ID: 931465851

View in Genome Browser
Species Human (GRCh38)
Location 2:62486231-62486253
Sequence CATTCTAATGATAAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931465841_931465851 21 Left 931465841 2:62486187-62486209 CCTGTAAATCTGCAGGAATAGGG No data
Right 931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG No data
931465847_931465851 -4 Left 931465847 2:62486212-62486234 CCCTCCAGGGCAGGATTTTCATT No data
Right 931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG No data
931465848_931465851 -5 Left 931465848 2:62486213-62486235 CCTCCAGGGCAGGATTTTCATTC No data
Right 931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG No data
931465849_931465851 -8 Left 931465849 2:62486216-62486238 CCAGGGCAGGATTTTCATTCTAA No data
Right 931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931465851 Original CRISPR CATTCTAATGATAAGGCTGC TGG Intergenic
No off target data available for this crispr