ID: 931438651

View in Genome Browser
Species Human (GRCh38)
Location 2:62271119-62271141
Sequence CAGCTAGGATACATTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931438643_931438651 16 Left 931438643 2:62271080-62271102 CCCTGTTTTGTCTTTTGTAACTA No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438641_931438651 18 Left 931438641 2:62271078-62271100 CCCCCTGTTTTGTCTTTTGTAAC No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438646_931438651 -7 Left 931438646 2:62271103-62271125 CCCTAAGGCTGATATTCAGCTAG No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438642_931438651 17 Left 931438642 2:62271079-62271101 CCCCTGTTTTGTCTTTTGTAACT No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438640_931438651 19 Left 931438640 2:62271077-62271099 CCCCCCTGTTTTGTCTTTTGTAA No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438644_931438651 15 Left 931438644 2:62271081-62271103 CCTGTTTTGTCTTTTGTAACTAC No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data
931438647_931438651 -8 Left 931438647 2:62271104-62271126 CCTAAGGCTGATATTCAGCTAGG No data
Right 931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931438651 Original CRISPR CAGCTAGGATACATTGGCAT GGG Intergenic
No off target data available for this crispr