ID: 931428954

View in Genome Browser
Species Human (GRCh38)
Location 2:62195212-62195234
Sequence AGGGCGCATCGGTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931428945_931428954 0 Left 931428945 2:62195189-62195211 CCTCGAAGGAGCGCGGGGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428943_931428954 2 Left 931428943 2:62195187-62195209 CCCCTCGAAGGAGCGCGGGGCTA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428944_931428954 1 Left 931428944 2:62195188-62195210 CCCTCGAAGGAGCGCGGGGCTAG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73
931428939_931428954 10 Left 931428939 2:62195179-62195201 CCTTGGAACCCCTCGAAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931428954 Original CRISPR AGGGCGCATCGGTGGGCCCG GGG Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
905580677 1:39081284-39081306 AGCGCGCATCGGGGGGCGGGGGG + Intergenic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
1067284112 10:44894971-44894993 TGGGCACAGCGCTGGGCCCGCGG - Intergenic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1075948914 10:126460706-126460728 AGGGGGCCTCGGTGGGACCTGGG - Intronic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG + Intergenic
1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG + Intergenic
1077094314 11:792858-792880 AGGGCGCATTGGTGAGGGCGGGG - Exonic
1078142006 11:8699681-8699703 GGGGCACATCAGTGGGCCCGTGG + Intronic
1079064379 11:17276739-17276761 AGAGCGGAGCGGTGGGCCGGGGG + Intronic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1083663116 11:64261240-64261262 AGGGCGCATCAGTGAGACCCCGG + Intronic
1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG + Intronic
1084978306 11:72815100-72815122 AGGGGGCATCAGGGGGCCCCGGG + Intronic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG + Intronic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG + Exonic
1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG + Intronic
1121690550 14:95875192-95875214 GGGGCACAGCGGTGGGCCCTGGG + Intergenic
1122262644 14:100531926-100531948 GTGGGGCATCGGTGGGGCCGGGG - Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122543422 14:102509880-102509902 GGGGCGCACCGCTGGACCCGCGG + Intergenic
1123035813 14:105471501-105471523 AGGGCGCCTGGGTGGGCTGGGGG - Intergenic
1130032636 15:80329363-80329385 AGGCTGCATCAGTGGACCCGTGG - Intergenic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1135407392 16:22207731-22207753 AGGGAGCTTCTGTGGGCCTGGGG - Intronic
1138165636 16:54799115-54799137 AAGGGGCATAGGTGGGCCTGAGG + Intergenic
1141132556 16:81445576-81445598 AGGGCGCATCTCGGGCCCCGAGG - Intronic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1143480753 17:7226251-7226273 AGGGCGCACGGGGAGGCCCGAGG - Exonic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG + Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG + Intronic
1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG + Intronic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160683387 19:422820-422842 AGGGCACATTGGAGGCCCCGCGG - Intronic
1165658303 19:37551897-37551919 AGGGCGCATAAGAGAGCCCGCGG - Intronic
1167244571 19:48365465-48365487 AGGGGGCTTCTGTGGGCCCCAGG - Intronic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932500543 2:72179305-72179327 AGGTCGCCTCTGTGGGTCCGGGG + Exonic
937346890 2:121131761-121131783 AGGGAACATCCGTGGCCCCGTGG + Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG + Intergenic
1169208740 20:3754194-3754216 GGGCCGCATGGGTGGGGCCGGGG - Intronic
1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG + Exonic
1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG + Intronic
1181831771 22:25565318-25565340 ATGGGGCATCGGAGGGCCGGTGG + Intronic
1181971292 22:26692336-26692358 AGTGCTCATCGGTGGGCATGTGG + Intergenic
1183678225 22:39311699-39311721 AGGGTGCACCTGTGGGCTCGGGG - Intergenic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184437244 22:44486665-44486687 AGGGCTCTGCTGTGGGCCCGGGG - Intergenic
950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG + Intronic
960556267 3:119034473-119034495 AGGCCGGGTCGGCGGGCCCGGGG - Intronic
968756063 4:2417274-2417296 AGGGCGCATCTGGGCGTCCGAGG - Intronic
980564330 4:134518889-134518911 AGGGCACTTTGGTGGGCACGGGG - Intergenic
983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG + Intronic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985642180 5:1068867-1068889 AGGGCGCGTCTGTGCGCACGAGG - Intronic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
1006502100 6:34465793-34465815 AGGGCGCACCGGAGGGCTCCCGG + Intergenic
1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG + Intergenic
1022989543 7:35694655-35694677 AGGGCACAACGGCCGGCCCGGGG + Exonic
1034963202 7:155374872-155374894 AGGGGGCTTCCGTGGGTCCGCGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1061570907 9:131476919-131476941 AGGGGGCATCGCTGGCCTCGTGG + Intronic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1189352984 X:40290926-40290948 AGGGGGCATCTGAGGGCACGAGG + Intergenic