ID: 931424634

View in Genome Browser
Species Human (GRCh38)
Location 2:62159514-62159536
Sequence CAGCCCAGATGTCCTTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931424631_931424634 30 Left 931424631 2:62159461-62159483 CCTGTACACATATGTTTATAGCA No data
Right 931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931424634 Original CRISPR CAGCCCAGATGTCCTTCCAC AGG Intergenic
No off target data available for this crispr