ID: 931453635

View in Genome Browser
Species Human (GRCh38)
Location 2:62389404-62389426
Sequence CTGGAGATGCAGATCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931453635_931453640 10 Left 931453635 2:62389404-62389426 CCTGGGCTGATCTGCATCTCCAG No data
Right 931453640 2:62389437-62389459 ATCCTCCTGCCTGGAATTACAGG No data
931453635_931453639 1 Left 931453635 2:62389404-62389426 CCTGGGCTGATCTGCATCTCCAG No data
Right 931453639 2:62389428-62389450 GCTCAAGCAATCCTCCTGCCTGG 0: 41
1: 188
2: 618
3: 1158
4: 2097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931453635 Original CRISPR CTGGAGATGCAGATCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr