ID: 931442583

View in Genome Browser
Species Human (GRCh38)
Location 2:62301190-62301212
Sequence GACCCACAGGGGACTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931442583_931442589 3 Left 931442583 2:62301190-62301212 CCAGTCTGAGTCCCCTGTGGGTC No data
Right 931442589 2:62301216-62301238 CGGCTTTAGCTCCCATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931442583 Original CRISPR GACCCACAGGGGACTCAGAC TGG (reversed) Intergenic
No off target data available for this crispr