ID: 931472911

View in Genome Browser
Species Human (GRCh38)
Location 2:62557345-62557367
Sequence TATGAGGCCCAGGAACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931472906_931472911 -7 Left 931472906 2:62557329-62557351 CCAGGACAGGGCTGCCTATGAGG No data
Right 931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG No data
931472899_931472911 16 Left 931472899 2:62557306-62557328 CCCACTTCAAGGTGTTTGTGACC No data
Right 931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG No data
931472904_931472911 -5 Left 931472904 2:62557327-62557349 CCCCAGGACAGGGCTGCCTATGA No data
Right 931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG No data
931472900_931472911 15 Left 931472900 2:62557307-62557329 CCACTTCAAGGTGTTTGTGACCC No data
Right 931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG No data
931472905_931472911 -6 Left 931472905 2:62557328-62557350 CCCAGGACAGGGCTGCCTATGAG No data
Right 931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931472911 Original CRISPR TATGAGGCCCAGGAACATCT GGG Intergenic
No off target data available for this crispr