ID: 931458575

View in Genome Browser
Species Human (GRCh38)
Location 2:62431681-62431703
Sequence CCGAGGAAAGCTGAGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931458572_931458575 -2 Left 931458572 2:62431660-62431682 CCGTAGACTTGAGGGTGCACTCC No data
Right 931458575 2:62431681-62431703 CCGAGGAAAGCTGAGTGATGAGG No data
931458569_931458575 22 Left 931458569 2:62431636-62431658 CCAGTAGGTTTCTGGAAGCAGGT No data
Right 931458575 2:62431681-62431703 CCGAGGAAAGCTGAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931458575 Original CRISPR CCGAGGAAAGCTGAGTGATG AGG Intergenic
No off target data available for this crispr