621 CTGAGTCACTCCAGAGCTGCGGG - Intronic
1141600124 16:85120636-85120658 TGTAGTAAATCCAGAAATACAGG + Intergenic
1144644463 17:16962803-16962825 TGGAGTCAAGATAGACCTGCTGG - Intronic
1145204724 17:20977061-20977083 TGGAGTCAAGGCAGACCTGCTGG + Intergenic
1146545502 17:33734470-33734492 TGGCAGCAATCCAGAAGTGCGGG - Intronic
1148729322 17:49822077-49822099 TGTAGTCAAACCAGTTCTGCTGG + Intronic
1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG + Intronic
1157238042 18:45982364-45982386 TGGAGGCAGCCCAGAAGTGCTGG + Intergenic
1157671836 18:49536875-49536897 TTGATTCAATCCGGAAATGCGGG + Intergenic
1160921281 19:1521950-1521972 GGGAGTGAATCCAGAGCTCCTGG - Intergenic
1161391610 19:4024099-4024121 TGGAGTTGATCCGGAACTCCAGG + Exonic
1162100969 19:8338452-8338474 GGGAGGCATTCCAGACCTGCTGG + Intronic
1166241818 19:41499731-41499753 TGCAGTCACTCCATAAATGCTGG - Intergenic
1167867644 19:52341204-52341226 TGGAGTCAACCAAGAACTAGGGG - Intronic
928047411 2:27950045-27950067 AGGAGTGAATCTAGAACTTCAGG - Intronic
928593538 2:32840095-32840117 TGGAGTCAAGCCAGTGCTGGGGG - Intergenic
931417069 2:62091483-62091505 TGGAGTCAATCCAGAACTGCTGG + Intronic
937645915 2:124265769-124265791 TGTAGTCCAACCAGAGCTGCTGG - Intronic
937756831 2:125549719-125549741 TGGAGTCTATGCAGTTCTGCAGG - Intergenic
942273543 2:174301054-174301076 TGAAGACAGTCCAGAACTCCAGG - Intergenic
944648413 2:201803904-201803926 GTGATACAATCCAGAACTGCAGG - Intronic
945746540 2:213725481-213725503 TGGAGTCACTACAAAACTGGTGG + Intronic
1171272693 20:23828803-23828825 CAGAGTCAACCCAGAGCTGCTGG + Intergenic
1172163636 20:32885595-32885617 AGGACTCAGACCAGAACTGCAGG - Exonic
1175386605 20:58600024-58600046 GGGCGTCACTCCAGACCTGCTGG - Intergenic
1176208501 20:63904676-63904698 TGGACTGACTCCAGAACAGCTGG + Intronic
1179878569 21:44284058-44284080 TGCTGTAAATACAGAACTGCAGG + Intergenic
951000403 3:17552877-17552899 TGGAATAAATCCAGAATTCCAGG + Intronic
962820505 3:139044110-139044132 CGGAGTCCATCCAGAGCTCCGGG + Exonic
967779046 3:193415954-193415976 TGGAGATAATCCAGAGCTGAAGG - Intronic
968220245 3:196932405-196932427 CGGACTCAATCCTCAACTGCTGG - Exonic
971514837 4:27473047-27473069 TGGAATCAAGGAAGAACTGCTGG + Intergenic
972743983 4:41915264-41915286 GGGAGGGACTCCAGAACTGCAGG + Intergenic
974594145 4:63995420-63995442 TAGAGTCAATCCAGAGCTGCTGG + Intergenic
974627350 4:64442292-64442314 TGGAACCAATCCAGAACCGTTGG + Intergenic
977405605 4:96594005-96594027 TGCTGTGAATACAGAACTGCAGG - Intergenic
977828438 4:101561113-101561135 TGTGGTCAACTCAGAACTGCTGG + Intronic
978248067 4:106599191-106599213 TGCAGTCAATTCTGAAATGCTGG - Intergenic
980844532 4:138308266-138308288 TGGAGTCACTCCACAAGTACTGG + Intergenic
981380429 4:144065262-144065284 TGCAGTTAATGCAGAAGTGCAGG - Intergenic
982548220 4:156761037-156761059 TGGAGGCAGGGCAGAACTGCAGG + Exonic
983809801 4:172047185-172047207 GGGAATCAATACAGAGCTGCGGG - Intronic
984895381 4:184534593-184534615 TTGAGTCAAAAAAGAACTGCTGG + Intergenic
985565054 5:611535-611557 TGGAGTGAATCCAGACCCCCAGG - Intergenic
986800464 5:11255002-11255024 TGGAGTCATGCCAGAGCTACAGG + Intronic
986834998 5:11627330-11627352 TGGAGCCACTGAAGAACTGCTGG - Intronic
988846784 5:35135625-35135647 TGGAGTCAATCTGAAACTCCAGG - Intronic
989940644 5:50145975-50145997 TGGAGTCTATACAGGAATGCAGG - Intergenic
992981459 5:82178412-82178434 TGGTGTCAATCTAAAACTCCTGG - Intronic
993111986 5:83668918-83668940 TAAAGTCTATCCAGAACCGCTGG - Intronic
997513003 5:134466087-134466109 GGGAGTATTTCCAGAACTGCTGG - Intergenic
998754431 5:145360375-145360397 TGTAGCCAATAGAGAACTGCAGG + Intergenic
1003129903 6:3386674-3386696 AAGAGTGAATCCAGGACTGCCGG + Intronic
1006241735 6:32686890-32686912 TGGAGTCAATCCAGGTTTGTGGG + Intergenic
1019445212 7:1067457-1067479 TGGAGTACATCCAGAGGTGCGGG + Intronic
1019445255 7:1067652-1067674 TGGAGTACATCCAGAGGTGCGGG + Intronic
1020103308 7:5407546-5407568 TGGAATTAAGCCAGAATTGCCGG - Intronic
1027420227 7:78011542-78011564 TGGAGCCAACCCAGCCCTGCAGG + Intergenic
1033025221 7:137765742-137765764 TAGAGTCCATCCAGACCTGAGGG - Intronic
1034044945 7:147917832-147917854 AGGAGGGACTCCAGAACTGCAGG - Intronic
1038975369 8:32689986-32690008 TGGGGTCAATCTAGGACTTCAGG + Intronic
1048208081 8:132431521-132431543 GGGAGTCTATCCAGAAAGGCAGG + Intronic
1052125325 9:24767118-24767140 TGGAGACAAAACAGAGCTGCTGG + Intergenic
1055086014 9:72315009-72315031 AGAAGTAAATCCAGAGCTGCGGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1186393219 X:9181864-9181886 TGGTGTCAATCCAGACATGATGG - Intergenic
1196716115 X:118812496-118812518 TTCAGTCAATCCAGACCAGCAGG + Intergenic
1199172375 X:144746251-144746273 TGGAGTCAATCCAGAACTGCTGG - Intergenic