ID: 931423754

View in Genome Browser
Species Human (GRCh38)
Location 2:62152109-62152131
Sequence GGAGGTGAGCAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931423754_931423765 26 Left 931423754 2:62152109-62152131 CCATCTTCCCTCTGCTCACCTCC No data
Right 931423765 2:62152158-62152180 CCTTTGGACGTCACTTTCTCAGG No data
931423754_931423766 27 Left 931423754 2:62152109-62152131 CCATCTTCCCTCTGCTCACCTCC No data
Right 931423766 2:62152159-62152181 CTTTGGACGTCACTTTCTCAGGG No data
931423754_931423761 10 Left 931423754 2:62152109-62152131 CCATCTTCCCTCTGCTCACCTCC No data
Right 931423761 2:62152142-62152164 TCATCCTTCAGGCCTTCCTTTGG No data
931423754_931423760 -1 Left 931423754 2:62152109-62152131 CCATCTTCCCTCTGCTCACCTCC No data
Right 931423760 2:62152131-62152153 CACGGACTGAGTCATCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931423754 Original CRISPR GGAGGTGAGCAGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr