ID: 931444317

View in Genome Browser
Species Human (GRCh38)
Location 2:62314072-62314094
Sequence CTGAGGTTTCACCAGGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931444312_931444317 -10 Left 931444312 2:62314059-62314081 CCACACCCACACACTGAGGTTTC No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444308_931444317 -1 Left 931444308 2:62314050-62314072 CCCCTGCAACCACACCCACACAC No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444305_931444317 29 Left 931444305 2:62314020-62314042 CCTGAGTATTGTGACCACAGAGA No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444307_931444317 3 Left 931444307 2:62314046-62314068 CCTGCCCCTGCAACCACACCCAC No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444304_931444317 30 Left 931444304 2:62314019-62314041 CCCTGAGTATTGTGACCACAGAG No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444306_931444317 15 Left 931444306 2:62314034-62314056 CCACAGAGATAGCCTGCCCCTGC No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444309_931444317 -2 Left 931444309 2:62314051-62314073 CCCTGCAACCACACCCACACACT No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data
931444310_931444317 -3 Left 931444310 2:62314052-62314074 CCTGCAACCACACCCACACACTG No data
Right 931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931444317 Original CRISPR CTGAGGTTTCACCAGGGTGT AGG Intergenic