ID: 931420044

View in Genome Browser
Species Human (GRCh38)
Location 2:62118678-62118700
Sequence CAGGATAAAACCTGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931420044_931420052 25 Left 931420044 2:62118678-62118700 CCTTCCTCACAGGTTTTATCCTG 0: 1
1: 0
2: 3
3: 11
4: 218
Right 931420052 2:62118726-62118748 TTCAAAATCAAGTTCAATGAGGG 0: 1
1: 0
2: 0
3: 29
4: 315
931420044_931420053 30 Left 931420044 2:62118678-62118700 CCTTCCTCACAGGTTTTATCCTG 0: 1
1: 0
2: 3
3: 11
4: 218
Right 931420053 2:62118731-62118753 AATCAAGTTCAATGAGGGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 254
931420044_931420051 24 Left 931420044 2:62118678-62118700 CCTTCCTCACAGGTTTTATCCTG 0: 1
1: 0
2: 3
3: 11
4: 218
Right 931420051 2:62118725-62118747 TTTCAAAATCAAGTTCAATGAGG 0: 1
1: 0
2: 5
3: 44
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931420044 Original CRISPR CAGGATAAAACCTGTGAGGA AGG (reversed) Intronic
900805525 1:4765125-4765147 CAGAATAACACCTGTCAGGAAGG + Intronic
903191707 1:21660132-21660154 GAGGCTAAAGCTTGTGAGGATGG - Intronic
904360617 1:29969241-29969263 GAGTATGAAACCTGTGATGAGGG - Intergenic
904486539 1:30828463-30828485 CAGTGCAAAACCGGTGAGGAAGG - Intergenic
904915553 1:33967825-33967847 CAGGATAAACCTTGAGATGAAGG + Intronic
908342673 1:63197883-63197905 CCTCATAAAACCTGTGAGGCAGG - Intergenic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
908617541 1:65939024-65939046 CAGGACAAAAGCAGTGAGAATGG + Intronic
910375102 1:86559900-86559922 AAGGAAAAAATATGTGAGGATGG - Intronic
911836738 1:102629179-102629201 AATGATAAAACCTGAGAGCAGGG + Intergenic
913125631 1:115785312-115785334 CATAAAAAAACTTGTGAGGATGG + Intergenic
918058537 1:181043322-181043344 CAGGATAACACCTGTGAGGGAGG + Intronic
918622474 1:186621381-186621403 CAAGCTGGAACCTGTGAGGATGG - Intergenic
920192467 1:204202367-204202389 CAGGAGAAAAGGTGTGGGGAAGG - Intronic
920411479 1:205764846-205764868 CAGTTTAAAGCCTGTCAGGAAGG - Intergenic
920455640 1:206099117-206099139 CAGGAGAAAGCCAGAGAGGAAGG + Intronic
920542954 1:206793152-206793174 CAGGTATAAACCTCTGAGGATGG - Intergenic
922318729 1:224465503-224465525 CAGCATAAAAGCTATGAGGAGGG - Intronic
1063345539 10:5308864-5308886 CAGGCTAAAGCAGGTGAGGAGGG + Intergenic
1063845115 10:10119023-10119045 CAGGATAGAACCTGGGGGTAGGG - Intergenic
1065335272 10:24651043-24651065 AAGAATACAACCTGTGAGCAGGG + Intronic
1065359818 10:24878947-24878969 CAGGAGAATAGCTGAGAGGAAGG - Intronic
1067107698 10:43376759-43376781 CAGGATATTTCCTGGGAGGAGGG - Intergenic
1071054038 10:81487947-81487969 AATGATAAAGCTTGTGAGGAAGG + Intergenic
1072241065 10:93496264-93496286 TGGGATAAAACCAGTGACGATGG - Intergenic
1073296360 10:102441575-102441597 CAAAATAAAACCTGTTACGAAGG - Intergenic
1077219893 11:1411237-1411259 CAGGAGCAAGGCTGTGAGGAAGG - Exonic
1080689856 11:34547469-34547491 CAGGAATAAACCTGCAAGGAAGG + Intergenic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1082295348 11:50435112-50435134 CAGGATAAAAACTAGAAGGATGG + Intergenic
1082300607 11:50500151-50500173 CATGATAAAAGCTGGAAGGAAGG - Intergenic
1082309310 11:50627277-50627299 CAGGATAAAAACTAGGAGTAAGG + Intergenic
1082312212 11:50665313-50665335 CAGGATAAAAACTGGAAGAAAGG - Intergenic
1082584649 11:54920925-54920947 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1082587433 11:54959141-54959163 CAGGATAAAAACTATAAGAAAGG + Intergenic
1082592910 11:55036263-55036285 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1082595425 11:55074047-55074069 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1086113381 11:83222003-83222025 CAGTATAAAAACTGTGAGTTGGG + Intronic
1086940024 11:92786661-92786683 AATGATAAAACCTTTGAGTAGGG + Intronic
1089870196 11:121665668-121665690 CAGGATAAAACCAATTAAGAGGG + Intergenic
1090118542 11:124000557-124000579 CAGCATAAAATCTGTGAGTGAGG + Intergenic
1090444219 11:126749445-126749467 CAGGAGCAAACCGGCGAGGATGG - Intronic
1091882673 12:3992129-3992151 CAGGAAAGTACCTGTCAGGACGG + Intergenic
1091919984 12:4296291-4296313 CAGAATAGAGCCCGTGAGGAAGG + Intronic
1092125205 12:6070573-6070595 CCGGTTACAACCTGTGAGGCAGG - Intronic
1094860223 12:34456987-34457009 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1094860727 12:34463054-34463076 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1094864583 12:34515724-34515746 CAGGATAAAAACTAGCAGGAAGG - Intergenic
1096543252 12:52320411-52320433 CCCCATAAAGCCTGTGAGGATGG + Intronic
1096742354 12:53703064-53703086 TAGGATAAATCCTGGGAGTAGGG + Intergenic
1101059326 12:100954618-100954640 CAGGGAACAACCTGTTAGGAGGG - Intronic
1104114995 12:125741083-125741105 CAGCCTAAAATCTGTTAGGAAGG - Intergenic
1106415280 13:29541113-29541135 AAGGGCAAAACCTGTGTGGAAGG + Intronic
1109801964 13:67391767-67391789 CAGAGTAAAACCTGTGATTATGG + Intergenic
1110254400 13:73416608-73416630 CAGGATAAAAAAGGTAAGGAAGG + Intergenic
1111596636 13:90420277-90420299 CAGGATGAAGCCTGTGGGCAGGG + Intergenic
1114239196 14:20850420-20850442 AAGGAAGAACCCTGTGAGGATGG + Intergenic
1114976888 14:28112940-28112962 CAGGAAAAAAACTGTGACTATGG - Intergenic
1119345602 14:73921093-73921115 CAGGAGCAAACTGGTGAGGAGGG + Exonic
1119563869 14:75612356-75612378 CAGGACAAACCCTGTGACGGGGG + Intronic
1120037331 14:79712802-79712824 CAGGATGATAGCTGTGAGGCAGG - Intronic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1121081793 14:91114404-91114426 CAGGGCAAAACCAGTGAGCAAGG + Exonic
1121658028 14:95612561-95612583 GAAGTTAAATCCTGTGAGGATGG + Intergenic
1124407392 15:29404635-29404657 CAGGATAGATACTGCGAGGAGGG - Intronic
1125188688 15:36963980-36964002 AAGCATAAAACCTGTCAGCAAGG + Intronic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1127382352 15:58440953-58440975 GAGGACAAAACTTCTGAGGATGG - Intronic
1127632473 15:60840044-60840066 AGGGATAAAAGCTGTGATGATGG + Intronic
1128112245 15:65083913-65083935 CAGGAAATAACATGTTAGGATGG - Intergenic
1129880410 15:79003048-79003070 CAGGAGAAACCCTGAGAGTAGGG + Intronic
1134417474 16:14056984-14057006 CAGGAGAAAAGATGAGAGGAAGG - Intergenic
1134684152 16:16147034-16147056 CATCACAAAACCTGTGAGGATGG + Intergenic
1135530970 16:23254344-23254366 ATGGATAAAACCTTTGTGGAGGG + Intergenic
1136740788 16:32523144-32523166 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1136745550 16:32586906-32586928 CAGGATAAAAACTGAAAGAAAGG + Intergenic
1138533819 16:57649281-57649303 CTGGATAAAGGCTGTGGGGATGG - Intronic
1139652449 16:68369320-68369342 CAGGACAGAACCTGGGAGGAGGG + Intronic
1203012479 16_KI270728v1_random:310158-310180 CAGGATAAAAACTAGTAGGAAGG + Intergenic
1203013448 16_KI270728v1_random:324375-324397 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203028814 16_KI270728v1_random:552089-552111 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203030814 16_KI270728v1_random:583317-583339 CAGGATAAAAACTAGTAGGAAGG + Intergenic
1203031783 16_KI270728v1_random:597534-597556 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203039938 16_KI270728v1_random:736897-736919 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1203040907 16_KI270728v1_random:751114-751136 CAGGATAAAAACTAGTAGGAAGG - Intergenic
1203042907 16_KI270728v1_random:782342-782364 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1203047676 16_KI270728v1_random:846111-846133 CAGGATAAAAACTGAAAGAAAGG + Intergenic
1144407330 17:14964717-14964739 GAGGATAAACTCTGTCAGGACGG - Intergenic
1145414852 17:22706470-22706492 TAGTATAAAACTTGGGAGGAGGG - Intergenic
1146266573 17:31457199-31457221 CAGTCGAGAACCTGTGAGGAAGG - Intronic
1146291414 17:31610218-31610240 CAGTATAAAAACTGTGAGGTGGG + Intergenic
1146455934 17:33009653-33009675 CAGGATCACACCTGTGGGCAGGG + Intergenic
1146675280 17:34769069-34769091 CAGGATTACACCTGTGGGAAAGG + Intergenic
1147337798 17:39737869-39737891 GAGGAGGAAACCTGGGAGGAGGG - Intergenic
1148116497 17:45178359-45178381 CAGGAGAGAGCCTGGGAGGAAGG - Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1151803541 17:76391603-76391625 CAGGATCAGACCTGTGTGGGCGG + Exonic
1152597752 17:81246221-81246243 CAGGAAAAAACCTGGGAAGGAGG - Exonic
1153501369 18:5753363-5753385 CAGGATAAAACCTGTGCATCAGG - Intergenic
1154079473 18:11242198-11242220 CAGGATATAACCTTTTAAGATGG - Intergenic
1154376310 18:13812698-13812720 CAAGACGAAACCTGTGAAGAAGG + Intergenic
1156300885 18:35834952-35834974 CAAGAACAAACCTGTTAGGAAGG + Intergenic
1158008082 18:52695983-52696005 CAGAATAAAAACTTTGAGTATGG - Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1160159521 18:76460582-76460604 CAGTAAAAAAACTGGGAGGAAGG + Intronic
1162790343 19:13059513-13059535 CAGCAGAAAACCTGGAAGGAGGG - Intronic
1166405488 19:42519029-42519051 CAGCATAAACCCTGTCAAGAGGG - Exonic
1166863140 19:45821161-45821183 AAGGGTAAAACCTGGGAGGAAGG + Intronic
925611771 2:5707162-5707184 CTGGCTCTAACCTGTGAGGACGG + Intergenic
928663846 2:33530719-33530741 CAGGACAAAATCTGTGAGGGTGG + Intronic
929098505 2:38286498-38286520 CTGGATGGAAACTGTGAGGAGGG - Intergenic
931420044 2:62118678-62118700 CAGGATAAAACCTGTGAGGAAGG - Intronic
931815474 2:65896520-65896542 CTGGACACAACCTGTGAGCAAGG + Intergenic
931913150 2:66924249-66924271 CAGAATAAAACAAGGGAGGAGGG - Intergenic
933429383 2:82156283-82156305 CAGGAGAGAACCTGGGAGGTGGG - Intergenic
933753108 2:85615924-85615946 CTGGATAAAAGCTGTCAGGCCGG - Intronic
935000466 2:99009772-99009794 AAGGATGAAACCTGTGGGCATGG + Intronic
937671356 2:124540906-124540928 CAGGAGAGAACCTGAGAGGAAGG + Intronic
940449234 2:153817481-153817503 CAGCAAAAATCCTGTTAGGATGG + Intergenic
943831325 2:192466392-192466414 CAGGATCAAAACTTTGAAGAAGG + Intergenic
943873058 2:193026304-193026326 CAGGACAAAAACTGTAAGAAGGG + Intergenic
946591823 2:221257964-221257986 TAGAATAAAACCTGTGAATATGG + Intergenic
946991898 2:225341910-225341932 CAGGAGAAAATTTGTGAGAAAGG - Intergenic
947333535 2:229055739-229055761 CAGGATAAAGCCTGAGAATATGG + Intronic
1170669509 20:18418195-18418217 CAGGCTGAAAACTGTGACGATGG - Intronic
1171994159 20:31719422-31719444 CAGGATAATACCTGAGAGGAAGG + Intronic
1173402863 20:42740353-42740375 CTGGATAAAACCCCAGAGGAAGG - Intronic
1174897519 20:54466747-54466769 CTGGATAAAATGTGTGAAGAGGG - Intergenic
1175458976 20:59136629-59136651 CAGGATGAAAGCTCAGAGGAGGG - Intergenic
1175468646 20:59210044-59210066 TAGGATAAAACCTGTAAGGATGG - Intronic
1177759578 21:25388427-25388449 CGGGATTCAATCTGTGAGGAGGG - Intergenic
1178044304 21:28676681-28676703 CAGGATTCAATCTGTGAGGCAGG + Intergenic
1183350250 22:37330921-37330943 CAGAACAAAACCTGAGGGGAGGG + Intergenic
1185394531 22:50579927-50579949 CAGGACCCATCCTGTGAGGAAGG - Intronic
949095943 3:85700-85722 CAGGACAAAACCTGGGAAGCAGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
952906595 3:38143136-38143158 TAGGACTGAACCTGTGAGGAGGG - Intergenic
954627809 3:52032145-52032167 CAGGATAAAAGAAGAGAGGAAGG - Intergenic
956618541 3:71197815-71197837 CAGGCTTAAGCCTGTGAAGAAGG - Intronic
957007150 3:74962900-74962922 CAGGGTAATACCTATGAGGGAGG - Intergenic
957818625 3:85338567-85338589 CAGTAAAAACCCTGTGAGGTAGG + Intronic
962330025 3:134469965-134469987 CAAGATTAAACTGGTGAGGAAGG - Intergenic
962620432 3:137172794-137172816 CTGGAAAAAATGTGTGAGGAGGG + Intergenic
967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG + Intergenic
971020671 4:22532092-22532114 CAGGAGAAAAGCTGTCATGATGG - Intergenic
971530673 4:27684652-27684674 CAGGATACAAGCGCTGAGGAAGG + Intergenic
972316423 4:37930885-37930907 AAAGATAAAAACTGTGAGAAAGG + Intronic
976294202 4:83453635-83453657 AAGTATATAGCCTGTGAGGAAGG + Exonic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977558315 4:98506868-98506890 AAGGAAAAAAGCTGGGAGGAGGG + Intronic
977803545 4:101268422-101268444 CACCATAAAAACTGTGAGGTTGG - Intronic
986274158 5:6259018-6259040 CAGGTGAGAACGTGTGAGGAAGG - Intergenic
986470239 5:8066603-8066625 AAGTATGAAACCTGTGAGGGAGG + Intergenic
989634249 5:43517294-43517316 CATGATTAAGCCTGTAAGGAAGG + Intergenic
989848694 5:46179813-46179835 CAGGATAAAAGCTGGAAGGAAGG - Intergenic
994274966 5:97824265-97824287 CAGGATACAACTTGGGAGCAGGG - Intergenic
995882225 5:116855809-116855831 ATGGATAGAACCTGTGAGAACGG + Intergenic
996485087 5:124024220-124024242 AAGGGTGAAAGCTGTGAGGAGGG - Intergenic
996670198 5:126108719-126108741 CAGGATTCAATCTGTGAGGTGGG + Intergenic
997091687 5:130865547-130865569 CAAGAGAAAACATGTGAAGAAGG + Intergenic
997371432 5:133363687-133363709 CAGGATGAAACCTGGGCTGAGGG + Intronic
998516119 5:142755736-142755758 CAGGAGTTAACCTATGAGGATGG - Intergenic
999674380 5:153984264-153984286 CAGTATAAATCCTGTGAGGTAGG + Intergenic
1001672340 5:173484385-173484407 CCCGATAATGCCTGTGAGGAAGG - Intergenic
1003025971 6:2556221-2556243 CAGGTTAAGACCTGTGAGACAGG - Intergenic
1003516880 6:6825266-6825288 CAGGATGTAAGCTGTGAGGGTGG - Intergenic
1003740424 6:8931430-8931452 CAGGATAAAACCTTTGTTGGAGG - Intergenic
1005813876 6:29535022-29535044 CAGCCTAGAACCTGTGAGGTGGG - Intergenic
1005831575 6:29675325-29675347 CAGGATAACCCCTGAAAGGATGG - Intronic
1006475038 6:34247959-34247981 CAGGTCAAATCCTGGGAGGAGGG + Intronic
1007524226 6:42477506-42477528 AAGGAAAAAGCCTGTGAGGAAGG + Intergenic
1007529827 6:42532226-42532248 CTGGATAAAACATTTGTGGAAGG - Intergenic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1009249542 6:61280960-61280982 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1009251674 6:61308800-61308822 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1009259572 6:61467376-61467398 CAGGATAAAAACTTCAAGGAAGG + Intergenic
1009262419 6:61510225-61510247 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1010218799 6:73429451-73429473 TAATATAAAACCTGTAAGGATGG - Intronic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011664514 6:89621745-89621767 CAGGACAAGACCTAGGAGGATGG + Intronic
1012815034 6:104012858-104012880 AAGGATACAACCTGTGACAAAGG + Intergenic
1014473616 6:121846285-121846307 CTGTTTAAAACTTGTGAGGAAGG - Intergenic
1014599829 6:123397299-123397321 CAGGATAAAGTCTGTGTGGTAGG - Intronic
1019180191 6:170181952-170181974 CAGGAAAATTCCTGTGAGCATGG - Intergenic
1020545437 7:9523224-9523246 AAGAATATAACCTGTGTGGAAGG - Intergenic
1020967156 7:14885480-14885502 CAGGAAGAAACTCGTGAGGAGGG + Intronic
1022342407 7:29480902-29480924 CAGGATAAAGGCTGTGACCAAGG - Intronic
1023794743 7:43782454-43782476 CAGAGTACAACCTGTCAGGAAGG + Intronic
1025526546 7:61820000-61820022 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025526984 7:61826631-61826653 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025528612 7:61847453-61847475 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025530584 7:61877029-61877051 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025580139 7:62703147-62703169 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025581703 7:62727780-62727802 CAGGATAAAAACTGGAAAGAAGG + Intergenic
1025581751 7:62728464-62728486 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025593767 7:62898468-62898490 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025595367 7:62917012-62917034 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025711443 7:63914112-63914134 TAGTCTCAAACCTGTGAGGAAGG - Intergenic
1025751122 7:64294709-64294731 CACAATACAACCTGTGGGGAGGG + Intergenic
1028369861 7:90078985-90079007 CAGGAAAAACCCTGGGAGGCAGG + Intergenic
1031323185 7:120359304-120359326 AAAGATAATACATGTGAGGAAGG + Intronic
1032072832 7:128819463-128819485 CTGACAAAAACCTGTGAGGAGGG - Intronic
1033246632 7:139721911-139721933 CAAGATAAAACCTGTCAAAATGG + Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1036578074 8:10047427-10047449 AAAGAAAAAACCTGTGAGGTTGG + Intergenic
1037934429 8:22905732-22905754 CAGGCTGAGACCTGTGAGGTGGG - Intronic
1038253024 8:25924058-25924080 GAGGATAAAACTTAAGAGGAAGG + Intronic
1049147302 8:141010634-141010656 CAGGATGGAAACTGTGTGGAGGG - Intergenic
1049152142 8:141041831-141041853 CAGGATCACACCTCTGAGCAAGG + Intergenic
1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG + Intergenic
1053462302 9:38280400-38280422 CAGGAAGAAACCTGGGAAGAAGG - Intergenic
1053562481 9:39210383-39210405 CAGAAAAAAAACTGTGGGGAAGG - Intronic
1053828284 9:42048375-42048397 CAGAAAAAAAACTGTGGGGAAGG - Intronic
1054134670 9:61408656-61408678 CAGAAAAAAAACTGTGGGGAAGG + Intergenic
1054362982 9:64196267-64196289 CAGGATAAAAACTTCAAGGAAGG + Intergenic
1054602275 9:67139079-67139101 CAGAAAAAAAACTGTGGGGAAGG + Intergenic
1054823419 9:69547019-69547041 CAGGAAATAACCTGTGAAAAAGG - Intronic
1056855049 9:90120087-90120109 AAGGATAAAGGCTTTGAGGAAGG - Intergenic
1060097699 9:120807297-120807319 AAGCATAAAACATGAGAGGAGGG - Intergenic
1060740009 9:126091828-126091850 GAGGAGAAAACCTGTCAGAAAGG - Intergenic
1061227486 9:129289143-129289165 CAGGCCAAAGCCTGTAAGGAGGG - Intergenic
1062607969 9:137356695-137356717 CAGAATATCACCAGTGAGGAAGG - Intronic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188462870 X:30448862-30448884 TAGGATAAAAAATGTGATGAAGG - Intergenic
1189110854 X:38287014-38287036 GGGGATGGAACCTGTGAGGAAGG - Exonic
1189224822 X:39403762-39403784 CAGGATCAAGCCTCTGAAGAGGG + Intergenic
1190073349 X:47296988-47297010 CAGTATAAAACCTTTGAGATTGG + Intergenic
1190512169 X:51184844-51184866 AAAGATAAAACCTGTGCAGATGG + Intergenic
1190693950 X:52935519-52935541 CAGGAGGAGACCCGTGAGGACGG - Intronic
1191033575 X:56001436-56001458 CAGGAAAGAACCAGTGAGTAGGG - Intergenic
1195726420 X:107922143-107922165 CAGGAAGGAACCTGTGGGGATGG - Intronic
1197014152 X:121604179-121604201 CGGGATATAACCTTTGGGGAAGG + Intergenic
1198205556 X:134461083-134461105 CAAGAAAAAACCAGTGAGGGTGG - Intronic