ID: 931435296

View in Genome Browser
Species Human (GRCh38)
Location 2:62240684-62240706
Sequence GCTTTAGGGTCCACACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931435293_931435296 14 Left 931435293 2:62240647-62240669 CCATCTAAATAAATAAATAAGCA No data
Right 931435296 2:62240684-62240706 GCTTTAGGGTCCACACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931435296 Original CRISPR GCTTTAGGGTCCACACAGCC TGG Intergenic