ID: 931430995

View in Genome Browser
Species Human (GRCh38)
Location 2:62208943-62208965
Sequence CAACCTGGGTGGGGGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931430995 Original CRISPR CAACCTGGGTGGGGGCAGTG GGG Intronic
900300357 1:1973879-1973901 CAAGCTGGGAGGAGGCAGGGAGG + Intronic
900343085 1:2197758-2197780 CCACTGGGGAGGGGGCAGTGGGG + Intronic
900408739 1:2503585-2503607 CAGCGTGGGTGGGGGCAGAAAGG - Intronic
900654800 1:3751171-3751193 CTACCTTGGTGAGGGGAGTGTGG - Intergenic
901004322 1:6164589-6164611 CCACCTGGTTGGAGGCAGAGAGG + Intronic
901055122 1:6445760-6445782 GAAGCTGGGTGGGGGTGGTGGGG - Exonic
902279318 1:15362771-15362793 CCACCTGGGTGGGGGCAAACAGG + Intronic
902479247 1:16702854-16702876 GAAGCTGGGTGGGGGTGGTGGGG + Intergenic
902650035 1:17831156-17831178 CAACCATGGGGGTGGCAGTGGGG - Intergenic
902686180 1:18079195-18079217 CAAGCTGGGTGTGGCCAGAGAGG + Intergenic
902867363 1:19288363-19288385 GAACAGGGGTGGGGGCGGTGGGG + Intronic
903466960 1:23558547-23558569 CCAACTGGGTGGGGGCAGCGTGG - Intronic
903614292 1:24640984-24641006 CCATCTGCGGGGGGGCAGTGGGG + Intronic
904261271 1:29289063-29289085 CCACCTGGGTGGGGACAGAAAGG - Intronic
905139831 1:35834478-35834500 CAACTTGCGTGGGAGCAGTGGGG + Intronic
905282644 1:36859078-36859100 CAACACTGGTGGGGGCTGTGGGG + Intronic
905548028 1:38815683-38815705 AAACCTGGGTGTGGGGAGTGAGG - Intergenic
906907940 1:49915507-49915529 CAAACTGCAAGGGGGCAGTGAGG + Intronic
908133827 1:61106398-61106420 CAAACAGGGAGGGTGCAGTGAGG - Intronic
910518355 1:88088608-88088630 CTCCCTGGGTGGGGGAAGGGCGG - Intergenic
911242562 1:95481989-95482011 CATCCTGGCAGGGGGCAGGGAGG - Intergenic
911742446 1:101401463-101401485 CAACCTGAGAAGGGGCAGAGAGG - Intergenic
912432572 1:109636799-109636821 GGACCTGGCTGGTGGCAGTGTGG + Intergenic
912570277 1:110616293-110616315 GAACCTGGGTGGTGGGGGTGGGG - Intronic
912624191 1:111194297-111194319 CAGCCTGGGTGGGACCAGTTAGG - Intronic
912707405 1:111925128-111925150 CAGCCTAGGTGTGGGGAGTGAGG - Intronic
912778200 1:112520261-112520283 GAACCTGGGTTGGGGAAGAGAGG - Exonic
913163261 1:116164448-116164470 CCCCCAGGGTGGGGGCTGTGAGG + Intergenic
913195751 1:116454742-116454764 CAGCCTGGGTGAGGGGAGGGTGG + Intergenic
915912481 1:159923465-159923487 GGACATGGGTGGGGGCAGGGAGG + Exonic
916059655 1:161089694-161089716 GGACCTGGGTGGGGGCGGTGGGG + Intergenic
916592327 1:166204513-166204535 CAGCCAGGGTTGGGGCAGTGGGG - Intergenic
919010639 1:191957674-191957696 CTACGTGGGGGGGGGAAGTGGGG - Intergenic
919625609 1:199907281-199907303 CGCCCTGGGTGAGGGAAGTGGGG + Intergenic
920516058 1:206585334-206585356 CACCCTGGGTGGGTGCAGGTGGG + Intronic
921270588 1:213465906-213465928 CGACCTCGGTATGGGCAGTGGGG - Intergenic
922087551 1:222365253-222365275 GAACAGGGGTGGGGGCAGTCTGG - Intergenic
922605787 1:226889062-226889084 CAAGGCTGGTGGGGGCAGTGGGG + Intronic
922798451 1:228353099-228353121 CAGCCTGGGTCTGGGCCGTGGGG - Intronic
923984321 1:239363861-239363883 CAGCCTGGGTGACGGGAGTGAGG - Intergenic
1064429271 10:15257266-15257288 AGACCTGTGTGAGGGCAGTGGGG + Intronic
1065510353 10:26472083-26472105 CAAGATGGGTGGGGGCTGCGGGG + Intronic
1066707089 10:38192381-38192403 CAACCTTTGTGGAGACAGTGTGG + Intergenic
1067281743 10:44878708-44878730 GAACCTGGGAGGGGGCAGCCTGG + Intergenic
1069034168 10:63630367-63630389 CAGGGTGGGTGGGTGCAGTGAGG + Intergenic
1069557368 10:69407023-69407045 CCACCTGGGGCTGGGCAGTGGGG + Intronic
1069827523 10:71263153-71263175 ACACCGGGGTGGAGGCAGTGGGG + Intronic
1070390381 10:75965333-75965355 TAAACTAGGTAGGGGCAGTGTGG + Intronic
1070618899 10:77991423-77991445 AAATCTGGTGGGGGGCAGTGGGG - Intronic
1071277511 10:84069178-84069200 CAGCCTGGGTGACGGGAGTGAGG + Intergenic
1071330253 10:84551858-84551880 AAACCTGGGAGTGGGAAGTGGGG + Intergenic
1072348245 10:94530226-94530248 CATTCTGGTTGGGGGAAGTGGGG - Intronic
1074203467 10:111259995-111260017 CAAGCTGGGGGGTGGGAGTGGGG - Intergenic
1074291606 10:112141737-112141759 CCAACTGGGTAGGGGGAGTGTGG + Intergenic
1075092350 10:119450913-119450935 CAGCCTGGGGAGGGCCAGTGGGG - Intronic
1075474742 10:122724459-122724481 GAGCCTGGGTGGGGTCTGTGGGG - Intergenic
1075569534 10:123529674-123529696 CTGCCTGGGTAGGGGCAGGGGGG - Intergenic
1075588898 10:123677426-123677448 CAGCCGGGGTGGTGGCAGTGGGG - Intronic
1075742582 10:124704889-124704911 GAACCAGGGTGGTGGCAGCGGGG + Intronic
1076288996 10:129329701-129329723 AACCCTGGGTGGGAGCAGTGGGG - Intergenic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1076941786 10:133614997-133615019 AAACCTGGGCTGGGCCAGTGAGG - Intergenic
1077142407 11:1030382-1030404 CAAGCTGGGGTGGGGCAGGGAGG - Intronic
1077341858 11:2029779-2029801 CAGCCTGGATGGGGGCATTGGGG + Intergenic
1078085932 11:8233048-8233070 CAGCCTGGGCACGGGCAGTGGGG - Intronic
1078240787 11:9529456-9529478 CAGCCTGGCTGGGCCCAGTGGGG - Intergenic
1079221278 11:18563303-18563325 CAACCAGGCCGGGTGCAGTGGGG + Intronic
1079603755 11:22341708-22341730 CAACCTGGGCGTGGCCATTGTGG + Exonic
1080399244 11:31918967-31918989 AAAGATGGGTGGAGGCAGTGGGG + Intronic
1080964343 11:37196562-37196584 CACCCTTTGTGGAGGCAGTGAGG - Intergenic
1082000467 11:47391265-47391287 CAGCCTGGGTGGGGCTGGTGAGG + Intergenic
1089325842 11:117656232-117656254 CGTCTTGGGTGGGGGCAGCGGGG + Intronic
1089559940 11:119338763-119338785 CAACCTAGGTGGCGGCTCTGTGG + Intergenic
1090362312 11:126182202-126182224 CAGCCTGGGAGGGGGCAATCGGG - Intergenic
1090362324 11:126182231-126182253 CAGCCTGGGAGGGGGCAATCGGG - Intergenic
1090423137 11:126589339-126589361 CTTCCTGGATGGGGGCACTGTGG + Intronic
1090797897 11:130150958-130150980 CAGCTTGGGCGGGAGCAGTGGGG + Intergenic
1202824844 11_KI270721v1_random:84968-84990 CAGCCTGGATGGGGGCATTGGGG + Intergenic
1091531507 12:1361067-1361089 CAGCCTGGGTGATGGGAGTGAGG + Intronic
1091664163 12:2407073-2407095 CACCCTGGCTGGAGGCAGAGGGG + Intronic
1091790591 12:3269852-3269874 CATCCTGGGCCTGGGCAGTGGGG - Intronic
1092711270 12:11340143-11340165 CAAACTGGGAGGTGGCAGTGAGG - Intergenic
1093207082 12:16263951-16263973 CAACCTCTGCTGGGGCAGTGTGG + Intronic
1093332092 12:17855949-17855971 CAAACTGCAAGGGGGCAGTGAGG + Intergenic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1094465619 12:30751521-30751543 CAACTTGGGAGGGGGAAGGGAGG + Intronic
1094698602 12:32846327-32846349 TCACCGGGGTGGGGGGAGTGGGG + Intronic
1094779380 12:33773274-33773296 CAAACTGGAAGGTGGCAGTGAGG + Intergenic
1096776806 12:53969341-53969363 GAAGCTGGGTGGGGCCTGTGGGG + Intergenic
1096780965 12:53991890-53991912 CTATCTGGGAGGGGGCAGTGGGG - Intronic
1097032728 12:56101290-56101312 TAACCCGGGTGGGGAGAGTGGGG - Exonic
1097250951 12:57632130-57632152 CATCCTAGGTGGGGGTAGGGTGG + Exonic
1097376085 12:58844546-58844568 CCACATGGTTGGAGGCAGTGAGG + Intergenic
1097855715 12:64459662-64459684 CAACGTGGGGGAGGGGAGTGGGG - Intronic
1098761867 12:74435029-74435051 GAACCTCTGTGAGGGCAGTGTGG + Intergenic
1099865672 12:88277835-88277857 CACACTGGGTGGGGGGAGTGTGG - Intergenic
1100732542 12:97488325-97488347 GAACCTAGGTGGGTGCAGTTGGG + Intergenic
1101301711 12:103489676-103489698 CAACCTGTGAGGCTGCAGTGTGG - Intronic
1101628607 12:106471189-106471211 CAACCTGGGATGGTGGAGTGTGG - Intronic
1101830606 12:108253639-108253661 CAACAGGGGTGGGGGAAGGGAGG - Intergenic
1102062768 12:109946659-109946681 CCACCGTGGTGGGGGAAGTGTGG - Intronic
1102118200 12:110419615-110419637 CAACTGGGGTGGAGGCAGGGTGG + Intergenic
1102949684 12:117022624-117022646 CAGCCTGGGTGATGGGAGTGAGG + Intronic
1102965773 12:117124404-117124426 GGACCAGGGTGGTGGCAGTGGGG + Intergenic
1103073853 12:117966956-117966978 CGCCGAGGGTGGGGGCAGTGGGG - Intronic
1104787266 12:131457717-131457739 GAACCTGGCTGGAGGCAGTCAGG - Intergenic
1104924908 12:132309007-132309029 CTCCCTGGTTGGGGGCAGAGGGG - Intronic
1105701956 13:22940600-22940622 GAACCAGGGTGTGGGCAGCGGGG - Intergenic
1106242812 13:27924194-27924216 CTGCGTGGGTGGGGGCTGTGCGG + Intronic
1106299914 13:28454025-28454047 AGAGCTGGGTGGGGGGAGTGGGG + Intronic
1106584538 13:31045653-31045675 CATCCTGGGTGAGATCAGTGAGG + Intergenic
1106839167 13:33668395-33668417 CAACCTGGTGGTGGGCATTGTGG + Intergenic
1106871440 13:34026185-34026207 AGACCTGGGTAGGGGCAGTGTGG - Intergenic
1108000870 13:45904631-45904653 CAATGGGGGTGGGGGCAGCGGGG + Intergenic
1108144647 13:47463834-47463856 CTTCCTGGGTGGGGGAAGGGCGG + Intergenic
1108605222 13:52030683-52030705 CTACCTGGCTGGGGCGAGTGGGG + Exonic
1112328004 13:98456567-98456589 CAAGTTGGGAGGGGGCAGGGAGG + Intronic
1112333159 13:98492530-98492552 CCACCTGGGGGTGGGCTGTGCGG - Intronic
1112676062 13:101703657-101703679 CAAGCTGGATGAGGGCAGTAAGG + Intronic
1113331757 13:109334182-109334204 TAAGCTGTGAGGGGGCAGTGGGG + Intergenic
1113417669 13:110141349-110141371 CTGTCTGGGTGTGGGCAGTGTGG - Intergenic
1113803211 13:113096949-113096971 CGCTCTGGGTGGGGGCGGTGAGG - Exonic
1114416379 14:22547441-22547463 CAGCCTGGGTTGGGGCAAAGAGG + Intergenic
1116188801 14:41636220-41636242 CATTCTGGGTGGAGGCAATGAGG + Intronic
1117548851 14:56814017-56814039 TAACTTTGGTGGGGGGAGTGGGG + Intergenic
1117981653 14:61347905-61347927 CAAGCTTGGCGGAGGCAGTGGGG + Intronic
1119433957 14:74585930-74585952 CAACCTGCGCAGGAGCAGTGCGG - Exonic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1119852176 14:77874047-77874069 ACAGCTGGGTGGTGGCAGTGGGG + Intronic
1120549756 14:85855697-85855719 AAACCAGGGTGGGGGCGGTGGGG + Intergenic
1120871170 14:89338712-89338734 GAACCTGGGGGTGGGCAGGGAGG + Intronic
1121125891 14:91406552-91406574 CAGCCTGCGTGCGGGCAGTTGGG - Intronic
1121299817 14:92861506-92861528 CAACGTGGGTGATGGGAGTGGGG - Intergenic
1121507355 14:94486992-94487014 CAACCTGGGGCAGGGCTGTGGGG + Intergenic
1121512301 14:94521559-94521581 CTTCCTGGGCGGGAGCAGTGGGG - Intergenic
1122778085 14:104131622-104131644 GAGCCAGGGTGGGGCCAGTGAGG + Intergenic
1122862352 14:104588336-104588358 CACCCACGGAGGGGGCAGTGGGG - Intronic
1124123310 15:26911345-26911367 CAGCAAGGGTGGGGGCAGGGAGG - Intronic
1124367018 15:29079300-29079322 CTAGCTGTGTGGGTGCAGTGTGG + Intronic
1124920680 15:34023218-34023240 CAACCTGAGTGGGGGATGAGAGG - Intronic
1125130373 15:36278207-36278229 CTACCTGGGTGGAGGTGGTGGGG - Intergenic
1125664972 15:41423374-41423396 CATCTTGGGTGGGGGCTGGGTGG - Intronic
1126042863 15:44609716-44609738 AAAGCTGGGCGGGGGCAGGGAGG - Intronic
1126254930 15:46614710-46614732 CAAACTGCAAGGGGGCAGTGAGG + Intergenic
1126673166 15:51134975-51134997 CAACCTGATTGGGGTCACTGTGG + Intergenic
1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG + Intronic
1129231399 15:74199060-74199082 CAGCATGGGTGAGGCCAGTGGGG + Intronic
1129462085 15:75704576-75704598 CTACGTGGGTGAAGGCAGTGGGG + Intronic
1129722777 15:77887270-77887292 CTACGTGGGTGAAGGCAGTGGGG - Intergenic
1129736947 15:77971961-77971983 CACCCTGGGTCGGGGCAGCTGGG - Intergenic
1130089515 15:80808354-80808376 CTGCCTAAGTGGGGGCAGTGGGG - Intronic
1130297622 15:82658351-82658373 CAAACCTGGTGGGTGCAGTGGGG - Intergenic
1131795446 15:96011232-96011254 CAGAATGGGTGGGGGCAGAGCGG + Intergenic
1132147087 15:99435437-99435459 CAGCGAGGGTGGGGACAGTGAGG - Intergenic
1132659765 16:1056044-1056066 CTACCTGGGGGGCGGCACTGAGG + Intergenic
1132686820 16:1165710-1165732 GAGCCGGGGTGGGGGCAGGGAGG - Intronic
1132722702 16:1324607-1324629 CCTCCTGGGGGAGGGCAGTGTGG - Intronic
1132839958 16:1974112-1974134 CAGCCTGGGGAAGGGCAGTGGGG + Intronic
1132899179 16:2244121-2244143 CAGCCTGGGTGGAGGCTGTGTGG - Intronic
1134890249 16:17835232-17835254 CAACATGGTTGGTGGCATTGGGG - Intergenic
1136240900 16:28943212-28943234 CCACAGTGGTGGGGGCAGTGGGG - Intergenic
1136590782 16:31216540-31216562 GAGCCTGGAAGGGGGCAGTGGGG + Intronic
1137492270 16:48943194-48943216 CAACCAGGGGGTGGGGAGTGCGG + Intergenic
1137516472 16:49148887-49148909 GAACTTGGTTGGGGGCAGGGGGG - Intergenic
1138261330 16:55625286-55625308 CAGTCTGGATGGGGGCAGTGTGG + Intergenic
1138331390 16:56218625-56218647 GAAGCTGGGTGGGGGCAGGCAGG - Intronic
1139169721 16:64615743-64615765 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
1139237698 16:65357127-65357149 CAAACTGCAAGGGGGCAGTGAGG + Intergenic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1140908614 16:79430914-79430936 GAACTTGGGTTGGGGCAGTGGGG + Intergenic
1141652496 16:85401125-85401147 CCAGCTGGGTGGGTGCGGTGCGG + Intergenic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142059530 16:88020535-88020557 CAACCTGAGAGGTGGCATTGTGG + Intronic
1142680671 17:1546394-1546416 GAACCTGTGTGGGGCCACTGAGG + Intronic
1142889854 17:2936252-2936274 AAAACTGGGTGGGGGGAGGGGGG - Intronic
1142911549 17:3097775-3097797 CTCCCTGGGTGGGGGAAGGGCGG + Intergenic
1142995104 17:3755348-3755370 TAACCTGGCTGGGAGCAGGGGGG + Intronic
1143265979 17:5638371-5638393 CAACATGATTGGAGGCAGTGAGG - Intergenic
1143666265 17:8363094-8363116 CAAATTGGCTAGGGGCAGTGAGG + Intergenic
1144907193 17:18645289-18645311 CAACCTTAAAGGGGGCAGTGAGG + Intronic
1145279571 17:21457812-21457834 CCACCGGGGTGAGGGCAGAGAGG - Intergenic
1146645188 17:34572524-34572546 CAAGCTGGTTTGGGGAAGTGGGG - Intergenic
1146833215 17:36088624-36088646 CGACCTCGGTGGGCCCAGTGGGG - Exonic
1147168039 17:38603718-38603740 CAGTCTGGGTGGGGACAGCGGGG + Intronic
1147178456 17:38671120-38671142 CAACCTGGAAGGGGGCGGGGTGG - Intergenic
1147875068 17:43615215-43615237 AAACCTGGCTGGAGGCAGAGGGG - Intergenic
1148203632 17:45766035-45766057 CAGCCTGGGGCGGGGCTGTGGGG + Intergenic
1148864470 17:50621324-50621346 CTCCCTGGGTGGTGGTAGTGTGG + Intronic
1149506416 17:57197675-57197697 CAAAGTGTGTGGGGGCAGTAAGG - Intergenic
1151304996 17:73257631-73257653 CACCCTGGAGGGTGGCAGTGTGG - Intronic
1151312946 17:73305295-73305317 CAGCCTGTATGGGGGCAGTGGGG - Intronic
1151473682 17:74333101-74333123 CTGCCTGCCTGGGGGCAGTGAGG + Intronic
1151522708 17:74641635-74641657 CATCCTGGGTCCGGGGAGTGGGG - Intergenic
1151625174 17:75271614-75271636 CTACCTGGGTTGGGGGAGCGGGG - Intergenic
1151793436 17:76325120-76325142 CAACCTGGGTCCGGGCACAGTGG + Intronic
1151972635 17:77466646-77466668 CACACAGGGTCGGGGCAGTGTGG + Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152638404 17:81439539-81439561 CACACGGGGTGGGGTCAGTGGGG + Intronic
1152871648 17:82757128-82757150 CACCCTGGGTGGGGGCACCCTGG + Intronic
1153978793 18:10291947-10291969 GAACGTGGCTGGGGGCTGTGTGG - Intergenic
1155848864 18:30745011-30745033 CAGCTTGGGTGAGGGAAGTGAGG - Intergenic
1156499104 18:37545662-37545684 AAGCCTGGATGGAGGCAGTGGGG + Intronic
1157620794 18:49016578-49016600 CAGCCTGGAAGGGGGCAGGGTGG + Intergenic
1160137590 18:76285851-76285873 GAGTCTGGGTGGGTGCAGTGGGG - Intergenic
1160396903 18:78579444-78579466 TAGCCTGAGTGGGGGCAGGGAGG + Intergenic
1160441914 18:78899509-78899531 CCACCTGGGTGGGGGGAGCTGGG + Intergenic
1160702957 19:517402-517424 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160702982 19:517453-517475 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703023 19:517546-517568 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703079 19:517670-517692 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703167 19:517876-517898 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160772842 19:840818-840840 CAACCTTTGTGGGGGCGGGGAGG - Intergenic
1160961145 19:1721482-1721504 CATCCTGGGTGCAGGAAGTGTGG - Intergenic
1161176331 19:2844524-2844546 CACCCTGGTTGGGGGCATGGTGG - Intronic
1161326382 19:3666091-3666113 CCCCCGGCGTGGGGGCAGTGTGG - Intronic
1161542421 19:4860048-4860070 CAAACTGGGTGGGGGAAGATGGG + Intronic
1161960306 19:7519620-7519642 AGACCTGGGGGGTGGCAGTGAGG - Exonic
1162490451 19:10988065-10988087 CAGCCAGGGTGGGAGCAGGGAGG - Intronic
1162566298 19:11447198-11447220 GAGGCGGGGTGGGGGCAGTGTGG - Intronic
1163153804 19:15429477-15429499 CAGGGTGGGTGGGGGCGGTGGGG - Intronic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1164179535 19:22807086-22807108 ACAGCAGGGTGGGGGCAGTGGGG + Intergenic
1164534713 19:29076528-29076550 CAGCCTGGGTCGAGGCAGGGCGG - Intergenic
1164809003 19:31141411-31141433 CAACCTGGGCGGAGGCTGGGAGG - Intergenic
1165060806 19:33204436-33204458 ACACCTGGATGGGGACAGTGTGG + Intronic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1165777750 19:38414820-38414842 CAGCCTGGGCGGGGCCAGGGGGG + Intronic
1166071929 19:40393007-40393029 CTTCCTGGGTGGGGCCAGAGTGG + Intergenic
1166268025 19:41696910-41696932 CTGCCTGGGTGGGGACACTGGGG - Intronic
1166543839 19:43622780-43622802 TAACTTTGATGGGGGCAGTGAGG - Exonic
1166738013 19:45097496-45097518 CCAGCTGGGTGGGAGCTGTGGGG + Intronic
1167082193 19:47284203-47284225 CAGCCTGGGTGGTGACAGCGAGG + Intergenic
1167350116 19:48969158-48969180 CGGACTGGGTGGGGGCACTGCGG + Exonic
1167493812 19:49806662-49806684 ACATCTGGGTGGGGGCATTGGGG - Exonic
1168267431 19:55230458-55230480 CTCCCGGGGTGGGGGCAGGGCGG - Exonic
1202713286 1_KI270714v1_random:28760-28782 GAAGCTGGGTGGGGGTGGTGGGG + Intergenic
925900005 2:8502512-8502534 CGACCCCAGTGGGGGCAGTGTGG + Intergenic
925902369 2:8517787-8517809 CAGCCTGGGTGCAGGCAGTGGGG + Intergenic
926086485 2:10023341-10023363 CATCCTGAGTTGGGGCAGGGAGG + Intergenic
926685927 2:15697522-15697544 AGACTTGGGTGGGGGGAGTGGGG - Intronic
926765234 2:16318239-16318261 CAGCTGGAGTGGGGGCAGTGTGG + Intergenic
927980500 2:27371627-27371649 CAGCCTGGGTGGAGGTAGTGGGG - Intronic
929086731 2:38175341-38175363 GATACTGGGTGGGGGCACTGAGG + Intergenic
930000721 2:46859875-46859897 CCACCTGGCTGGGGGCAGGTGGG + Intergenic
930035541 2:47083143-47083165 CAGCCTGGGAGGAGGCCGTGGGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
932805317 2:74778178-74778200 CAAAGTGGGTGTGGGGAGTGGGG + Intergenic
932826712 2:74947956-74947978 CTTCCTGGGTGGGGGAAGGGTGG + Intergenic
933066431 2:77804697-77804719 GAAACTGGCGGGGGGCAGTGAGG + Intergenic
933707692 2:85304111-85304133 CTGCCTGGGCGGGGGCAGGGAGG - Intronic
933726050 2:85427907-85427929 CCACCAGGCTGGGGGCACTGGGG - Intronic
934171517 2:89544398-89544420 CAATGTGGGTGGGGTGAGTGGGG + Intergenic
934281825 2:91618716-91618738 CAATGTGGGTGGGGTGAGTGGGG + Intergenic
934608104 2:95713376-95713398 CAAGTAGGGTGGGGACAGTGTGG - Intergenic
936385880 2:112028651-112028673 CATCCTGAATGGGGGCAGTGAGG + Exonic
936400406 2:112160308-112160330 AAGCCTGGTTGGTGGCAGTGGGG + Intronic
936861679 2:117027487-117027509 CACCCTGGGTGGGAGGAGTGGGG - Intergenic
937044196 2:118842482-118842504 GAAACTGGGCGGGGGCAGCGAGG + Exonic
937119839 2:119433427-119433449 TCACCTGGGTAGGGGCAGAGTGG + Intronic
937131729 2:119518884-119518906 CAACCTGGGTGGGGATCATGAGG + Intronic
937271369 2:120654983-120655005 CAACCGGGGTGTTGGCAGGGGGG + Intergenic
937714510 2:125016056-125016078 CAACCTGGGATAGGGGAGTGAGG + Intergenic
937871491 2:126789322-126789344 CCACCTGGGTGCGGGGACTGAGG + Intergenic
938079974 2:128364734-128364756 GGCCATGGGTGGGGGCAGTGTGG - Intergenic
938136846 2:128765996-128766018 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
938631261 2:133170232-133170254 GAACGTGGGTGAGGGCAGAGTGG + Intronic
942924053 2:181411332-181411354 CTCCCTGGGTGGGGGAAGGGTGG + Intergenic
943361732 2:186927286-186927308 CAACCTGGGAGGCGGAGGTGCGG + Intergenic
943738053 2:191378777-191378799 CAAGCGGGATTGGGGCAGTGTGG + Intronic
944599722 2:201290951-201290973 CAAACTGCGAGGTGGCAGTGAGG + Intronic
945028030 2:205637905-205637927 GAACCTGGCTGGGTGCTGTGCGG - Intergenic
945978496 2:216289231-216289253 CAACTTGGGTGGGGGGCGGGTGG - Intronic
946364721 2:219241917-219241939 GGACCAGGGTGGGGGCAATGGGG + Intronic
946414927 2:219535172-219535194 CTCCCTGGGTGGGGGCCCTGAGG + Exonic
946865138 2:224035909-224035931 CAGCCTGCATGTGGGCAGTGCGG + Intronic
947641565 2:231710195-231710217 CTGCCGGGGTGGCGGCAGTGGGG + Intronic
947848129 2:233262238-233262260 AGACCAGGGTGGGAGCAGTGAGG - Intronic
948592165 2:239057960-239057982 TAACCTGGGATGGGGCACTGAGG + Intronic
948641767 2:239379616-239379638 CCACCAAGGTGGGGGCTGTGGGG - Intronic
948709043 2:239813961-239813983 CAACCTGGGAAGGGGCAGCAGGG - Intergenic
1169091189 20:2862327-2862349 CAGACTGGGTGGGGATAGTGGGG - Intronic
1171298856 20:24041952-24041974 CACCCTGGGTGGGAGCAGATGGG - Intergenic
1171495429 20:25551633-25551655 AAACAAGGGTGGGGGCAGGGAGG + Intronic
1172195755 20:33090436-33090458 CTACGTTGGTGGGGGCAGGGGGG - Intronic
1172245459 20:33442893-33442915 CAACCAAGGTGGGTGCAGAGGGG - Intronic
1172620566 20:36315932-36315954 CAGCCTGGGAGGGGGTGGTGTGG + Intronic
1173263534 20:41457890-41457912 CAATCTGGGAGGGTGGAGTGTGG - Intronic
1173717049 20:45217541-45217563 TGACCTTGGTGGGGGCAGGGGGG + Intergenic
1173765219 20:45601084-45601106 GAACCTGGCTAGGAGCAGTGTGG - Intergenic
1174265601 20:49329453-49329475 GAACCAGGGAGGTGGCAGTGGGG + Intergenic
1174516833 20:51099069-51099091 CAGCGTGGGTGGGGACTGTGAGG + Intergenic
1175051190 20:56157080-56157102 CAACATGGGTGGGGGAAAAGTGG - Intergenic
1175418282 20:58815946-58815968 CAGCAGGGCTGGGGGCAGTGAGG + Intergenic
1175757420 20:61538571-61538593 CCTCCTGGGTGGATGCAGTGAGG + Intronic
1175953131 20:62593941-62593963 CAAACTGGGAGGGGGCTTTGGGG + Intergenic
1176108158 20:63399173-63399195 CATCCTTGGAGGGGGCCGTGGGG + Intergenic
1176241673 20:64078466-64078488 GACCCTGGGTGGGGACAGAGAGG - Intronic
1176245181 20:64093902-64093924 CAGTGTGGGGGGGGGCAGTGTGG + Intronic
1176728485 21:10465531-10465553 GAGCCGGGTTGGGGGCAGTGGGG + Intergenic
1178344096 21:31810379-31810401 CAACATGCATGGGGGCAGGGAGG + Intergenic
1180028093 21:45180082-45180104 CCACCCGCGTGGGGCCAGTGTGG - Intronic
1180067154 21:45418231-45418253 CATCCCTGGTGGGGGCAGAGGGG + Intronic
1181179171 22:21055245-21055267 GCCCCTGGGTGGGGGCTGTGGGG - Intronic
1181311480 22:21947116-21947138 CACCCTGGGAGGAGGCTGTGAGG - Intronic
1181509388 22:23382245-23382267 CATCCTGGCTGGGCGCTGTGCGG + Intergenic
1181556473 22:23674469-23674491 CAGCATGGGGGCGGGCAGTGCGG + Intergenic
1181769788 22:25117137-25117159 AAACCTGGATGGGGGCTGGGAGG - Intronic
1182024683 22:27108872-27108894 CAGCCAGGGTGGGGGCGGGGGGG - Intergenic
1183346226 22:37309844-37309866 CAAGCTGACTGGGGGCAGGGAGG + Intronic
1183353116 22:37344503-37344525 CCACCTGTGTGGGGGCAGCAGGG - Intergenic
1183423737 22:37726377-37726399 CCTCCTGGGTGGGGGCAGGTCGG - Exonic
1183510067 22:38229548-38229570 TAGCCTGGGTGGGGGCAGTGTGG - Intronic
1183647008 22:39132753-39132775 CAACCCAGGTGTGGGCAGTCAGG - Exonic
1184678002 22:46053928-46053950 CACCCCGGGTGGGCGCAGGGTGG + Exonic
1185047678 22:48537199-48537221 CACCCGGGGTGGGGGCAGGGTGG + Intronic
1185294925 22:50048490-50048512 GAGTCTGGGTTGGGGCAGTGTGG - Intronic
1185331906 22:50255740-50255762 CTGCCCAGGTGGGGGCAGTGGGG - Intronic
950345176 3:12287235-12287257 CAACATGGGTGGGGACGGAGTGG - Intergenic
950529696 3:13546130-13546152 CAGCCACAGTGGGGGCAGTGTGG - Intergenic
952326290 3:32323178-32323200 CAGCCTGGCTGGGGGCAGGAAGG + Intronic
952503810 3:33989352-33989374 CTCCCTGGGTGGGGGAAGGGCGG - Intergenic
952597228 3:35032619-35032641 CAACCCTTGTGGGGTCAGTGTGG - Intergenic
952932740 3:38372841-38372863 CAGCATGGGTGGGGGTGGTGAGG - Intronic
953761910 3:45695058-45695080 CAACCAGGGAGGGCTCAGTGAGG + Intronic
954157337 3:48693730-48693752 CTACCCGTGTGGGGGCACTGTGG - Intronic
954296583 3:49677645-49677667 CTGGCTGGGTGGGTGCAGTGGGG + Intronic
956167569 3:66408033-66408055 CCACGTGGATGGGGGCAGGGAGG - Intronic
957546499 3:81644803-81644825 GGACATGGGTGGTGGCAGTGGGG + Intronic
959056691 3:101574336-101574358 CTCCCAGGGTGGGGGGAGTGGGG + Intronic
959268350 3:104172092-104172114 TAGCCTGGGTGGGGGCAGCAAGG - Intergenic
959574481 3:107919532-107919554 CAACCTGAGTGGGGGCCGAAGGG + Intergenic
959580348 3:107976882-107976904 CAAACTGGGTGGTGGCAGGAAGG + Intergenic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
960413713 3:117358973-117358995 CTCCCTGGGTGGGGGAAGAGCGG + Intergenic
961085909 3:124067313-124067335 CAACAGGGGTGGGTGCGGTGGGG - Intergenic
961933133 3:130554793-130554815 CAACATGGGAGGCTGCAGTGGGG + Intergenic
963009620 3:140756808-140756830 CTTGCTGGGTGGGGGCACTGAGG - Intergenic
964533689 3:157696246-157696268 GGACCTGGGTGGTAGCAGTGTGG - Intergenic
965547916 3:169934297-169934319 TATCCAGGGTGGGAGCAGTGGGG + Intronic
965724090 3:171695739-171695761 CATCCTGGGTTGGGGGGGTGGGG - Intronic
968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG + Intronic
969157131 4:5220816-5220838 CAACTAAGGTGGTGGCAGTGGGG + Intronic
969173844 4:5384576-5384598 TCAGCTGGGTGGGCGCAGTGCGG + Intronic
969854444 4:9987873-9987895 CAGCCTGGCTGGAGGCAGTAGGG + Intronic
970152717 4:13106898-13106920 CAACCTGGGGAGTGGGAGTGGGG + Intergenic
970156920 4:13151224-13151246 GCCTCTGGGTGGGGGCAGTGGGG + Intergenic
972072387 4:35038278-35038300 CACCCTTGGTCGGGGCAGCGGGG - Intergenic
972249760 4:37287393-37287415 CAACCTGGGTTGGGGAAGGGTGG + Intronic
972343332 4:38171903-38171925 TCTCCTGGGTGGGGGGAGTGAGG + Intergenic
973717315 4:53690080-53690102 AGACCTGGGTGGGGGCTGAGAGG - Intronic
974534357 4:63155145-63155167 CCAACTGTGTGGGGGCAGTTGGG - Intergenic
975282557 4:72578577-72578599 GAACTTGTGTGGGGGAAGTGAGG - Intergenic
975473367 4:74794612-74794634 CAATTTGGGTGGGAGCAGCGTGG - Exonic
975484170 4:74916032-74916054 CAAGCTTGGTGGGGGCAGGAGGG - Intergenic
977716571 4:100190267-100190289 CGGCCTTGGTGGGGGCAGCGGGG - Intronic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
982585276 4:157229006-157229028 TATCCTGGTTGGGGGCAGGGAGG - Intronic
982858218 4:160412710-160412732 CAGACTGCGTGGGGGCAGTGCGG - Intergenic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
985628625 5:1003606-1003628 CAACATGGTTGGGGGGGGTGCGG + Intergenic
987399858 5:17463898-17463920 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
987453848 5:18119451-18119473 CTCCCTGGGTGGGGGAAGGGTGG + Intergenic
989194174 5:38699933-38699955 CAAGCTTGGTGGGGGTAGGGGGG + Intergenic
990564307 5:57013745-57013767 AAACTAGGGTGGGGGTAGTGAGG + Intergenic
992890160 5:81196616-81196638 CAACGGGGGAGGGGGGAGTGGGG - Intronic
993710045 5:91215677-91215699 CAAGCTGGCTAGGTGCAGTGTGG + Intergenic
993807891 5:92436056-92436078 CTACTTGGGTGGGGGAAGGGTGG + Intergenic
994727741 5:103456258-103456280 CAACTTGGGTGTGAACAGTGTGG - Intergenic
995338488 5:111030141-111030163 CAAACTGTGAGGTGGCAGTGAGG + Intergenic
996456496 5:123689637-123689659 CCACATGGGTGGGGGCAGGAGGG + Intergenic
997419698 5:133756266-133756288 GAACCTGGGTGGCAGGAGTGAGG + Intergenic
997459487 5:134042342-134042364 CAGGATGGGTGGGGGCCGTGAGG - Intergenic
997728098 5:136139559-136139581 CAACCAGGGTGATAGCAGTGGGG - Intronic
997800961 5:136861634-136861656 CTCCCTGGGTGGTGGGAGTGAGG + Intergenic
998267429 5:140676776-140676798 GCCCCTGGGTGTGGGCAGTGTGG - Exonic
1001193059 5:169648282-169648304 CAACCTGGGGGAGGGGAGTCGGG - Intronic
1001518621 5:172374674-172374696 CCATCTTGGTGGGGGGAGTGGGG + Intronic
1001518831 5:172376531-172376553 CAACCTGGGAGAGAGCAGTGAGG + Intronic
1001775671 5:174327567-174327589 CAGCCTGGCTGGGGGCACTGCGG + Intergenic
1001839727 5:174864869-174864891 CTCCCTGGGTGGGGACAGGGTGG - Intergenic
1001985865 5:176074132-176074154 AAACCTGGGCTGGGCCAGTGAGG - Intronic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1002196291 5:177503473-177503495 CGAGCTGGGAGGAGGCAGTGGGG - Intronic
1002231006 5:177763992-177764014 AAACCTGGGCTGGGCCAGTGAGG + Intronic
1002264332 5:178019756-178019778 AAACCTGGGCTGGGCCAGTGAGG - Intronic
1002346560 5:178551969-178551991 CATCCTGAGTGGAGGCAGAGGGG - Intronic
1002634157 5:180598844-180598866 GAACAAGGGTGGGGGGAGTGTGG + Intergenic
1003157130 6:3606518-3606540 CAAACTAGGTGGGGGCGCTGAGG + Intergenic
1003244017 6:4369226-4369248 CCAGCTGGGTGTGGTCAGTGGGG - Intergenic
1003957032 6:11173667-11173689 CAGCCTGGGAGGGGGCATTGAGG - Intergenic
1003966772 6:11259307-11259329 CAACCTGGAAGGGGGCAGCAAGG + Intronic
1006341879 6:33451839-33451861 CAGCCGGGGTGGGGGTGGTGGGG - Exonic
1006461456 6:34161643-34161665 AGACCTGGGTGAGGGCAGGGAGG + Intergenic
1006640155 6:35485628-35485650 CAGCCTGGGAGGCAGCAGTGGGG + Intronic
1007094249 6:39203630-39203652 CACGCTGGGTGGGGGCTGGGAGG - Intronic
1007385856 6:41519805-41519827 CTGCTGGGGTGGGGGCAGTGGGG - Intergenic
1007812347 6:44495505-44495527 CCCCCTGGGTGGTGGCTGTGGGG - Intergenic
1008094770 6:47328310-47328332 CGAACTGGGTGGAGGCACTGTGG + Intergenic
1008588461 6:52970195-52970217 CACCTTGGGTTGGGGCAGGGAGG - Intergenic
1013807397 6:114010923-114010945 CAAACTGGGCGGTGGCAGTTAGG + Intronic
1013917141 6:115354433-115354455 CTACCTGGCCGGGAGCAGTGAGG + Intergenic
1015618477 6:135104669-135104691 AAAGCTGGATGGGGGCAGTTAGG - Intergenic
1016201021 6:141408697-141408719 CAAGCTGGGGAGGGGCAGTGTGG - Intergenic
1017223531 6:151993705-151993727 CAACCTGGGAGGAAGCAGAGTGG + Intronic
1017720033 6:157237370-157237392 CATACTGGGTGGGGGAAGGGAGG + Intergenic
1017981104 6:159401808-159401830 TAACCTCAGTGTGGGCAGTGAGG - Intergenic
1018955941 6:168410714-168410736 CTGCCAGGGCGGGGGCAGTGGGG + Intergenic
1019188070 6:170232623-170232645 CACCCTGGGTGGGGGGGATGAGG + Intergenic
1019304874 7:328556-328578 CAGCCTGGGTGGGGACAGGTGGG - Intergenic
1019747569 7:2709241-2709263 CAAGGTGGGTGGGGGCTCTGGGG + Exonic
1022332948 7:29397507-29397529 CAAGCTGGGTTGGGGAAATGAGG - Intronic
1022521943 7:31014103-31014125 CCTCCTGGGCTGGGGCAGTGAGG - Intergenic
1023940919 7:44767966-44767988 CAGGCTGGGTGGGGGCAGGCAGG - Exonic
1023999270 7:45180232-45180254 CACCCTGGGTGGAGGCAGCCTGG + Intronic
1024125449 7:46290339-46290361 CATTCTGGGTGCAGGCAGTGAGG - Intergenic
1025744788 7:64233194-64233216 CAAGCTGGAGTGGGGCAGTGGGG - Intronic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1026267893 7:68811176-68811198 GAACCTGGGGGTGAGCAGTGGGG + Intergenic
1027374250 7:77535518-77535540 CAACCTGGGCGACGGGAGTGAGG - Intergenic
1028767061 7:94571409-94571431 CTGCAGGGGTGGGGGCAGTGCGG - Intergenic
1029380558 7:100211706-100211728 CACCCGGGGTGGGGGAAGTGGGG - Intronic
1029651714 7:101897959-101897981 CAAGCTGGGTGGGGGTAGGAGGG - Intronic
1030854986 7:114544307-114544329 CTAACTGGGTGGGGGCAGGGTGG - Intronic
1031849923 7:126851322-126851344 GAATCAGGGTGGGGGCAGTTAGG - Intronic
1032944249 7:136831595-136831617 CAAACTGTGAGGCGGCAGTGAGG + Intergenic
1034601607 7:152262429-152262451 GAGCCGGGTTGGGGGCAGTGGGG - Intronic
1034674262 7:152881192-152881214 CACACTGGGTGGGGGGAGGGGGG + Intergenic
1035099419 7:156384116-156384138 CAACCTGGGAGAGTGAAGTGGGG + Intergenic
1035519752 8:266672-266694 TCACCTGGGAGGGGGCAGTCGGG + Intergenic
1038683425 8:29692579-29692601 CCAGCTGGGTGGGGGGAGGGGGG + Intergenic
1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG + Intronic
1040385250 8:46910980-46911002 CAGGCTGGGGTGGGGCAGTGGGG - Intergenic
1040439041 8:47422327-47422349 CAAACTGCAAGGGGGCAGTGAGG - Intronic
1040568442 8:48587457-48587479 CAACCCTGGTGGGGGCTGTGAGG + Intergenic
1040699346 8:50042290-50042312 CACCCTGGGGGTGGGCTGTGGGG - Intronic
1040899455 8:52403109-52403131 CAACTTGGATGGGGGAAATGGGG + Intronic
1041886884 8:62820035-62820057 GAACCAAGGTGGGGACAGTGAGG + Intronic
1042335261 8:67623508-67623530 GAACCTGGGAGGTTGCAGTGAGG - Intronic
1042629939 8:70805507-70805529 CTCCCTGGGTGGGGGAAGGGCGG + Intergenic
1044499001 8:92929032-92929054 CAGCTTGGATGGGGGCAATGAGG + Intronic
1044507172 8:93035654-93035676 CAGCATGGGTGGGCGCAATGGGG - Intergenic
1045205496 8:100035528-100035550 CAACCTTGTGGGGGACAGTGTGG + Intronic
1047201447 8:122771021-122771043 CAACATGGGGGTGGGCAGTAGGG + Intergenic
1047291745 8:123537912-123537934 CATCCTGGGGGTGGGCGGTGAGG + Intronic
1047471663 8:125179781-125179803 AAGACTGAGTGGGGGCAGTGAGG - Intronic
1048993236 8:139773622-139773644 GAGCCAGGGTGGGGGCTGTGGGG - Intronic
1049377424 8:142295910-142295932 CATCCTGGGTGCCGGCAGTGAGG + Intronic
1049981173 9:905170-905192 CATCCTGGGGGGAGGCAGTAAGG - Intronic
1053013028 9:34646179-34646201 CAAACTTGGTGGGGTCTGTGTGG - Intronic
1053151155 9:35744029-35744051 CTAGTTGGGTTGGGGCAGTGAGG + Intronic
1053152975 9:35754577-35754599 CACCCCTGGTGGTGGCAGTGGGG - Exonic
1055091199 9:72365676-72365698 CAAAATGGGTGTGGGGAGTGAGG - Intergenic
1055754483 9:79543218-79543240 GAACCTGGGTGGAGGCAGGCAGG + Intergenic
1057199294 9:93131803-93131825 CAACCTGGGTGGGCTCTGTTGGG - Intronic
1057705772 9:97393917-97393939 TCAACTTGGTGGGGGCAGTGGGG - Intergenic
1060675499 9:125510688-125510710 CAACCTGGGGGAAGGCAGGGTGG + Intronic
1060785251 9:126447230-126447252 AAAGGTGGCTGGGGGCAGTGTGG - Intronic
1060810726 9:126610344-126610366 TAAACTGGGAGGGGGCAGTGTGG + Intergenic
1061191393 9:129084804-129084826 AAAGCAGGGTGGGGGCACTGGGG - Intronic
1061361138 9:130143102-130143124 GAGCCTGGGTGGGGGCAGGGAGG - Intergenic
1061375588 9:130222602-130222624 GATCCTGGGCTGGGGCAGTGGGG - Intronic
1061409106 9:130408950-130408972 CACCTTGGGTGGGGCCACTGAGG + Intronic
1061435012 9:130555567-130555589 ACACCTGGGTGCAGGCAGTGTGG - Intergenic
1061464704 9:130768489-130768511 CAGCCTAGCTGGGGGCAGGGTGG - Intronic
1061825867 9:133257828-133257850 CTACCTGGGGAGGGGCAGCGGGG - Intronic
1062155565 9:135046293-135046315 GACCCTGGGTGGGGGCAGGGTGG + Intergenic
1062386182 9:136312408-136312430 CACCCTGAGTAGGGGCCGTGGGG - Intergenic
1062478473 9:136741028-136741050 GCACCTGGGTGGGGGCTCTGAGG - Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1062589688 9:137267976-137267998 CCACCTGGGGTGGGGCACTGGGG - Intronic
1062614047 9:137388018-137388040 CCATGTGGGTGGGGGCAGAGCGG + Intronic
1186666283 X:11720657-11720679 CCACCTGGGTGGGGGTAGGGTGG - Intergenic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1188341357 X:29006122-29006144 CCAGCTGGGTGTGGCCAGTGAGG + Intronic
1189822654 X:44885359-44885381 CAATTAGGATGGGGGCAGTGGGG - Intronic
1190982963 X:55472972-55472994 CAATGTGTGTGGGGTCAGTGTGG - Intergenic
1190985736 X:55500211-55500233 CAATGTGTGTGGGGTCAGTGTGG + Intergenic
1193091074 X:77494406-77494428 CTCCCTGGGTGGGGGAAGGGAGG + Intergenic
1193270031 X:79517922-79517944 TCACCTGGGTGGTGGCAGTGGGG - Intergenic
1193888223 X:87009408-87009430 CTACCTGTGGGGGGGCAGAGGGG + Intergenic
1194342972 X:92728521-92728543 CAGCATGGGTTGGGGCAGGGGGG - Intergenic
1195269491 X:103215659-103215681 CTGCCGGGGTGGGGGAAGTGGGG - Intronic
1197744959 X:129926051-129926073 CTACCTGGCTGGGGCGAGTGGGG + Exonic
1199690766 X:150307645-150307667 CAACCTTGGTGGGTGGTGTGAGG - Intergenic
1199718517 X:150525089-150525111 GTCCCTGGGTGGGGGAAGTGGGG + Intergenic
1200118232 X:153778568-153778590 CCACGTGGAGGGGGGCAGTGAGG - Intronic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic
1200651333 Y:5845187-5845209 CAGCATGGGTTGGGGCAGGGGGG - Intergenic
1200707663 Y:6456583-6456605 CAGGATGGGTGGGGGCAGTGAGG - Intergenic
1201026449 Y:9708125-9708147 CAGGATGGGTGGGGGCAGTGAGG + Intergenic
1201867705 Y:18672693-18672715 GAACCTTCTTGGGGGCAGTGAGG - Intergenic