ID: 931433051

View in Genome Browser
Species Human (GRCh38)
Location 2:62224821-62224843
Sequence ATAGTTCAACACTACTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931433051 Original CRISPR ATAGTTCAACACTACTGTAA TGG (reversed) Intergenic
904818081 1:33220522-33220544 ATAGTCCAACATGACTGTAGGGG - Intergenic
905065895 1:35182255-35182277 ATAATTCAACCAAACTGTAATGG + Intronic
909507100 1:76404876-76404898 ATTGTTTTACACTACTCTAATGG - Intronic
910852272 1:91660324-91660346 AGAGCTCAGCACTACTGAAATGG + Intergenic
911127763 1:94356577-94356599 ATAGTTCAACACTAAGGAGATGG + Intergenic
912759355 1:112353310-112353332 ATATTTTAAAACTACCGTAAAGG + Intergenic
915878229 1:159635974-159635996 ATAGTACAACACTAGCATAAAGG + Intergenic
916281234 1:163053687-163053709 AAACTTCAACACAACTGTAATGG + Intergenic
923968529 1:239172564-239172586 ATAGTTCCACATTGCTGGAAAGG - Intergenic
923996294 1:239498638-239498660 ATTGTTCATCAGTGCTGTAATGG + Intronic
924167290 1:241297454-241297476 ATTCTTCAGCATTACTGTAAGGG + Intronic
924487416 1:244499225-244499247 TAAGTTCAAAACTACTATAATGG - Intronic
1067254420 10:44621969-44621991 AGAGTTCAACACCCCTGTATTGG + Intergenic
1069127084 10:64649322-64649344 ATAGTCCAAGACTAATGCAATGG + Intergenic
1070450893 10:76556133-76556155 AAAGTTCAACCCTATTGTAGGGG + Intronic
1073419598 10:103413642-103413664 ATTGTTCAACGCTGCTGTTATGG + Intronic
1073835356 10:107435116-107435138 ATAGTTGAACACAACTGCAAAGG + Intergenic
1078766967 11:14307366-14307388 ATAGTTCAAGACAACCGTATTGG + Intronic
1080205054 11:29718408-29718430 ATACTACAACACTATTGAAATGG - Intergenic
1081474185 11:43409128-43409150 ATGTTTCAACTCTACTGTACAGG + Intronic
1082203305 11:49400336-49400358 ATACTTATGCACTACTGTAAAGG + Intergenic
1085550142 11:77362069-77362091 ATTGTTCAACAATATTTTAAAGG + Intronic
1086651731 11:89299753-89299775 ATATTTATGCACTACTGTAAAGG - Intergenic
1093674011 12:21913157-21913179 ATACTTCAAAAATACTTTAAGGG + Intronic
1095073385 12:37886350-37886372 ATAGTTTAATACTTCTTTAATGG - Intergenic
1095859024 12:46893994-46894016 ATAGTTGAACACAACTGCAAAGG + Intergenic
1096730070 12:53602591-53602613 ATGCTACAGCACTACTGTAATGG + Intronic
1099784624 12:87245100-87245122 ACAATTCAACACTAATGCAATGG + Intergenic
1107138297 13:36969456-36969478 ATAGATCAATACTAATTTAATGG - Intronic
1108029146 13:46210933-46210955 ACAGTACACTACTACTGTAAAGG + Intronic
1109872212 13:68347168-68347190 ATTGATCAACACTACAGTGACGG - Intergenic
1114365321 14:22020298-22020320 AAAGTTCATGACTACTGTAGAGG - Intergenic
1114372122 14:22101145-22101167 ATATTTCTATACTACAGTAAGGG - Intergenic
1116030194 14:39561921-39561943 ATAGTACAACAGTATAGTAAGGG - Intergenic
1120153063 14:81059115-81059137 ATAGTTCAACCTTACAATAAGGG - Intronic
1120179785 14:81331483-81331505 ACAGTTCAATACTACTGGGAGGG + Intronic
1124583765 15:30986455-30986477 ATAGTGCAAAACTAATTTAAAGG + Intronic
1125303771 15:38286674-38286696 ATACTTCATCAATACTGTAAAGG - Intronic
1130025872 15:80270102-80270124 ATAGTTCAGCTGTTCTGTAATGG + Intergenic
1133982109 16:10640656-10640678 ATAGATAAACACTTCTGTCACGG + Intronic
1135883819 16:26285721-26285743 AAAGTTGTACTCTACTGTAATGG - Intergenic
1146123968 17:30217758-30217780 ATAGTTCAAAACTATTCAAATGG - Intronic
1152180097 17:78814227-78814249 CTGGTGCAACACTTCTGTAAAGG + Intronic
1152184634 17:78846805-78846827 AAAGGTCAACATTACTCTAAAGG - Intergenic
1157121899 18:44918856-44918878 ACAGTTCAACAGAACTGTAGGGG + Intronic
1159729351 18:72005610-72005632 TTAGTTCAACTCTGATGTAACGG + Intergenic
1162253734 19:9470058-9470080 AAAGTTCAGAACTACTGGAATGG - Intronic
925900191 2:8503736-8503758 CTCTTTCAACACTACTGTGATGG + Intergenic
927445028 2:23152299-23152321 ATACTTCCACACTTCTATAAAGG - Intergenic
928245548 2:29623779-29623801 ATATTTCAACATTTCTATAATGG + Intronic
931433051 2:62224821-62224843 ATAGTTCAACACTACTGTAATGG - Intergenic
931509720 2:62977716-62977738 ATAGTTCAACTCTAATGTGAAGG + Intronic
933304272 2:80577750-80577772 AGAGCTCAACACCACTGGAATGG - Intronic
934011748 2:87826737-87826759 ATATTTCAACACAACTGGCATGG - Intergenic
935418841 2:102845785-102845807 ATTCTTCAGGACTACTGTAAGGG + Intergenic
935615733 2:105079221-105079243 ATAGTTTACAACTTCTGTAATGG + Intronic
936643979 2:114348055-114348077 ATCTCTCAACACTACTGTACTGG + Intergenic
937996420 2:127697989-127698011 AAAGTCCAACAATACTGGAAGGG + Intergenic
939919722 2:148094554-148094576 ATAGTTAAATACTACTTAAAGGG - Intronic
940687351 2:156869695-156869717 ATAATTTAACATTACTTTAATGG - Intergenic
941769675 2:169331144-169331166 GTAGTTCATCATTAATGTAAAGG + Intronic
942602506 2:177656034-177656056 ATAGTTGAATTCTACTGTAAAGG - Intronic
943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG + Intergenic
944047732 2:195432254-195432276 CTATTTCAAGGCTACTGTAAAGG - Intergenic
946326883 2:218989233-218989255 GGAGTTCAACACCACTGCAAGGG + Intergenic
1176965921 21:15211273-15211295 ATACTTCAACCCTAATGCAATGG - Intergenic
1178696153 21:34794118-34794140 ATAATTTGACACTAATGTAAAGG + Intronic
1180042146 21:45286147-45286169 ATAGTTCAACACTAAGGCAGAGG + Intronic
951114349 3:18842404-18842426 GTAGTTCATAACTACTGTATTGG - Intergenic
955110745 3:55947173-55947195 CTGGTTGAACACTGCTGTAAAGG - Intronic
957188390 3:76973515-76973537 ATAATCAACCACTACTGTAATGG + Intronic
957500367 3:81048941-81048963 ATATTTAAAGACTACTTTAATGG + Intergenic
958450587 3:94267907-94267929 ATAGTGCTACCCTACTGTAAGGG - Intergenic
959679614 3:109079327-109079349 ATAATAAAACACTACTTTAAAGG + Intronic
964763223 3:160153891-160153913 ATAGTGCCACACCACTGTAGAGG + Intergenic
966283464 3:178264330-178264352 ATAGTTCATTAGTACTTTAAAGG + Intergenic
973605503 4:52583214-52583236 TGAGTTCAACACTGCTCTAAAGG + Intergenic
974895381 4:67931844-67931866 ATACTTCAAGACTGCTTTAAAGG + Intronic
975966617 4:79980752-79980774 ATATTTAAACACTATGGTAATGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978067821 4:104427409-104427431 ATAGTTTAAGATTACTGTATAGG - Intergenic
979736120 4:124087069-124087091 AAAGATAAATACTACTGTAATGG + Intergenic
983439260 4:167760426-167760448 ATAGTTAAGAACTAATGTAAAGG + Intergenic
985210648 4:187589429-187589451 ATATTTCAAAACTACAGTCAAGG - Intergenic
988452202 5:31354591-31354613 ATAGTTTAAATCTACTGTAATGG + Intergenic
989069170 5:37492434-37492456 ATAGTTCAAAACTACATTCAAGG - Intronic
991146885 5:63317610-63317632 AATGTTCAACAATAGTGTAAAGG + Intergenic
992124995 5:73630849-73630871 CTTGGTCAACACTACTGGAAAGG + Intronic
993777148 5:92013237-92013259 ACAGTTCCACATTACTGGAAGGG - Intergenic
995291562 5:110462260-110462282 GGAGTTCAAGACTACTGTGATGG + Intronic
995497981 5:112768885-112768907 AGTGTTCTACACTACTGTATAGG - Intronic
996085794 5:119303857-119303879 ATAGCTCCCCACTATTGTAAAGG + Intronic
996577030 5:124986986-124987008 ATAGTTCAACACTATTTAACTGG - Intergenic
1001252522 5:170158122-170158144 ATAGATCAACAGAACTGAAATGG - Intergenic
1011129562 6:84039496-84039518 ATATCTCAACAATACTATAAGGG - Intronic
1011827515 6:91327637-91327659 ATAGCTCAGCACTATTTTAAAGG - Intergenic
1011859634 6:91738492-91738514 ATACTTCAACTGTAATGTAAGGG + Intergenic
1012035991 6:94140291-94140313 ATAGTTCAACTCTGTTCTAAAGG + Intergenic
1015287368 6:131501928-131501950 ACAGTTCCACACTACTGGAGAGG - Intergenic
1021013326 7:15499558-15499580 ATGGATCAACCCCACTGTAAGGG + Intronic
1021462637 7:20905974-20905996 ATGGTTGAACAAGACTGTAAGGG + Intergenic
1027997375 7:85441365-85441387 ATACTTCAACAAAACTATAATGG + Intergenic
1028012692 7:85668389-85668411 ATAGTTCATTACTGCTGCAAAGG - Intergenic
1032687059 7:134245246-134245268 ATACTCAAACACTACTGGAATGG + Intronic
1041503397 8:58564794-58564816 ATAGTTCAATAATACTATTAGGG + Intronic
1042102455 8:65288101-65288123 ATAGTTCCACACTACTGGGGAGG - Intergenic
1042145663 8:65727357-65727379 CTAATTCAAAACTACTGTGATGG - Intronic
1047567143 8:126057702-126057724 GTAGTGCAACACTGATGTAAAGG - Intergenic
1047891056 8:129310880-129310902 TTATTTCAGCACTATTGTAAAGG + Intergenic
1052973702 9:34397242-34397264 ATTCTTCAAAAATACTGTAAAGG - Intronic
1053626840 9:39880934-39880956 ATAGCTGAACACTTCTCTAAAGG + Intergenic
1053779150 9:41585086-41585108 ATAGCTGAACACTTCTCTAAAGG - Intergenic
1054167109 9:61795327-61795349 ATAGCTGAACACTTCTCTAAAGG - Intergenic
1054217047 9:62369769-62369791 ATAGCTGAACACTTCTCTAAAGG - Intergenic
1054670438 9:67785571-67785593 ATAGCTGAACACTTCTCTAAAGG + Intergenic
1058285420 9:103170703-103170725 ATTGTGGAACACTACTTTAAGGG - Intergenic
1062368498 9:136223959-136223981 ACAGTTCAACACGAGTCTAACGG + Intronic
1189069903 X:37852287-37852309 ATATTTAAAGACTTCTGTAATGG + Intronic
1189576244 X:42356775-42356797 ATTGTTCAACACTTATGAAATGG + Intergenic
1192537152 X:71938029-71938051 ATGGTTCCACCCAACTGTAATGG + Intergenic
1193936261 X:87625972-87625994 AGAGTTCAACACTAATTGAAAGG - Intronic
1195856933 X:109341869-109341891 AAAGTTCAACATTATTGTCAAGG + Intergenic
1195859489 X:109367905-109367927 AAAGTACAACACTATTTTAATGG - Intergenic
1199132736 X:144211810-144211832 ATATTTCAACACAACTGGCATGG + Intergenic