ID: 931460200

View in Genome Browser
Species Human (GRCh38)
Location 2:62443644-62443666
Sequence AGCTTGGATCGCAGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931460200_931460202 -5 Left 931460200 2:62443644-62443666 CCTTGGGAGCTGCGATCCAAGCT No data
Right 931460202 2:62443662-62443684 AAGCTTTCTGCAGACTGACATGG No data
931460200_931460205 28 Left 931460200 2:62443644-62443666 CCTTGGGAGCTGCGATCCAAGCT No data
Right 931460205 2:62443695-62443717 GCAGAGCTCAGTGGCTTCTCTGG No data
931460200_931460203 19 Left 931460200 2:62443644-62443666 CCTTGGGAGCTGCGATCCAAGCT No data
Right 931460203 2:62443686-62443708 GTGCCTTCTGCAGAGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931460200 Original CRISPR AGCTTGGATCGCAGCTCCCA AGG (reversed) Intergenic