ID: 931448586

View in Genome Browser
Species Human (GRCh38)
Location 2:62348235-62348257
Sequence CTTTATGTCCAGTTTTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931448586_931448590 -1 Left 931448586 2:62348235-62348257 CCATGTAAAAACTGGACATAAAG No data
Right 931448590 2:62348257-62348279 GAAATTATCTGGGCCAGGTGTGG No data
931448586_931448593 30 Left 931448586 2:62348235-62348257 CCATGTAAAAACTGGACATAAAG No data
Right 931448593 2:62348288-62348310 ACCTATAATCCAAGCAGTTTAGG No data
931448586_931448591 2 Left 931448586 2:62348235-62348257 CCATGTAAAAACTGGACATAAAG No data
Right 931448591 2:62348260-62348282 ATTATCTGGGCCAGGTGTGGTGG No data
931448586_931448589 -6 Left 931448586 2:62348235-62348257 CCATGTAAAAACTGGACATAAAG No data
Right 931448589 2:62348252-62348274 ATAAAGAAATTATCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931448586 Original CRISPR CTTTATGTCCAGTTTTTACA TGG (reversed) Intergenic
No off target data available for this crispr