ID: 931418972

View in Genome Browser
Species Human (GRCh38)
Location 2:62108281-62108303
Sequence CACTGAAACTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931418972_931418981 21 Left 931418972 2:62108281-62108303 CCCTCTGCCCTCTAGTTTCAGTG 0: 1
1: 0
2: 2
3: 25
4: 333
Right 931418981 2:62108325-62108347 CTGACAGAAGACAGATTAACAGG 0: 3
1: 33
2: 132
3: 374
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931418972 Original CRISPR CACTGAAACTAGAGGGCAGA GGG (reversed) Intronic
901736017 1:11312675-11312697 CACTGGAATAAAAGGGCAGATGG + Intergenic
902459768 1:16565300-16565322 CACTGAAATTAGAGTGAAAAAGG + Intronic
903844346 1:26268932-26268954 TACTGAAACTAGAAGCAAGAGGG - Intronic
904377889 1:30093282-30093304 TACTGAAACTAGAAGCAAGAGGG + Intergenic
904569726 1:31453964-31453986 TACTGAAACTAGAGGCAAGGGGG + Intergenic
904571838 1:31471806-31471828 TACTGAAACTAGAGGCAAGCGGG + Intergenic
904987025 1:34560025-34560047 AGCTGAAACAAGAAGGCAGAAGG - Intergenic
905917064 1:41692202-41692224 ATCTGAAACTAGAAGGCAGAAGG - Intronic
905968315 1:42117825-42117847 CACTGAAACTGGAGAACAGTGGG + Intergenic
906288112 1:44601578-44601600 CACTGAAACTGGAGGGAACAGGG + Intronic
908009930 1:59765546-59765568 CACTGCAACTAAAGAGCAGGTGG - Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
910508132 1:87973559-87973581 CACTGAAAGTTGTAGGCAGAAGG - Intergenic
911165566 1:94721434-94721456 TAATGCAACCAGAGGGCAGAAGG + Intergenic
911903722 1:103538250-103538272 AACTGAAACAAGAAGGCAGAGGG - Intronic
912273560 1:108233593-108233615 CACTGAAACTAGAATGTAGGAGG + Intronic
912294660 1:108460729-108460751 CACTGAAACTAGAATGTAGGAGG - Intronic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
913605825 1:120464859-120464881 CACTGAAATTAGAGTGAAAAAGG - Intergenic
913643243 1:120832471-120832493 CACTGAAATTAGAGTGAAAAAGG - Intronic
913643544 1:120835113-120835135 CACTGAAATTAGAGTGAAAAAGG - Intronic
913644010 1:120839228-120839250 CACTGAAATTAGAGTGAAAAAGG - Intronic
913989545 1:143598023-143598045 CACTGAAATTAGAGTGAAGGAGG + Intergenic
914082728 1:144424357-144424379 CACTGAAATTAGAGTGAAAAAGG + Intronic
914177635 1:145292871-145292893 CACTGAAATTAGAGTGAAAAAGG + Intronic
914178180 1:145297629-145297651 CACTGAAATTAGAGTGAAAAAGG + Intronic
914178725 1:145302391-145302413 CACTGAAATTAGAGTGAAAAAGG + Intronic
914179103 1:145305560-145305582 CACTGAAATTAGAGTGAAAAAGG + Intronic
914179479 1:145308743-145308765 CACTGAAATTAGAGTGAAAAAGG + Intronic
914180023 1:145313499-145313521 CACTGAAATTAGAGTGAAAAAGG + Intronic
914180568 1:145318271-145318293 CACTGAAATTAGAGTGAAAAAGG + Intronic
914181111 1:145323033-145323055 CACTGAAATTAGAGTGAAAAAGG + Intronic
914181654 1:145327781-145327803 CACTGAAATTAGAGTGAAAAAGG + Intronic
914182199 1:145332548-145332570 CACTGAAATTAGAGTGAAAAAGG + Intronic
914182744 1:145337304-145337326 CACTGAAATTAGAGTGAAAAAGG + Intronic
914183289 1:145342054-145342076 CACTGAAATTAGAGTGAAAAAGG + Intronic
914183833 1:145346812-145346834 CACTGAAATTAGAGTGAAAAAGG + Intronic
914184377 1:145351584-145351606 CACTGAAATTAGAGTGAAAAAGG + Intronic
914184921 1:145356346-145356368 CACTGAAATTAGAGTGAAAAAGG + Intronic
914185466 1:145361093-145361115 CACTGAAATTAGAGTGAAAAAGG + Intronic
914186012 1:145365847-145365869 CACTGAAATTAGAGTGAAAAAGG + Intronic
914186558 1:145370607-145370629 CACTGAAATTAGAGTGAAAAAGG + Intronic
914187102 1:145375355-145375377 CACTGAAATTAGAGTGAAAAAGG + Intronic
914187645 1:145380107-145380129 CACTGAAATTAGAGTGAAAAAGG + Intronic
914188190 1:145384861-145384883 CACTGAAATTAGAGTGAAAAAGG + Intronic
914188733 1:145389611-145389633 CACTGAAATTAGAGTGAAAAAGG + Intronic
914210602 1:145575314-145575336 CACTGAAATTAGAGTGAAAAAGG + Intergenic
914269533 1:146067669-146067691 CACTGAAATTAGAGTGAAAAAGG + Intronic
914269887 1:146070814-146070836 CACTGAAATTAGAGTGAAAAAGG + Intronic
914270427 1:146075536-146075558 CACTGAAATTAGAGTGAAAAAGG + Intronic
914270964 1:146080272-146080294 CACTGAAATTAGAGTGAAAAAGG + Intronic
914271502 1:146085008-146085030 CACTGAAATTAGAGTGAAAAAGG + Intronic
914272037 1:146089729-146089751 CACTGAAATTAGAGTGAAAAAGG + Intronic
914272573 1:146094447-146094469 CACTGAAATTAGAGTGAAAAAGG + Intronic
914273111 1:146099169-146099191 CACTGAAATTAGAGTGAAAAAGG + Intronic
914273650 1:146103891-146103913 CACTGAAATTAGAGTGAAAAAGG + Intronic
914274188 1:146108609-146108631 CACTGAAATTAGAGTGAAAAAGG + Intronic
914274724 1:146113319-146113341 CACTGAAATTAGAGTGAAAAAGG + Intronic
914275257 1:146118037-146118059 CACTGAAATTAGAGTGAAAAAGG + Intronic
914275794 1:146122773-146122795 CACTGAAATTAGAGTGAAAAAGG + Intronic
914367030 1:146988437-146988459 CACTGAAATTAGAGTGAAAAAGG - Intronic
914367566 1:146993195-146993217 CACTGAAATTAGAGTGAAAAAGG - Intronic
914485417 1:148105027-148105049 CACTGAAATTAGAGTGAAAAAGG + Intronic
914532366 1:148534350-148534372 CACTGAAATTAGAGTGAAAAAGG + Intronic
914532725 1:148537501-148537523 CACTGAAATTAGAGTGAAAAAGG + Intronic
914533260 1:148542221-148542243 CACTGAAATTAGAGTGAAAAAGG + Intronic
914533795 1:148546935-148546957 CACTGAAATTAGAGTGAAAAAGG + Intronic
914534331 1:148551643-148551665 CACTGAAATTAGAGTGAAAAAGG + Intronic
914534867 1:148556357-148556379 CACTGAAATTAGAGTGAAAAAGG + Intronic
914535402 1:148561074-148561096 CACTGAAATTAGAGTGAAAAAGG + Intronic
914535939 1:148565810-148565832 CACTGAAATTAGAGTGAAAAAGG + Intronic
914536474 1:148570532-148570554 CACTGAAATTAGAGTGAAAAAGG + Intronic
914536833 1:148573720-148573742 CACTGAAATTAGAGTGAAAAAGG + Intronic
914585379 1:149057002-149057024 CACTGAAATTAGAGTGAAAAAGG + Intronic
914585742 1:149060190-149060212 CACTGAAATTAGAGTGAAAAAGG + Intronic
914629086 1:149491622-149491644 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914629619 1:149496385-149496407 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914630154 1:149501140-149501162 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914630688 1:149505901-149505923 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914631219 1:149510662-149510684 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914631751 1:149515418-149515440 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914632287 1:149520171-149520193 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914632822 1:149524928-149524950 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914633358 1:149529657-149529679 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914633894 1:149534408-149534430 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914634428 1:149539159-149539181 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914634961 1:149543896-149543918 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914635496 1:149548633-149548655 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914636031 1:149553370-149553392 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914914193 1:151808339-151808361 CACAGAAACCAGTGAGCAGACGG + Intronic
916180346 1:162078108-162078130 CACTCACAGTAGAGGGCAAAGGG - Intronic
917423196 1:174886672-174886694 AACTGAAACTAGAAGGCATATGG - Intronic
918178750 1:182068106-182068128 CACTGATACAAGAGATCAGAGGG - Intergenic
919888099 1:201949738-201949760 CACTGAAACCAGATGGTACAGGG - Intergenic
919962262 1:202483588-202483610 TACTGAAGCTAGAGGCAAGAGGG + Intronic
920829895 1:209454830-209454852 AAATGAAAGTAGAGGGCATAAGG + Intergenic
921365213 1:214367345-214367367 CACTGAAAGCAGAGAGTAGAAGG - Intronic
922007836 1:221550462-221550484 CACAGAAGCTAAAGGCCAGAAGG + Intergenic
922008503 1:221556427-221556449 CACTGAAAAGAGAGAGAAGATGG + Intergenic
924416183 1:243859136-243859158 CACTAACACTGGAGGGCAAAAGG + Intergenic
1068982827 10:63079225-63079247 CACTTAGACTAGAGTGCAGTGGG - Intergenic
1071325291 10:84509782-84509804 CACAAAACCTAGAGGGCAAAAGG - Intronic
1073623579 10:105073691-105073713 CACTGGATGTAGAGGTCAGAGGG + Intronic
1074661598 10:115665044-115665066 CACTGAAACTGAAGACCAGATGG + Intronic
1075443193 10:122495206-122495228 CACAGAAACAAGAGGGGAGCTGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076685863 10:132198255-132198277 CACTCAGAATAGAGGGCAGAGGG - Intronic
1077559649 11:3251353-3251375 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077565542 11:3297156-3297178 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077739424 11:4828963-4828985 CACTGAAACTCCCGGGCAGATGG - Intronic
1078021112 11:7656638-7656660 CACCGGAACTAGAGGGCACTGGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1080565199 11:33502527-33502549 CACTGAAACTCCAGGACAAATGG - Intergenic
1080653692 11:34242272-34242294 CACTGAACCAAGAAGGCAGGAGG + Intronic
1080672955 11:34398161-34398183 TATTGAAACTAGAGTTCAGAAGG - Intergenic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1085385386 11:76154704-76154726 CACTGAACCCAGAAGTCAGAGGG - Intergenic
1085871518 11:80356071-80356093 CCCTAAAATTAGAGTGCAGAGGG + Intergenic
1087072033 11:94090727-94090749 CATAGAAACTAGGGTGCAGAAGG - Intronic
1090155940 11:124438945-124438967 AACTGAAACCAGAGGGCAAGGGG + Intergenic
1091026022 11:132141974-132141996 CATTGAAGCTGGAGGACAGAAGG + Intronic
1093898562 12:24604369-24604391 CACTGAAACTGTTGAGCAGAAGG - Intergenic
1094751660 12:33416586-33416608 CATTGAACCTAGAGGCCAAAGGG - Intronic
1095521374 12:43070628-43070650 CACTCAAAATTCAGGGCAGATGG + Intergenic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096607027 12:52774232-52774254 CACTGCATTTAGAGGGAAGAGGG - Intronic
1097559625 12:61186748-61186770 CAATAAAACTAGAGTTCAGAAGG + Intergenic
1097618465 12:61911275-61911297 TTCTGAAACTAGAGGGGTGAAGG - Intronic
1097844958 12:64356724-64356746 TACTGAAACTAGAGGCAAGGGGG + Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1101155620 12:101924909-101924931 CGCCGAAACTAGTGGGCTGATGG + Intronic
1102111332 12:110367496-110367518 TACTGAAACTCCAGGGCAGGAGG + Intergenic
1103625532 12:122215977-122215999 TGAAGAAACTAGAGGGCAGATGG - Intronic
1104884232 12:132095848-132095870 TACTGAAACTAGAGGCAAGGGGG - Intronic
1104910474 12:132237925-132237947 CCCTGAAGCTGGAGGGCAGCAGG - Intronic
1106222066 13:27754629-27754651 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1109728125 13:66372157-66372179 AACTACAACTTGAGGGCAGATGG - Intronic
1110471158 13:75861749-75861771 CTCAGAAATTACAGGGCAGAGGG - Intergenic
1110984997 13:81956316-81956338 CCCTGAATCATGAGGGCAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112096193 13:96135021-96135043 TACTGAAAGAAGAGGTCAGAGGG + Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1114223228 14:20715552-20715574 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1114224636 14:20726227-20726249 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118358296 14:65034196-65034218 GACTGAAGCAGGAGGGCAGAGGG - Intronic
1119437155 14:74605075-74605097 CACTGGAACTAGAGGGTAAGAGG + Intronic
1119727698 14:76932065-76932087 GACTGAAGCTAGAGGGCAGCTGG - Intergenic
1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG + Intronic
1121308265 14:92920981-92921003 CACTGGAACTAGTGAACAGAAGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1123897035 15:24839688-24839710 CAGTGAAACAACAGAGCAGATGG - Intronic
1128321640 15:66698805-66698827 CACTGAAACCAGAGTCCAGTGGG - Intergenic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1129634357 15:77298977-77298999 CACAGGGATTAGAGGGCAGAGGG - Intronic
1130987061 15:88851585-88851607 CACTGGAACTAAAGTGCTGATGG + Intronic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1132791023 16:1687885-1687907 CCCTGCAACTAGAGGGCTGTGGG - Intronic
1133011560 16:2915222-2915244 CACTGAACCTACCGGGGAGATGG - Intronic
1134256202 16:12613731-12613753 CACTGAATCTAGAGGCAAGGGGG - Intergenic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1137805768 16:51304023-51304045 CACTGAAATAAGAGCCCAGAGGG - Intergenic
1138577181 16:57915456-57915478 GCTTAAAACTAGAGGGCAGAAGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1140196389 16:72859045-72859067 CACAGAAGCCAGAGGGCAGAGGG - Intronic
1141307065 16:82874881-82874903 GACTGAACTTAGAGGGCAGTTGG + Intronic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141995062 16:87631419-87631441 CACTGAACCTAGAAGTCAGTGGG - Intronic
1143619513 17:8073022-8073044 CACTGAAACCAAAGGGTGGAGGG - Intronic
1144776962 17:17789736-17789758 TGCTGAAACTAGAAGGCAGGAGG - Intronic
1146097356 17:29944345-29944367 CACTGAGATTATAGGCCAGAGGG + Intronic
1146516235 17:33491737-33491759 GCCTGAAACTAGAGGCTAGAGGG + Intronic
1146528340 17:33585760-33585782 CATCGAGACTAGCGGGCAGAAGG - Intronic
1146584299 17:34069068-34069090 CACTGAAAGTGGAGTTCAGAGGG - Intronic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1146651640 17:34610583-34610605 CACTGATACTGGTGGGCTGAGGG + Intronic
1148024108 17:44573770-44573792 CACAGAAAGTAAAGGACAGAAGG - Intergenic
1148748041 17:49929319-49929341 CTCAGAAAGGAGAGGGCAGAAGG + Intergenic
1152218391 17:79047614-79047636 CACTGGACCCAAAGGGCAGAAGG + Exonic
1152563085 17:81088345-81088367 CACAGAGCCTCGAGGGCAGAAGG - Intronic
1153165735 18:2260084-2260106 CACTGAAACTATAGGTCACTGGG - Intergenic
1154157684 18:11956752-11956774 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1155340852 18:24812688-24812710 CACAGAGAGAAGAGGGCAGAAGG - Intergenic
1155782306 18:29851659-29851681 TAGTGAAACTTGAGGGCAAAGGG + Intergenic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1164952524 19:32349324-32349346 CAGTGAGCCTAGAGGGCAAATGG + Intronic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1166521484 19:43483314-43483336 CACTGAAGCTGGAGTGCAGTGGG + Intronic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
1202676012 1_KI270711v1_random:7484-7506 CACTGAAATTAGAGTGAAAAAGG + Intergenic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
930555852 2:52894786-52894808 CACTGAGCCTAGAAGGGAGAGGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
931483825 2:62670557-62670579 CACTGAAGCTAGAGAGCTGAGGG - Intergenic
932337976 2:70941911-70941933 CACTGAAGCCAGAGTGGAGAAGG + Exonic
932465869 2:71923705-71923727 GACTGAAACAAGAGGGTAGATGG + Intergenic
934897774 2:98133419-98133441 CACTGAACCTACAGAGCTGATGG + Intronic
934910108 2:98244945-98244967 CACTGACCATAAAGGGCAGAAGG - Intronic
935296454 2:101653806-101653828 GTCTGAAACAAGAGGACAGAGGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937881954 2:126875084-126875106 TACTGAAACTAGAGGCAAGGGGG - Intergenic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
944452435 2:199856847-199856869 CCCTGCCACTACAGGGCAGAAGG + Intergenic
945146886 2:206747792-206747814 CACTGAAACAATAGGGAAGATGG + Intronic
945483200 2:210365793-210365815 TACTGAAACTAGAGGCAAGGGGG + Intergenic
945507577 2:210660127-210660149 CAATGAAGCAAGAGGACAGAAGG + Intronic
945715237 2:213350336-213350358 CACTGCAACTTGAGGGTGGAGGG - Intronic
946011278 2:216565620-216565642 TACTGAAACTAGAGGCAAGGGGG + Intronic
947283994 2:228490159-228490181 CAAGGAAACTGGATGGCAGAAGG - Intergenic
947989985 2:234479197-234479219 CAATGTAACTAGAGGGGAAAAGG - Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168962283 20:1877650-1877672 CCCTGAAACTAGCAGGCAGTGGG + Intergenic
1169448183 20:5689532-5689554 CTTTGAAAGTAGAGGGCACAGGG + Intergenic
1169727477 20:8751512-8751534 CACTGAAAATAGAATACAGATGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1172910181 20:38402941-38402963 CACTGAAACTGGAGTTCAGCAGG + Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173394023 20:42661315-42661337 CAATGAGACTAAAGGGCATATGG + Intronic
1173475574 20:43356772-43356794 CCCAGAAGCTGGAGGGCAGAGGG - Intergenic
1173793765 20:45844419-45844441 CCCTGAAAGTAAAGGGAAGAGGG + Exonic
1174438136 20:50526619-50526641 GGCTGTAACTAGAGAGCAGAAGG - Intronic
1175328378 20:58145663-58145685 CATGGAAACTTCAGGGCAGATGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175816839 20:61887361-61887383 GACTGCCACTAGAGGGCAGCTGG - Intronic
1177592829 21:23194476-23194498 CACTGTAACTTGAGTGTAGAGGG - Intergenic
1179427168 21:41290662-41290684 CAGTGAAACTCGGGGGCAGAGGG - Intergenic
1179716535 21:43291453-43291475 CACTCAGAGAAGAGGGCAGAAGG + Intergenic
1180112335 21:45666671-45666693 CACAGAAACTAGAAGGCTGTAGG - Intronic
1180249434 21:46571362-46571384 ATCAGAAACTAGAGGCCAGAAGG + Intergenic
1182387575 22:29958555-29958577 CACTGAGACAAGAGGGGAGCAGG - Intronic
949681798 3:6522351-6522373 GACTTAATTTAGAGGGCAGAAGG + Intergenic
951625323 3:24655535-24655557 CACTAAACCTAGAAGGCAGAAGG - Intergenic
952821503 3:37490243-37490265 TACTGAAACTAGAGGCAAGGGGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954124193 3:48519067-48519089 CACAGAAACGTGAGGGCAGGGGG - Exonic
954560927 3:51555925-51555947 CTCTGAAACTAGAATGCAAAAGG - Intronic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
955077004 3:55623493-55623515 TACTGAAACTAGAAGCAAGAGGG - Intronic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
955408785 3:58642651-58642673 CACTTAAACAGGAGGCCAGAGGG - Intronic
957017810 3:75090336-75090358 AACTGAAACAAGATGGTAGACGG - Intergenic
957657942 3:83106571-83106593 CTCTGAAACAAGAAGGCATACGG - Intergenic
958075984 3:88679032-88679054 CACTGAAACCATGGGGCAGTTGG + Intergenic
965403939 3:168248399-168248421 CACTGAAACTAAGAGCCAGATGG + Intergenic
968034591 3:195535780-195535802 CACTGAAACTAAACAGTAGAAGG + Intronic
968453047 4:684062-684084 CACTGATCCCAGAAGGCAGAGGG + Intronic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
969061365 4:4437915-4437937 CACAGATACTAGAGGGCCCATGG - Intronic
969431889 4:7160141-7160163 CACTGGAATTAGGAGGCAGAGGG + Intergenic
969989270 4:11243786-11243808 CAATAAAAATAGAGGGCAGATGG - Intergenic
970167410 4:13253872-13253894 CACTGAAACTAGAGATGAGAAGG + Intergenic
970465463 4:16318175-16318197 CACTGCAGCTAGAAGGCAGCGGG - Intergenic
971427386 4:26529880-26529902 AGCTGAAACTAGAAGGCAGAGGG + Intergenic
972252871 4:37323072-37323094 CAAAGAAACCAAAGGGCAGAGGG - Intronic
972544291 4:40065477-40065499 CACTGAAAAAAGTGAGCAGAAGG + Intronic
975342898 4:73260891-73260913 CACAGAGACTAGACTGCAGAGGG - Intergenic
976377250 4:84359657-84359679 CACTGAATCTGGATGTCAGATGG + Intergenic
976772823 4:88672866-88672888 CACTGTGACTAGCAGGCAGATGG - Intronic
977155410 4:93566727-93566749 CACTCAGGCTGGAGGGCAGAGGG - Intronic
977422229 4:96816436-96816458 CATTGAACATAGAGGGTAGAGGG + Intergenic
977860126 4:101947571-101947593 CACTGAATCTAAAGTGCACATGG - Intronic
980305922 4:131061402-131061424 CACAGACACCAGAGGCCAGAGGG + Intergenic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982973657 4:162023835-162023857 CTCTGAAGCCAGAGGCCAGAAGG - Intronic
983299748 4:165909851-165909873 AACTGAGACTAGAGGTGAGAGGG + Intronic
983473733 4:168188898-168188920 GACTGAAACCAGAGGCAAGATGG + Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983674003 4:170270811-170270833 TACTGAAACTAGAAGCAAGAGGG - Intergenic
988785564 5:34563263-34563285 CTGTGAAATTAGAGGGCTGAGGG + Intergenic
989315473 5:40072862-40072884 CACAAAATCTAGAGGGCAAAAGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989537792 5:42583444-42583466 CACTTCCACTAGAGGGCAGCAGG - Intronic
990644646 5:57830539-57830561 CACTGCAACAAGAAGGCAGGAGG + Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
992933075 5:81671112-81671134 CACTGAAGGAAGTGGGCAGATGG + Intronic
993094360 5:83464514-83464536 CACTGAAACCAAAGTGTAGAAGG - Intergenic
993307014 5:86286493-86286515 CACTGAAACTAGAATGTAGGAGG - Intergenic
995407663 5:111819101-111819123 TACTGAAACTAGAGGCAAGCAGG - Intronic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
995850898 5:116544923-116544945 TACTGAAACTAGAAGCAAGAAGG - Intronic
997294567 5:132761625-132761647 CACTGAAAGCAGAGGGCCGGTGG + Exonic
997454416 5:134006272-134006294 CACTGAGACTGGTGGGCAGGGGG + Intergenic
997574404 5:134962873-134962895 CACTGAAGCTAGAAGCTAGAAGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998337594 5:141387124-141387146 CACTGAAACTATTGGGAAGGGGG + Intronic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1001289603 5:170447458-170447480 CATTCAAACTCTAGGGCAGAAGG - Intronic
1002159296 5:177305649-177305671 CTCTTAAACTAGAAGGCAAAAGG - Intronic
1002426533 5:179180103-179180125 CCCTTAATCTACAGGGCAGATGG - Intronic
1003255467 6:4471359-4471381 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1003299532 6:4865052-4865074 TACTGAAACTAGAGGCAAGGGGG - Intronic
1003838798 6:10099068-10099090 GCCTGCAACTAGACGGCAGAAGG - Intronic
1003912359 6:10753917-10753939 CAGGGAAACTAGAGGGTACATGG - Intronic
1004248593 6:14003372-14003394 CACTGAACCTACTGGGAAGAAGG + Intergenic
1005468818 6:26141792-26141814 AGCTGGAACTAGTGGGCAGAGGG - Intergenic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1007950597 6:45868754-45868776 CATTCAAATTAGAGGGCAAATGG + Intergenic
1008012663 6:46485528-46485550 CATTAAAACTTCAGGGCAGAGGG + Intronic
1009993490 6:70873381-70873403 CACAGAAGCTAGAAGGCAGTGGG - Intronic
1010845733 6:80704445-80704467 AACTGAAACAAGAAGGCAGAGGG - Intergenic
1011525810 6:88263756-88263778 CACTGATGCTGCAGGGCAGAAGG + Intergenic
1014273727 6:119363621-119363643 CAATGAAACTAGAGGGAGAAAGG + Intergenic
1014756590 6:125308356-125308378 CACTGAAAGTACAGGACAGTTGG + Intergenic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1017782085 6:157723253-157723275 CAGTGAAAATAGAGGTTAGAAGG - Intronic
1018564118 6:165133502-165133524 CTCTGACACTACAGTGCAGAAGG + Intergenic
1022147179 7:27556576-27556598 CACTGAAAATAAATAGCAGATGG - Intronic
1023165194 7:37336641-37336663 CACTGAAGCTAGAGGAAGGAAGG + Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023796026 7:43792963-43792985 CACAGATAGTGGAGGGCAGAAGG + Intronic
1025037589 7:55606999-55607021 TACTAAAAGGAGAGGGCAGAGGG + Intergenic
1026091682 7:67305576-67305598 CACTAAACCTATAGGGCAGATGG - Intergenic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1029002081 7:97164889-97164911 AACTGAAACTATAGGAAAGATGG + Intronic
1029596848 7:101542577-101542599 CACTCAGAACAGAGGGCAGAGGG - Intronic
1029818534 7:103122429-103122451 CACAGACAAAAGAGGGCAGATGG + Intronic
1029887577 7:103889345-103889367 CACTGACAACAGAGGACAGAAGG + Intronic
1032340553 7:131068780-131068802 GAGAAAAACTAGAGGGCAGAAGG - Intergenic
1033321735 7:140346037-140346059 TAGTGAGACTAGAGGGCAAATGG - Intronic
1033651295 7:143345862-143345884 CCCTGAAAGTAGTGGGAAGAGGG + Intronic
1034652721 7:152704636-152704658 TACTGAAACTAGAAGGAAGGGGG - Intergenic
1035081566 7:156220492-156220514 CACCCAAACCAGAGGGCAGTAGG - Intergenic
1035694241 8:1582883-1582905 CTCTGAAAGAAGAGGGCAGCAGG + Intronic
1036104199 8:5822808-5822830 CACTGAAACTAGAAGCAAGGGGG + Intergenic
1039850837 8:41363730-41363752 TACTGAAACTAGAGGGCTAAAGG + Intergenic
1041009486 8:53527933-53527955 AGCTGAAACAAGAAGGCAGAGGG - Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047640618 8:126817440-126817462 GACTGAAATTAGAGGGGAGATGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1049956983 9:702720-702742 CACTGAAACTAGGGGCTAAAAGG - Intronic
1050099092 9:2099476-2099498 AACTGAAGCTGGAGGACAGAAGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1054714786 9:68546639-68546661 AACAGAAACTAGAGTGCATAGGG - Intergenic
1056037495 9:82622664-82622686 CCCTAAAATTAGAAGGCAGAGGG + Intergenic
1057349248 9:94280936-94280958 TACTGAAACTAGAGGCAAGGGGG + Intronic
1057421634 9:94917654-94917676 CAGTGATACTATAGGGCAGTGGG - Intronic
1057964117 9:99486947-99486969 CACTGAACCTAGAGGGTAATAGG + Intergenic
1058719591 9:107751558-107751580 TACTGATAATACAGGGCAGAGGG + Intergenic
1058910579 9:109516869-109516891 TACTTAAACTACTGGGCAGATGG + Intergenic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1059484112 9:114613801-114613823 CAGTCACACTAGAGTGCAGAGGG + Intronic
1061190577 9:129080570-129080592 AACTGAGACCAGAGAGCAGAGGG - Intergenic
1187297346 X:18014797-18014819 CACTGAAGCTGGAGTCCAGAAGG + Intergenic
1189081226 X:37974818-37974840 CACTGAAGGTGAAGGGCAGAAGG + Intronic
1189201807 X:39202767-39202789 GCCTGCAACTAGAGGGCAGCTGG - Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1197971375 X:132118760-132118782 ATCTTAAACTTGAGGGCAGAGGG - Intronic
1198150132 X:133900124-133900146 AACTTAAACTAAAGCGCAGAAGG + Intronic
1198209404 X:134502735-134502757 CAATGAACTAAGAGGGCAGATGG - Intronic
1198524210 X:137483948-137483970 CCCTGCAACTAAAGGGGAGAGGG + Intergenic
1201296690 Y:12469444-12469466 TACTGAAACTAGAGGCAAGGGGG + Intergenic
1201607934 Y:15808523-15808545 CACTGAAGCTAAAGACCAGAAGG + Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic
1202297402 Y:23374529-23374551 TACTGAAGCTAGAGGCAAGAGGG + Intergenic
1202573405 Y:26296068-26296090 TACTGAAGCTAGAGGCAAGAGGG - Intergenic