ID: 931433175

View in Genome Browser
Species Human (GRCh38)
Location 2:62225958-62225980
Sequence AATTAGGCCTCAAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931433175 Original CRISPR AATTAGGCCTCAAGGGAAAC TGG Intergenic
900267596 1:1766625-1766647 TATTAAGCCTCAAAGAAAACTGG + Intronic
900776926 1:4592617-4592639 AACTAGGCCTCCAGGGAAAGAGG + Intergenic
903882315 1:26519607-26519629 AAAAAGGCCTCAAGAGAAACAGG + Intergenic
903920953 1:26800317-26800339 TGTTAGGCCTCAGGGTAAACAGG - Intergenic
905071545 1:35230162-35230184 AAGTATGCAGCAAGGGAAACAGG + Intergenic
907409838 1:54276081-54276103 AATGAGGACTCAACGGAAAGGGG + Intronic
908364904 1:63411310-63411332 AAAAAGGCCTCAAAGGAAAGGGG + Exonic
908784297 1:67719897-67719919 AATGAGGCCTCAATTAAAACTGG + Intronic
910253739 1:85225341-85225363 AATGAAGCCTCAAGAGCAACTGG + Intergenic
910310353 1:85816796-85816818 AATTGGGCCACCAGGAAAACAGG - Exonic
912466772 1:109880005-109880027 AAGTAGGCCTCATAGGAAAGGGG + Intergenic
914406972 1:147385154-147385176 AAGTTGGCTTGAAGGGAAACAGG - Intergenic
915988885 1:160493146-160493168 AATGAGGCCAGAAAGGAAACAGG - Intronic
917262190 1:173182263-173182285 AATTGGGCCAAAAGGGAAAACGG + Intergenic
922113074 1:222581684-222581706 AAGTAGGCCTCAATGAAAAGGGG + Intronic
922590173 1:226769727-226769749 AATTAGACCCCAAGGGACACAGG + Intergenic
922868577 1:228881831-228881853 AATTAGGGCTGAAGGGCAGCAGG + Intergenic
1068565380 10:58568870-58568892 AATTTGGCCTCAAAGCCAACTGG + Intronic
1074085155 10:110204196-110204218 AATTAGGACTCAAGTGACAAGGG + Intergenic
1077110775 11:861084-861106 AGCAAGGCCTCAAGGGAAGCAGG - Intronic
1077652487 11:3985769-3985791 AGTTAGGTCTGAAGGGAAGCAGG - Intronic
1078177780 11:8983273-8983295 AAATAGGCCACAAGTGAGACTGG + Exonic
1079367945 11:19825654-19825676 AATTAGCCCTCAAATGAAGCCGG - Intronic
1079656881 11:22995821-22995843 AAGAAAGCCTCAAGGGAAAACGG - Intergenic
1081958885 11:47118894-47118916 AATTAGGCTTCATGGGAGTCAGG + Intronic
1082841058 11:57690248-57690270 AATGAGGGCTAAAGGGAAAATGG + Intronic
1083115948 11:60459907-60459929 AATTAGGCATCCAGGGTACCAGG - Intronic
1087238685 11:95750974-95750996 ATTTAGCCCTCCAAGGAAACTGG - Intergenic
1087577869 11:100012135-100012157 ATTTAGGCCTCACAGGAAAGTGG + Intronic
1090002368 11:122972895-122972917 AAATAGGCTTCAATGAAAACAGG + Intergenic
1091332770 11:134743670-134743692 AATCAGATCTCAAGGGAATCAGG - Intergenic
1093112970 12:15174970-15174992 AAATAGGAGTCAATGGAAACTGG - Intronic
1097264805 12:57738672-57738694 AATTGGGACTCAAGGGACAGGGG + Intronic
1099210758 12:79785135-79785157 ATTTAGGCTTCATGGTAAACTGG - Intronic
1099642253 12:85306027-85306049 AATTTTACCTCAAGGTAAACAGG - Intergenic
1103927057 12:124429063-124429085 AAAGAGGCCTGAGGGGAAACCGG + Intronic
1105676817 13:22680752-22680774 CATTAGGCCTCAGGGATAACTGG - Intergenic
1106304755 13:28499531-28499553 AATAAGGCCTAAAGGAAAAGTGG + Intergenic
1107292500 13:38871646-38871668 AATTAAGACTCAAAGGAAAAAGG - Intronic
1107713994 13:43180533-43180555 AATTAGGGCACAAGAGCAACAGG + Intergenic
1108284680 13:48895044-48895066 AATGAGAGCTCAATGGAAACTGG - Intergenic
1109709590 13:66144429-66144451 AGTTAGGAGGCAAGGGAAACAGG + Intergenic
1109894307 13:68664123-68664145 AATTAGGCCCAAAGGGACATTGG - Intergenic
1116206496 14:41874205-41874227 AATTAGGCTTCAATGGTCACAGG - Intronic
1118271467 14:64346806-64346828 AATTATGCCTTAAGCCAAACAGG - Intergenic
1125789545 15:42353368-42353390 AGTTAGGCTTCATGGGAAAGTGG - Exonic
1130171033 15:81514231-81514253 AATTAGGCAGCAAGGAAAATAGG + Intergenic
1135956130 16:26958050-26958072 AATCAGGCCTCAGAAGAAACAGG + Intergenic
1138545065 16:57713697-57713719 AAAAAGGGCCCAAGGGAAACTGG - Intronic
1139674312 16:68512454-68512476 GATTAGACCCCAAGGGAACCAGG - Intergenic
1140062983 16:71587598-71587620 AATGAAGCCTCAAGGGACAAGGG - Intergenic
1141886422 16:86895432-86895454 AATGATGCCCCAAGGGAAAAAGG - Intergenic
1143472926 17:7187141-7187163 AATAATGCCTGGAGGGAAACAGG + Intergenic
1145804156 17:27714535-27714557 AATTAAACCTCAAGGGAGTCAGG - Intergenic
1146558390 17:33847246-33847268 AACTAAGGCTCAAGGAAAACAGG - Intronic
1156187002 18:34675070-34675092 AATTAGGACTCAAAGGAACTCGG + Intronic
1156834476 18:41536116-41536138 AATTAGGACCCAAAGAAAACAGG + Intergenic
1158491006 18:57909729-57909751 AATGACGCCTCCAGGGAAACTGG - Intergenic
1158640230 18:59197243-59197265 AATAAGGCCTAAAGTGCAACAGG + Intergenic
1159874392 18:73793946-73793968 AATTAGGCCACAGGGGATCCTGG + Intergenic
1161758445 19:6152225-6152247 AACTCGGCCTCCAGGGTAACTGG + Intronic
1163079345 19:14925781-14925803 AATGAGACCTCAAGGAAGACAGG - Intergenic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1165046331 19:33107997-33108019 AATTAGGCCTCCCGGGGAAGCGG - Intronic
1165260542 19:34612909-34612931 AATAAGGGCTCAAGTGATACGGG - Intronic
1167802544 19:51754106-51754128 AAAGAGGGCTCATGGGAAACAGG - Intronic
1168505645 19:56932453-56932475 AAGTTGGTCTCAAGTGAAACAGG + Intergenic
1168672080 19:58248203-58248225 AATGATGCCTCAAGGGCAAGGGG - Intronic
925707128 2:6696957-6696979 AATATGGCCTTAATGGAAACTGG + Intergenic
927665182 2:25027002-25027024 AATAAGGCCTATAGGTAAACAGG + Intergenic
928756197 2:34528653-34528675 AATTAGACATCAAAGGAAACAGG + Intergenic
929657440 2:43748343-43748365 AGTTTGCCCTCAAGGGAAACAGG - Intronic
929951685 2:46415016-46415038 AAATAGTCATGAAGGGAAACAGG + Intergenic
930025354 2:47026082-47026104 AATGAGGTCTCCAAGGAAACTGG - Intronic
931212833 2:60213972-60213994 GATTAACCCCCAAGGGAAACTGG - Intergenic
931433175 2:62225958-62225980 AATTAGGCCTCAAGGGAAACTGG + Intergenic
931646490 2:64426411-64426433 ACTAAGGCCTCCAGGGAAAAGGG - Intergenic
935152507 2:100450478-100450500 AAGAAGGGCCCAAGGGAAACAGG - Intergenic
939281979 2:140075483-140075505 AATTAGGCAACAGGGGAAAAGGG - Intergenic
944229140 2:197375958-197375980 AAATAGTCCTCAAAGGAGACAGG - Intergenic
946926120 2:224628621-224628643 CATTTTGCCTCTAGGGAAACAGG + Intergenic
947363091 2:229365796-229365818 GATTGGGGCTCAAGGGAAATGGG - Intronic
947966790 2:234288959-234288981 AATTAGGGCACAGGTGAAACAGG - Intergenic
1170580822 20:17698294-17698316 AATTATGTCTGAAGGTAAACAGG - Intronic
1171575713 20:26312788-26312810 ATTGAGGCCTAAAGTGAAACAGG + Intergenic
1174062221 20:47840746-47840768 GCTCAGACCTCAAGGGAAACAGG + Intergenic
1174150661 20:48483954-48483976 GCTCAGACCTCAAGGGAAACAGG + Intergenic
1174545536 20:51322438-51322460 CATAAGGCCTCATGGGAATCTGG - Intergenic
1177717737 21:24861681-24861703 AATTTTGCCTCAAGGGATATAGG + Intergenic
1180244621 21:46538896-46538918 GATGAGGCCTAAAGAGAAACAGG - Intronic
1181962455 22:26632552-26632574 ACTTAGTCTTCAAGTGAAACAGG - Intergenic
1182008985 22:26984663-26984685 AATCAGGTCTCAAGGAAAAACGG + Intergenic
1182833739 22:33324566-33324588 AATTTGGACCCAAGGGAAAATGG + Intronic
1183585242 22:38749642-38749664 AATAAAGGCTCCAGGGAAACTGG + Intronic
1183679276 22:39317711-39317733 ATTTAGGCCGGAAGGGCAACTGG + Intronic
950423835 3:12914251-12914273 CATTGGGCCTCAAGGGCAGCTGG - Intronic
952734698 3:36677336-36677358 AATTAGGAATAAAGTGAAACAGG - Intergenic
953621994 3:44541548-44541570 AATTAGGATGAAAGGGAAACAGG + Intergenic
953879612 3:46684834-46684856 AATCAGGCTTCAGGGGACACAGG + Intronic
956308064 3:67848488-67848510 AATTTGGCCTCAAGATAAAGAGG - Intergenic
956459431 3:69455977-69455999 AATTAAGCCTCAAAGCAAAATGG - Intronic
957814099 3:85269744-85269766 GATTCGGCCTCAAAAGAAACAGG - Intronic
959655331 3:108797962-108797984 AAAAAGGCATCAGGGGAAACCGG + Intergenic
959702066 3:109308046-109308068 AAAAAGGCCTCAACAGAAACAGG + Exonic
961602648 3:128073196-128073218 AATGAGGAGTCTAGGGAAACAGG + Intronic
966121588 3:176527840-176527862 AATGAGACCCCAAGGGAAAAGGG - Intergenic
967952503 3:194852083-194852105 ACTTAGGCCTCAAGGAACATGGG - Intergenic
973971465 4:56217757-56217779 ATTCAGGCCTCGAGGGAAAGTGG - Intronic
974216582 4:58855123-58855145 AATTAGGCTTCAGGGGAATAAGG - Intergenic
974409684 4:61523597-61523619 TAATAGGCCTCTAGGGAAATAGG + Intronic
980861926 4:138509290-138509312 AATTGGGCTTCAAAAGAAACAGG + Intergenic
982968823 4:161952289-161952311 AAATATGCCTCAAGGGAACTAGG + Intronic
983865810 4:172765058-172765080 AATCAGTACTCAAGGGAACCAGG - Intronic
984017062 4:174439370-174439392 CAGTAGGCGTCAAGGAAAACAGG + Intergenic
984374423 4:178909408-178909430 AATAAGTCCTCAAGGGACAGAGG - Intergenic
986742430 5:10715681-10715703 ACTAAGGTCTCAAGGAAAACAGG + Intronic
987303834 5:16619252-16619274 AATTAGAATTCAAGGGAAGCAGG - Intergenic
988718269 5:33850313-33850335 AATCAGACCTCAGGGGAAGCTGG + Intronic
988800989 5:34696571-34696593 AGTTAAGCCTCAAGGGAAAGGGG + Intronic
988962941 5:36387698-36387720 AAATAGGCCTCATGGGTAGCAGG - Intergenic
989084728 5:37663830-37663852 AATTAGGGCTCAAAGGAAGCAGG - Intronic
991390703 5:66140578-66140600 AATCAAGCCCCAAGGAAAACTGG - Intronic
991445972 5:66700109-66700131 TATTATGCCTCAAGGGAGAAGGG - Intronic
998481987 5:142470321-142470343 CATGAGGCCCCAAGGGAAAGGGG - Intergenic
999546379 5:152633107-152633129 AATTTTGCCTCCAAGGAAACTGG + Intergenic
999675070 5:153991352-153991374 ACTTTGCCCTCAAGGGATACAGG + Exonic
1004333794 6:14745420-14745442 ACTCAGACCTCAAGGGAAACAGG - Intergenic
1007020850 6:38519756-38519778 AGCTAGGCCTCAAGGGTAGCTGG - Intronic
1008271897 6:49499920-49499942 AATTAGCCCTTAGTGGAAACAGG - Intergenic
1011165332 6:84440052-84440074 AATTTGGTCTCAAGGACAACTGG - Intergenic
1013788070 6:113805403-113805425 ATTTAAACCTCAAGCGAAACAGG - Intergenic
1015702441 6:136051256-136051278 TATTTGGCCTCACAGGAAACAGG + Intronic
1016702157 6:147066095-147066117 AATTAGGCTTCACAGAAAACAGG - Intergenic
1022424205 7:30252767-30252789 AATTAGCTCTCAGGGGCAACTGG - Intergenic
1023967752 7:44971839-44971861 AATCAAGCCTCAAGGGAGACAGG - Intronic
1024404322 7:48961180-48961202 AATTAGGCTTCTAGGGAATTGGG - Intergenic
1025232218 7:57210418-57210440 GCTCAGACCTCAAGGGAAACAGG - Intergenic
1025575189 7:62629649-62629671 AATGAGGCCTCATGTGAAAAAGG - Intergenic
1029501093 7:100930360-100930382 ATTTAGGCTTCAAGGCAACCAGG - Intergenic
1033781227 7:144671689-144671711 ATTTAGGAATCAAGGGAAGCTGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1044344868 8:91093548-91093570 ACTTATGCCTCAAGGAAAGCAGG + Intergenic
1050303728 9:4285674-4285696 AATTCAGCCCCCAGGGAAACAGG + Intronic
1050827330 9:9964526-9964548 AATTATGACTCAGTGGAAACGGG + Intronic
1052351965 9:27467255-27467277 ATTTAGCCCACAAGGGTAACTGG - Intronic
1052981722 9:34454973-34454995 CATTAAGCCTCAAGGGAGCCAGG - Intronic
1059488232 9:114643999-114644021 AATAAGTCCTCAAGTCAAACAGG - Exonic
1059634447 9:116157557-116157579 CATTCGGCCAAAAGGGAAACTGG - Intronic
1059776262 9:117478277-117478299 AATAAAGCCAGAAGGGAAACAGG + Intergenic
1060673968 9:125495592-125495614 AATTAGTATTCAAGGGAAATTGG - Intronic
1185856591 X:3542038-3542060 AAGAAGACCTCAAGGGAGACGGG + Intergenic
1186598995 X:11015954-11015976 AATTAGGCAACAAGAGAAAGAGG + Intergenic
1186686602 X:11931216-11931238 AAATAAGCCTCAATGGAATCTGG - Intergenic
1187885853 X:23887984-23888006 AATTTGGCTTAAAGGTAAACTGG + Intronic
1189486734 X:41439040-41439062 AATTAAACCTAAAAGGAAACAGG + Intergenic
1189689318 X:43599413-43599435 AATTAGGAGTTAAGGGAAGCTGG + Intergenic
1194840824 X:98739089-98739111 AATTAGGAGTCAAGAGAAAAAGG - Intergenic
1197183667 X:123563171-123563193 AATTAGGGCTCAAGGGTCAATGG - Intergenic
1200694966 Y:6350706-6350728 AATTGACCCTCAAGGGAATCAGG + Intergenic
1201040311 Y:9824004-9824026 AATTGACCCTCAAGGGAATCAGG - Intergenic
1201604022 Y:15765265-15765287 AATTAAGACTCAAGGGAGGCTGG - Intergenic