ID: 931428954

View in Genome Browser
Species Human (GRCh38)
Location 2:62195212-62195234
Sequence AGGGCGCATCGGTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931428939_931428954 10 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG No data
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428943_931428954 2 Left 931428943 2:62195187-62195209 CCCCTCGAAGGAGCGCGGGGCTA No data
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428945_931428954 0 Left 931428945 2:62195189-62195211 CCTCGAAGGAGCGCGGGGCTAGG No data
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428944_931428954 1 Left 931428944 2:62195188-62195210 CCCTCGAAGGAGCGCGGGGCTAG No data
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931428954 Original CRISPR AGGGCGCATCGGTGGGCCCG GGG Intergenic