ID: 931428939

View in Genome Browser
Species Human (GRCh38)
Location 2:62195179-62195201
Sequence CGCTCCTTCGAGGGGTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931428939_931428954 10 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428939_931428947 -10 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428947 2:62195192-62195214 CGAAGGAGCGCGGGGCTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 105
931428939_931428953 9 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428953 2:62195211-62195233 GAGGGCGCATCGGTGGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 132
931428939_931428958 29 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428958 2:62195231-62195253 GGGGACCCCGCTGCTAGGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 97
931428939_931428951 3 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428951 2:62195205-62195227 GGCTAGGAGGGCGCATCGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 49
931428939_931428952 8 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428952 2:62195210-62195232 GGAGGGCGCATCGGTGGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 160
931428939_931428950 2 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428950 2:62195204-62195226 GGGCTAGGAGGGCGCATCGGTGG 0: 1
1: 0
2: 0
3: 7
4: 119
931428939_931428955 24 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428955 2:62195226-62195248 GGCCCGGGGACCCCGCTGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 273
931428939_931428948 -9 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428948 2:62195193-62195215 GAAGGAGCGCGGGGCTAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237
931428939_931428949 -1 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428949 2:62195201-62195223 GCGGGGCTAGGAGGGCGCATCGG 0: 1
1: 0
2: 2
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931428939 Original CRISPR CGCTCCTTCGAGGGGTTCCA AGG (reversed) Intergenic
900270550 1:1785111-1785133 GGCTCCTCGGAGGGGTTCCTGGG - Intergenic
900934414 1:5756162-5756184 CGCTTCTTCCAGAGGCTCCAGGG + Intergenic
901325659 1:8363857-8363879 CTCTCCTTCGAGGGGCCCCAGGG - Intronic
903379175 1:22885100-22885122 TGCTCCTTCGAGGCCCTCCAGGG - Intronic
904682882 1:32241126-32241148 CGCTCCATCGAGGTGTGCCGAGG - Intergenic
1063474827 10:6318896-6318918 GGCTGCTTCCATGGGTTCCACGG + Intergenic
1063715094 10:8519258-8519280 CACTCCTTCCAGGGGCTCTAGGG - Intergenic
1071876574 10:89849471-89849493 CTCTCCCTCCAGAGGTTCCAGGG - Intergenic
1077166926 11:1146498-1146520 CGTTCCTTCCAGAGGCTCCAGGG + Intergenic
1077377881 11:2214029-2214051 CACCCCATAGAGGGGTTCCACGG + Intergenic
1077538984 11:3137874-3137896 TGCTCCTTTGAGGGGATCCCAGG - Intronic
1081690590 11:45075155-45075177 CGATCCTTGGAAGGGTCCCATGG + Intergenic
1084270783 11:68028048-68028070 CGCTGCTTTGAGGGGTGCCCTGG - Exonic
1084561599 11:69908704-69908726 CGCTCCATCCAAGGGTTCTAGGG - Intergenic
1084681384 11:70668460-70668482 CGCTCCCTCCGGGGGCTCCAGGG - Intronic
1099870236 12:88338957-88338979 TGTTCCTTCTAGAGGTTCCAGGG - Intergenic
1100023285 12:90097338-90097360 TGCTCCTTCCAGAGGTTCTAAGG - Intergenic
1104433588 12:128737561-128737583 CATTCCTTCTAGGGGCTCCAGGG + Intergenic
1122826659 14:104374004-104374026 GGCTCCTTCTGGGGGCTCCAGGG + Intergenic
1122979461 14:105185120-105185142 GGCTCCTTCTGGGGGCTCCAGGG + Intergenic
1126888278 15:53175959-53175981 CCCTCCTCCAAGGGGATCCAAGG + Intergenic
1127699433 15:61483794-61483816 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1129897789 15:79121535-79121557 CGGTCCTTAGAGGAGTTCCCAGG + Intergenic
1132414031 15:101607899-101607921 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1132759325 16:1501184-1501206 AGCTCCTTCGAGAGGGGCCACGG + Intronic
1136654587 16:31702400-31702422 TGCTTCTTAGAAGGGTTCCAAGG + Intergenic
1139561198 16:67743527-67743549 CGCTCCTTCCAGGGATCCCACGG + Intronic
1141923549 16:87152582-87152604 GGCTCCTTCTACGGGCTCCAGGG + Intronic
1142057461 16:88007305-88007327 CGCAGCTTCCACGGGTTCCATGG + Intronic
1149661889 17:58338363-58338385 CACCTCTTCGAGGGGTCCCAGGG + Intergenic
1150522127 17:65879361-65879383 GGCTCCTTCTGGAGGTTCCAGGG - Intronic
1152424046 17:80209419-80209441 CTCTCCTTCGAGGGGTGTCCAGG + Exonic
1153685935 18:7545402-7545424 CGCTCCCTCCAGGGGCTCTAGGG + Intergenic
1154355756 18:13622228-13622250 CACTCCTGAGAGGGGTCCCAGGG - Intronic
1157976523 18:52333992-52334014 TGCTCCTTCTAGAGGCTCCAGGG + Intergenic
1161129558 19:2579914-2579936 TGCTCCCTCCAGAGGTTCCAGGG + Intronic
1161148152 19:2692016-2692038 CGCTCCTTCTAGAGGCTCCAGGG - Intronic
1163415778 19:17185716-17185738 AACTCCCTCGAGGGTTTCCAGGG + Intronic
1163613107 19:18311077-18311099 CGAGCCCTCGAGGGGTTCCTGGG - Intronic
1166045828 19:40230418-40230440 AGCTGCTTCCTGGGGTTCCATGG - Exonic
1166745364 19:45139516-45139538 CGCTCGTTCCGAGGGTTCCAGGG + Intronic
1167085541 19:47307262-47307284 CACTCCCTCCAGAGGTTCCAGGG - Intronic
926582187 2:14642845-14642867 TGCTCCTCCTAGGAGTTCCAAGG - Intronic
926911882 2:17859146-17859168 AGCTCCTTAGTGGGCTTCCAGGG + Intergenic
931428939 2:62195179-62195201 CGCTCCTTCGAGGGGTTCCAAGG - Intergenic
932137564 2:69244222-69244244 GGCTGCTTTAAGGGGTTCCAGGG + Intronic
933655133 2:84880850-84880872 CGCTGCTTCGCGGGGTTCGGAGG + Intronic
934529320 2:95075237-95075259 TGCTCCTTCCAGGGGTTCTGTGG - Intergenic
935341406 2:102062952-102062974 CGCTCCTGCCAGGGGATCCTAGG - Intergenic
937143870 2:119626037-119626059 CGCTCCCCCCAGGGGTTTCAGGG + Intronic
941125335 2:161577638-161577660 CTCTCCTTCCAGGGCTTCAATGG + Intronic
942123431 2:172801031-172801053 GGCTCGTGTGAGGGGTTCCATGG + Intronic
942188044 2:173443417-173443439 GGCTCCTTGGAGAGGTTCCTGGG + Intergenic
942384060 2:175422890-175422912 CATTCCTTCTAGGGGTTCCAGGG + Intergenic
948080553 2:235202216-235202238 CGCTCCCTCTGGGGGTTCCAGGG + Intergenic
948893027 2:240916288-240916310 CTCTCCTCCGGGTGGTTCCATGG + Intergenic
1171046329 20:21811662-21811684 CACTCCTCAGAGTGGTTCCATGG + Intergenic
1176407302 21:6428123-6428145 CGCTCCTTCCTGGGATTCCCTGG - Intergenic
1179682664 21:43035271-43035293 CGCTCCTTCCTGGGATTCCCTGG + Intergenic
1179682810 21:43036526-43036548 CGCTCCTTCCTGGGATTCCCTGG - Intergenic
1182742373 22:32577335-32577357 AGCCCCTTCGAGGGGGTCCCAGG - Intronic
1184019963 22:41814206-41814228 CTCTCATTCCAGGGGTTCCAGGG + Intronic
1184397052 22:44248545-44248567 CGCTCCTGCCTGGGTTTCCATGG + Exonic
1184650287 22:45916486-45916508 CGCTCTGACGAGGGCTTCCAGGG + Intergenic
1185072820 22:48666712-48666734 CGCTCCGACAAGGGGTTTCAGGG - Intronic
952198065 3:31096806-31096828 TGCTCCTTCAAGTGGTTCCTTGG - Intergenic
953402498 3:42637577-42637599 CGCTCATAAGAGGGCTTCCAAGG - Exonic
953855820 3:46498569-46498591 CTCTCCTCCTAGGGGCTCCAAGG - Intronic
955937175 3:64113087-64113109 CCCTCCTTCTAGGGTTCCCAAGG - Intronic
970695353 4:18670365-18670387 TGCTCCTTCCAGAGGCTCCAGGG - Intergenic
985363992 4:189207144-189207166 CGCTCCTTGGATGGATGCCAGGG + Intergenic
985576951 5:677984-678006 CGGTCCTTCGAGGGGTCCCCCGG + Exonic
985591871 5:770037-770059 CAGTCCTTCGAGGGGTCCCCCGG + Intergenic
985971280 5:3380644-3380666 CTCTCCCTCCAGGGGCTCCAGGG - Intergenic
991404615 5:66289671-66289693 CTCTCCTTCCAAGGGTTCCCTGG - Intergenic
997348870 5:133215713-133215735 CACTCCTTCTAGAGGTTCTAGGG + Intronic
1005261521 6:24066175-24066197 TGATCCTTCCAGAGGTTCCAGGG - Intergenic
1008985027 6:57531798-57531820 CGCTCTTTCAGGGGGTTGCAAGG + Intronic
1011099624 6:83708109-83708131 CGCTCCTGCGATGCGGTCCAGGG + Intronic
1022473041 7:30693385-30693407 CCCACCTTTGAGGGGTTTCACGG - Intronic
1039076453 8:33694218-33694240 CCCTCCTGCGAGGGGTTGAACGG + Intergenic
1041213856 8:55580384-55580406 GGTTCCTTCTGGGGGTTCCAGGG + Intergenic
1043650845 8:82589568-82589590 AGCTCCTTCGAGGGGGTGAAGGG + Intergenic
1052704778 9:31981733-31981755 CCCTCCTTCTTGGGGTTCCCAGG - Intergenic
1054460934 9:65462134-65462156 CCCTCCTTCTAGGGCTGCCATGG + Intergenic
1062445538 9:136592602-136592624 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1185918583 X:4063598-4063620 CACTCCCTCCAGGGGTTCCAGGG - Intergenic
1189956833 X:46284101-46284123 CGCTCCTTCCTAAGGTTCCAAGG + Intergenic