ID: 931483873

View in Genome Browser
Species Human (GRCh38)
Location 2:62670968-62670990
Sequence CTCTCTTCACCTATTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931483868_931483873 21 Left 931483868 2:62670924-62670946 CCTGCTCACAACTTTAGCTAGTA No data
Right 931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG No data
931483871_931483873 -9 Left 931483871 2:62670954-62670976 CCCTAGTGTTCTGTCTCTCTTCA No data
Right 931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG No data
931483872_931483873 -10 Left 931483872 2:62670955-62670977 CCTAGTGTTCTGTCTCTCTTCAC No data
Right 931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG No data
931483866_931483873 27 Left 931483866 2:62670918-62670940 CCTGACCCTGCTCACAACTTTAG No data
Right 931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG No data
931483867_931483873 22 Left 931483867 2:62670923-62670945 CCCTGCTCACAACTTTAGCTAGT No data
Right 931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931483873 Original CRISPR CTCTCTTCACCTATTCAGCC TGG Intergenic
No off target data available for this crispr