ID: 931431758

View in Genome Browser
Species Human (GRCh38)
Location 2:62214185-62214207
Sequence CTGAGGGAACAGTAGCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931431758 Original CRISPR CTGAGGGAACAGTAGCATAT TGG Intronic
900887395 1:5424588-5424610 CTGAGGGAAGAGTAGCCCATTGG + Intergenic
902704207 1:18193199-18193221 CAGAGGGAAGAGCAGCATAGAGG + Intronic
906188818 1:43882245-43882267 CAGAGGGAACAGTGGTATAGAGG + Intronic
906515898 1:46438641-46438663 CTGAGGAACCAGTCGCAGATGGG - Intergenic
912142561 1:106748945-106748967 AGGAGTGAACAGTAGCAAATGGG - Intergenic
916624308 1:166537604-166537626 CTGATGGAAGACCAGCATATGGG - Intergenic
920765346 1:208827154-208827176 ATGAGGGAACAGTAACATATAGG + Intergenic
921977060 1:221214413-221214435 TTGCGGGAACAGTAGCAGGTTGG + Intergenic
923926192 1:238629875-238629897 CTGAGGTGTCAGTAGCAGATAGG - Intergenic
1065297627 10:24291612-24291634 CTGTGGGGACAGTAACTTATAGG + Intronic
1067759350 10:49031886-49031908 CTGAATGAACAGTGCCATATGGG - Intronic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1069064941 10:63932557-63932579 CTGAGCAAACAGTAGCTTAAAGG + Intergenic
1072221196 10:93329077-93329099 CTGAGGCCAAAATAGCATATGGG - Intronic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1074928105 10:118094170-118094192 CTGGGGGAACTGTTACATATAGG + Intergenic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1077534495 11:3115642-3115664 CTGATGCAAGACTAGCATATGGG + Intronic
1078928877 11:15898131-15898153 CTAAGGGAACAGAAGAATCTTGG + Intergenic
1082176899 11:49070949-49070971 CTGTGGGATCAGTCGAATATGGG - Intergenic
1082612284 11:55315013-55315035 CTGTGGGAACTGTAGCCTCTTGG + Intergenic
1083504565 11:63143678-63143700 ATTAGGGAACAGTAGGATGTTGG + Exonic
1085112606 11:73901147-73901169 CTGAGGGAACAGTAAAAGCTGGG + Intronic
1085800540 11:79585372-79585394 CTGAGGAAAGAGTAGAATATGGG + Intergenic
1086401258 11:86462825-86462847 CTGAGGGAACAGGGGCTGATGGG + Intronic
1086426127 11:86684229-86684251 CTGAGGGACCACTAACACATTGG - Intergenic
1086688814 11:89764913-89764935 CTGTGGGATCAGTCGAATATGGG + Intergenic
1086717043 11:90075044-90075066 CTGTGGGATCAGTCGAATATGGG - Intergenic
1087047494 11:93855042-93855064 CTGATGCAAGACTAGCATATGGG - Intergenic
1087413500 11:97822768-97822790 CTAAGGAAAAAGTAGCAAATTGG - Intergenic
1090932485 11:131310721-131310743 TTGAGGGGAGAGTAGGATATAGG + Intergenic
1092271442 12:7026977-7026999 CTGATGCAAGACTAGCATATGGG - Intronic
1096199111 12:49668629-49668651 CTGAGGGCCCAGTAGCAGAAAGG - Intronic
1098408782 12:70156085-70156107 CTGATGTAAAACTAGCATATGGG + Intergenic
1098501800 12:71201616-71201638 CTGATGAAACAGGAGCATACAGG - Intronic
1103969503 12:124661253-124661275 CAGAGGGAACAGTCGCAGCTGGG - Intergenic
1105062846 12:133169605-133169627 CTGTAGAAACAGTAGCTTATTGG - Intronic
1105314324 13:19243445-19243467 CTGAGGGAAAAATGGCAGATGGG + Intergenic
1106203109 13:27560478-27560500 CTGAGTCAAAAGTAGGATATCGG + Intronic
1107658224 13:42613525-42613547 CTGAGAGGACAGAACCATATTGG + Intergenic
1111196318 13:84878230-84878252 CTGATGCAAGAGCAGCATATAGG - Intergenic
1112653881 13:101428105-101428127 CTGAGGGAAGAGTACTTTATAGG - Intergenic
1117645730 14:57850058-57850080 CTGAGGGGAAATTAGCATAGTGG - Intronic
1118023477 14:61743819-61743841 CTGAGTGAAAAATAGCATAGTGG + Intronic
1119811173 14:77520869-77520891 CTGACGGAAGAGTAGCAAAGAGG - Intronic
1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG + Intergenic
1120992300 14:90388274-90388296 CTGTGGGAACCTTTGCATATGGG - Intergenic
1124933232 15:34144187-34144209 CTGAGGGAAGAAAAGCAAATGGG - Intronic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1137773062 16:51033530-51033552 CTGAGTGAACAATAGTTTATAGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151707004 17:75774439-75774461 CTGAGGGTACTGTAGAATTTGGG + Intergenic
1151887952 17:76934161-76934183 CTCAGTGAACAGTAGCGTCTTGG - Intronic
1152047531 17:77947392-77947414 CTGAGGGAAGGGAAGTATATAGG + Intergenic
1154079862 18:11245457-11245479 CTGAGGGAAAAATAGCAGTTTGG + Intergenic
1154984150 18:21532528-21532550 CTGCGGGATCAGTCGAATATGGG - Exonic
1158057863 18:53303697-53303719 CTGAGCCCACAGTAGCATCTAGG + Intronic
1158690250 18:59653808-59653830 CAGAGGGATCAGTAACAAATTGG - Intronic
1160314925 18:77833956-77833978 CTTAAGGAACAGTAGCTTCTGGG + Intergenic
1161168353 19:2800634-2800656 CTGAGGGAACACTCGCAGGTCGG + Intronic
1167675730 19:50884034-50884056 CTGAGGGAACAATAGATCATCGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
931431758 2:62214185-62214207 CTGAGGGAACAGTAGCATATTGG + Intronic
932793023 2:74672329-74672351 CTGAGGGAACAGTATCTCAGAGG - Intronic
935507314 2:103921633-103921655 CTTAAGGAACAGTGACATATAGG - Intergenic
936235145 2:110735951-110735973 CTGAGAGAACAGAATCCTATGGG - Intronic
936646312 2:114376507-114376529 CTGAGGTGTCAGTAGCAGATAGG - Intergenic
938775185 2:134535524-134535546 CTAAGGGGAGAGTAGCAAATGGG + Intronic
940721799 2:157290668-157290690 TTTAGGGAACAGTAGCATCAAGG - Intronic
941153614 2:161947097-161947119 CTGAGGAAACTGAAGCATAAAGG - Intronic
945786460 2:214245277-214245299 ATCAGGGAACTGCAGCATATAGG - Intronic
1168825146 20:806870-806892 CTGATGCAAGACTAGCATATGGG + Intergenic
1168872917 20:1146326-1146348 CTGAGGAAACAGTAGGTTAGAGG + Intronic
1169712435 20:8580021-8580043 GTGATGGAGCAGTAGAATATTGG + Intronic
1172259752 20:33552848-33552870 CAGAGGGAACAGAATAATATAGG - Intronic
1175910656 20:62403863-62403885 CTCAGGGAACAGTAACTTCTCGG - Intronic
1176334153 21:5580092-5580114 CTGAGCAATCAGTAGCATAGTGG + Intergenic
1176393604 21:6240860-6240882 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1176467815 21:7075314-7075336 CTGAGCAATCAGTAGCATAGTGG + Intronic
1176491376 21:7457092-7457114 CTGAGCAATCAGTAGCATAGTGG + Intergenic
1176509266 21:7681291-7681313 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1180204665 21:46251160-46251182 CTGAGGTAACAGTAACTTCTTGG - Intronic
1183270431 22:36859113-36859135 CTGAGGGAAGAGGAGGACATTGG - Intergenic
949233130 3:1774871-1774893 TGGAGGGAACAGTAGCACAGGGG - Intergenic
950236574 3:11326727-11326749 CTGATGGAAGAGTAGCAGGTGGG + Intronic
951652571 3:24967236-24967258 CTGAGGGAAGAAAAGCAAATGGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955956701 3:64297298-64297320 CTGAGGCAACAATACCATTTGGG + Intronic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
957978477 3:87476999-87477021 CTGATGGAAAAGTAGAATACAGG + Intergenic
963384464 3:144573201-144573223 TTGAAGGAACAGAAGCATTTAGG + Intergenic
964401943 3:156308873-156308895 CTGATGGAACATTAGAATTTAGG + Intronic
968020543 3:195384182-195384204 CTGCGGTAACAGTAAAATATTGG + Intronic
970542960 4:17097783-17097805 CTGAGGGCAGAATAGCACATTGG + Intergenic
972362601 4:38342153-38342175 ATGCTGGAACAGTGGCATATGGG - Intergenic
974663672 4:64929177-64929199 CTGAGGGCACAGGTGCATTTTGG + Intergenic
976501943 4:85801204-85801226 CTGAGTAAAAAGTAGGATATAGG - Intronic
976762469 4:88564978-88565000 CTGAATGACCAGAAGCATATTGG - Intronic
978008295 4:103646902-103646924 CTTAGGGAACAGTATGATATAGG + Intronic
978147890 4:105398136-105398158 CTGAGGCAAAAATACCATATAGG + Intronic
978950339 4:114550866-114550888 CTGATGCAACACCAGCATATGGG - Intergenic
981366050 4:143904611-143904633 CTGAGCATACAGTAGCATACAGG - Intronic
982756809 4:159229821-159229843 CTGAGGGAGTACTAGCATTTAGG + Intronic
984979763 4:185268593-185268615 CTGATGGAAAAGTAAAATATTGG + Intronic
985032099 4:185799809-185799831 ATGAGGGAACTGTGGCATAGAGG + Intronic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
985870070 5:2547401-2547423 CTCAAGGAACAGTTGCTTATTGG - Intergenic
986342597 5:6803832-6803854 GTGAGGGAACAGTATCAAAGAGG + Intergenic
989678855 5:44005915-44005937 CTTAGGGAATATTGGCATATTGG + Intergenic
995663436 5:114512442-114512464 CTTAGGCAACAGTAGAAAATAGG + Intergenic
995756593 5:115512046-115512068 CTGAGGGAAAAGTAGCTCCTGGG + Intergenic
997713285 5:136023894-136023916 AAGAGGGAACAGAAGCATCTAGG + Intergenic
999826887 5:155282111-155282133 CTGAGGGGACAGTGCCATTTGGG + Intergenic
1002129383 5:177070785-177070807 CGGGGGGAAAAGTAGCATAGTGG + Intronic
1002518409 5:179775892-179775914 CTAAGGGAACCTTAGCATAAAGG + Exonic
1005343848 6:24869734-24869756 CTGACAGAACAGTATCATATTGG + Intronic
1010544671 6:77137637-77137659 CTAAGTTAACAGTAGCATCTGGG + Intergenic
1010796996 6:80128576-80128598 CTAAGGGAACAGTCACAAATAGG - Intronic
1012879349 6:104766935-104766957 GTGAGGAAACAGAAGCATATAGG - Intronic
1018179755 6:161212050-161212072 CTGATGCAAGACTAGCATATGGG + Intronic
1018252491 6:161885254-161885276 CTGAGTGAACATCAGCGTATGGG + Intronic
1020340773 7:7108083-7108105 CTGATGGAAGACCAGCATATGGG + Intergenic
1020879602 7:13742829-13742851 ATCAGGGCACTGTAGCATATTGG - Intergenic
1022458597 7:30581988-30582010 CTGATGCAAGACTAGCATATGGG + Intergenic
1029821853 7:103153880-103153902 TTGAGAGAACAGCAGCATAAGGG + Intergenic
1030925547 7:115449451-115449473 ATGAGGGAAAATTAGCTTATTGG - Intergenic
1031874106 7:127118991-127119013 CAGAAGGAACAGTAGCAATTGGG - Intronic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1039143939 8:34423980-34424002 TTGAGGGAACAGAAGCAATTAGG + Intergenic
1042968218 8:74378902-74378924 CTTAGGGAAGAGTTGCTTATAGG + Intronic
1042998758 8:74731705-74731727 TTGAGGGTACAGCATCATATAGG - Intronic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1050126734 9:2363924-2363946 CTGAGAGAAATGTAGCATTTGGG + Intergenic
1050692041 9:8239144-8239166 CTAGGGGAAGAGTAGAATATTGG + Intergenic
1050762700 9:9092132-9092154 ATGAGTTAACAGTAGCATGTTGG - Intronic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1051452945 9:17217433-17217455 CTGAGTGAACAGTGGCCTGTGGG + Intronic
1052557561 9:30036738-30036760 CTGGGGGAACAGCAGATTATTGG - Intergenic
1055604062 9:77949555-77949577 ATGAGGGAACAGCAGCAGCTGGG + Intronic
1061693257 9:132352891-132352913 CTGAGGGAGAAGGAGCGTATAGG - Intronic
1203427484 Un_GL000195v1:54805-54827 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1185955882 X:4488346-4488368 CTGGAGGAACACTAGCATAAAGG + Intergenic
1191079772 X:56497092-56497114 CTGAGGGAACTGAGGCATTTGGG + Intergenic
1192019825 X:67376308-67376330 CTGAGGGAACAGCAGTCTATAGG + Intergenic
1196032200 X:111103096-111103118 ATGAGGGAGCAGTAGCAGGTGGG + Intronic
1196772980 X:119313891-119313913 CTGATGGAAGACCAGCATATGGG + Intergenic
1196940673 X:120772805-120772827 ATGATGGAACACTAGCATATAGG + Intergenic
1197042913 X:121961796-121961818 CTGAAGCAACATCAGCATATGGG + Intergenic
1197864828 X:131006803-131006825 CTGAGGGAAGAGGAGCAGATTGG + Intergenic
1197988991 X:132296835-132296857 CTGAAGGATCAGTGGCAGATAGG - Intergenic
1198691876 X:139293290-139293312 ATGAGGGAACTGAAGCATAAAGG - Intergenic
1200911737 Y:8537190-8537212 CTGAGGGAAGAGCAGCATACTGG + Intergenic
1200925165 Y:8647730-8647752 CTGAAGGAACAGTGGTATACTGG + Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic