ID: 931484516

View in Genome Browser
Species Human (GRCh38)
Location 2:62676714-62676736
Sequence TTTTTTTAAAGGGCCTTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931484509_931484516 25 Left 931484509 2:62676666-62676688 CCAAGCCATTGTTTTGCTGGAAA 0: 1
1: 0
2: 0
3: 21
4: 237
Right 931484516 2:62676714-62676736 TTTTTTTAAAGGGCCTTCGCCGG 0: 1
1: 0
2: 1
3: 18
4: 144
931484510_931484516 20 Left 931484510 2:62676671-62676693 CCATTGTTTTGCTGGAAAAGCAG 0: 1
1: 0
2: 2
3: 23
4: 272
Right 931484516 2:62676714-62676736 TTTTTTTAAAGGGCCTTCGCCGG 0: 1
1: 0
2: 1
3: 18
4: 144
931484512_931484516 -10 Left 931484512 2:62676701-62676723 CCATATTCCTTTTTTTTTTTAAA 0: 1
1: 6
2: 106
3: 1249
4: 8515
Right 931484516 2:62676714-62676736 TTTTTTTAAAGGGCCTTCGCCGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931484516 Original CRISPR TTTTTTTAAAGGGCCTTCGC CGG Intronic
900695787 1:4009525-4009547 TTTTTTACAAAGGCCTCCGCAGG - Intergenic
901566250 1:10118257-10118279 TATTTGTAAAGGGCCTTCTTTGG + Intronic
904479925 1:30787292-30787314 TTTTTTAAAATGCCCTTGGCTGG - Intergenic
905169950 1:36103895-36103917 TTTTTTTAAAGTGAGTTAGCTGG + Intronic
906679834 1:47718723-47718745 TTTTTTTAAAGGCCCTTAGAGGG - Intergenic
908803957 1:67910307-67910329 CTTTTTTAAAGAGACTACGCTGG - Intergenic
909804422 1:79857391-79857413 TTTTTTTAAAAAGCCATAGCTGG + Intergenic
912912083 1:113772408-113772430 TTTTTTAAAAAGGCTTTGGCAGG - Intronic
915129164 1:153685308-153685330 TTTTTTTAAAGTGTTTTCACAGG - Intronic
919256599 1:195133208-195133230 TTTTTGTTCAGGGCCTCCGCAGG + Intergenic
921888505 1:220330214-220330236 TTTTTTTAAATGGCTTTCCTTGG - Intergenic
923388330 1:233488316-233488338 TTTTTTCAAAGGGCTTTTGCTGG - Intergenic
1075204130 10:120432097-120432119 CTTTTTTTAAGGGCTTTCTCTGG + Intergenic
1078466430 11:11553623-11553645 TTTCCATAAAGGGCCTTCCCAGG - Intronic
1079991226 11:27249009-27249031 ATTTTTTACAGAGCCTTCCCTGG + Intergenic
1080685276 11:34510211-34510233 TTTTTGTAAAGGGCCTTCTCAGG + Intronic
1083489581 11:63006105-63006127 TTTCTTAAAAGGGCCTTCTTAGG - Intronic
1083850594 11:65364182-65364204 TTTGTTTAAAGGGCCTTAAGAGG - Intergenic
1085291570 11:75404009-75404031 TTCTTTTAAAGGGCCTGCTATGG + Exonic
1089465541 11:118683033-118683055 TTTTTTTAAAGAACATTGGCTGG - Intergenic
1091898947 12:4127878-4127900 TTTTTTTAAAGTGAATTCCCTGG + Intergenic
1092000938 12:5031777-5031799 TTTCTTTGAAGAGCCTTTGCAGG + Intergenic
1095295587 12:40523715-40523737 TTTTTTTAAATGCCCTACACAGG - Intronic
1097858591 12:64493754-64493776 TTATTAAAAAGGGCCTTTGCTGG - Intronic
1099211155 12:79790082-79790104 TTTTTTAAAAGTGTCTTCACTGG + Intronic
1099662912 12:85588382-85588404 TTTTTTTAAAGACCATTCTCAGG - Intergenic
1100566049 12:95795084-95795106 TGTTTTTAAAGGGCATTCAAAGG - Intergenic
1105211993 13:18262347-18262369 TTTTTTAAGAGGGGCTTAGCAGG + Intergenic
1106232385 13:27830686-27830708 GTTTTTTAAAGAACCTCCGCCGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107706406 13:43111005-43111027 TATTTTTAAAAGGCCTTCCTAGG - Exonic
1108092561 13:46864458-46864480 ATATTTTAAAAGGCCCTCGCAGG + Intronic
1109956755 13:69578931-69578953 TTTTTTTAAAGATCTTTCTCTGG - Intergenic
1110676741 13:78256835-78256857 TTTTTTTGGAGAGCCTTTGCTGG - Intergenic
1111009072 13:82288142-82288164 TTTTTTTAAATTGCCTTTGCTGG + Intergenic
1111071076 13:83168649-83168671 TTTTTTTAAAAGTCCTTCTTAGG - Intergenic
1112751711 13:102589971-102589993 TTTTTTTAAAATGCCTTCCCAGG - Intergenic
1113331318 13:109330685-109330707 TTTTTTTAAATTGCCTTGGCTGG + Intergenic
1116013395 14:39377766-39377788 TTTTTTTAAATTGGCTTTGCTGG + Intronic
1116951349 14:50881574-50881596 TTTTTTTAAACTTCCTTCACAGG + Exonic
1117220477 14:53599603-53599625 TTGTTTTAAAGGGCACTCGATGG - Intergenic
1120414205 14:84198851-84198873 TTCTATTAAATGGCCTTCTCCGG + Intergenic
1120860186 14:89248028-89248050 ATTCTTCAAAGGGCCTTCCCTGG + Intronic
1127667380 15:61161805-61161827 TGTTTTTAAGTGGCCTTCACGGG - Intronic
1127990963 15:64116831-64116853 TATTTTTAAAGTCCCTTCTCTGG + Intronic
1128617297 15:69120308-69120330 GTTTTTCAAAGGGCTTTCACAGG - Intergenic
1132109572 15:99092669-99092691 TTTCTGTAATGGGCCTCCGCTGG - Intergenic
1135196011 16:20395339-20395361 TTTTTTTAAAGGGACATAGGTGG + Intronic
1136128088 16:28199853-28199875 ATTTTTTAAAAGGCCTTCCCTGG + Intronic
1138247827 16:55480218-55480240 TTTGTTTAAAGGTCCCTCTCCGG - Intronic
1138659691 16:58509757-58509779 TTGTTTCAAAAGGCCTTCTCAGG - Intronic
1157671720 18:49535467-49535489 TTTTTTTAAATTGACTTTGCTGG - Intergenic
1157878165 18:51293265-51293287 TTTATTTCAAGTGCCTTCGGTGG + Intergenic
1161409575 19:4109412-4109434 TGTTTTTAAATGGCCTTCTCAGG - Intronic
1168328163 19:55549137-55549159 TTTTTTTTAAATGCCTTGGCTGG + Intergenic
925658813 2:6180893-6180915 TTTTTTTCAAGGGCCATCCAAGG + Intergenic
926872385 2:17436737-17436759 TTTTTGTACAGGGCCTTTGGTGG - Intergenic
928744661 2:34397141-34397163 TTTTTTTAAAGGGCCATGACTGG + Intergenic
929345002 2:40871130-40871152 TATATTTAAAGGGGCTTCCCTGG + Intergenic
931484516 2:62676714-62676736 TTTTTTTAAAGGGCCTTCGCCGG + Intronic
931946092 2:67309151-67309173 TTTTTTTAATGGCACTTAGCAGG + Intergenic
932466327 2:71926566-71926588 TTTTTTAAAAGGCCCCTCTCTGG - Intergenic
933838902 2:86269655-86269677 TATTTTTAAATGTCCTTTGCTGG - Intronic
936400697 2:112162327-112162349 TTTTTTTTAAGGGAATTTGCTGG + Intronic
936953523 2:118002054-118002076 TTTTTTTAAAGGGTCTTGTGTGG - Intronic
937077409 2:119117328-119117350 TCTTTTTAAAGTTCCTTCCCAGG + Intergenic
937732057 2:125244950-125244972 TTTTTTTAAAAGGGCTTCACAGG - Intergenic
939925655 2:148171162-148171184 TTTTTTTAAATGTCCTTGTCTGG - Intronic
941986074 2:171513125-171513147 ATTTTTTAAAGGACGTTCACTGG - Intergenic
944993687 2:205269530-205269552 TTTTTTTAAAGTTCCTTCAGGGG + Intronic
1170695550 20:18654783-18654805 TTTTTTTAATGAGCTTTCTCAGG - Intronic
1174357254 20:50006680-50006702 TTTTTCTAAAAAGCCTTTGCTGG - Intergenic
1174622766 20:51888899-51888921 TTTTTTTAAAGTCCATTCACTGG - Intergenic
1177819610 21:26016864-26016886 TTTTTTTAATTGGCCTGGGCTGG - Intronic
1179501674 21:41813122-41813144 TTTGTTTAAAGGGCATTCATAGG - Intronic
1181973273 22:26709908-26709930 GTTTTTTAAAGGGCCCACCCAGG - Intergenic
1182411217 22:30188512-30188534 CTTTTTCAAAGGGCCCTCTCTGG + Intergenic
1183541543 22:38431958-38431980 TTTTTTTAAAGGGCCCTGCTGGG + Intronic
949464093 3:4326276-4326298 TTTTTTTAAATTGGCTTTGCTGG + Intronic
950455531 3:13090696-13090718 TTGATTTAAAGGGACTTTGCTGG + Intergenic
950746354 3:15092919-15092941 TATTTTTAATTGGCCTTCTCTGG - Intronic
953280094 3:41546753-41546775 TTTTTTTTAAGGGCCTAGGGAGG - Intronic
953528596 3:43716699-43716721 TTTTTTTTAGGGGTCTTCCCCGG + Intronic
957494035 3:80967391-80967413 TTTTTTTAATGGGCCTCAGTTGG + Intergenic
960396849 3:117147807-117147829 ATTCTTTAAAGTGCCTTAGCAGG - Intergenic
963358783 3:144244138-144244160 TTTTTTTAAAAAGCCTTACCAGG + Intergenic
964141817 3:153410942-153410964 TTTTTTGGAAGGGCTTTAGCTGG + Intergenic
967683934 3:192398049-192398071 TTTTTTTAAAGGGGGTTTGAAGG - Intronic
968142018 3:196266037-196266059 TTTTTTTAATGGGCACTTGCAGG - Intronic
968229183 3:196994536-196994558 TTTTTTTAAAAGGCCTCACCCGG - Intronic
968720551 4:2199939-2199961 TTTTTTTAAAGGCATTTTGCTGG - Intronic
973016161 4:45140866-45140888 TTTTTATAAAGAGCCTTGACTGG - Intergenic
976920657 4:90438995-90439017 TTTTTTTAAAAAGCCTTGGCTGG + Intronic
976945871 4:90767150-90767172 TTTTTTTAAATGTCCTTCTATGG - Intronic
981013595 4:139951174-139951196 TCTTTGTAAAGGGCCTGTGCTGG + Intronic
981982786 4:150815264-150815286 TTTTTTTAAAGGACTTTGGATGG + Intronic
982719287 4:158842788-158842810 TTTTATTAAAGGGCCTTTATAGG + Intronic
984574508 4:181432108-181432130 TTTTTTTAATTGGTCTTCTCCGG + Intergenic
985182163 4:187276771-187276793 TATTTTTAAAGAGCATTGGCAGG + Intergenic
990524293 5:56609420-56609442 TTTTTTTAAAAAGCCTTCTTGGG - Intergenic
991065699 5:62422423-62422445 TGCTTTTAAAGGTCCTTCTCTGG - Intronic
993903247 5:93598142-93598164 TCTTGTTAAAGGGCCTGCTCAGG + Intergenic
994963782 5:106639664-106639686 TTTTATTAAAGTGCCTTTGATGG + Intergenic
995608842 5:113888235-113888257 TTTTTTTAAAGGGAATTCATTGG - Intergenic
997158865 5:131586337-131586359 TTTTTGTAAAGTGACTTCTCAGG - Intronic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
999654006 5:153795077-153795099 TTTTTTCAAAGGGCCTGCTCTGG + Intronic
999731068 5:154477052-154477074 TGTTTTCAAAGGGCCTTTGCTGG - Intronic
1000930001 5:167240074-167240096 TTTTTTTAAATAGCCTTTACTGG + Intergenic
1001581954 5:172804984-172805006 TTTTTTAAAAGGGCATTTGTTGG - Intergenic
1003386635 6:5673505-5673527 TTTTTTTAATGGGACTTGGGCGG + Intronic
1008187226 6:48409324-48409346 TGGTTTTGAAGGGCCTTGGCTGG + Intergenic
1011222401 6:85069052-85069074 TGTATTTAAAGGGCATTCACTGG + Intergenic
1013015128 6:106154194-106154216 TTTTTTTAAAGGATCTTCATTGG + Intergenic
1015602418 6:134923324-134923346 TTTTTTTAATAAACCTTCGCTGG - Intronic
1016298511 6:142602405-142602427 TTCTTTTAGAGGGGCTTCCCTGG + Intergenic
1018353257 6:162985233-162985255 TTTTTTTAAATGTCCTTCCCTGG - Intronic
1018853854 6:167661919-167661941 TTTCTTTAATGGGCGTTCTCCGG + Intergenic
1019214144 6:170432061-170432083 TTTTTTAAAAGAACCTTGGCTGG + Intergenic
1019764515 7:2840556-2840578 TTTATTTAAAGTCCCTTCCCTGG + Intronic
1019864733 7:3696895-3696917 TTTTTTTAAAGGAACTTCTATGG - Intronic
1020651909 7:10885820-10885842 TTATTTGAAAGGGCTTTGGCTGG - Intergenic
1020690975 7:11354275-11354297 TTTTTTTTAAGGGGCTTTCCTGG + Intergenic
1020690976 7:11354276-11354298 TTTTTTTAAGGGGCTTTCCTGGG + Intergenic
1021092018 7:16495420-16495442 TTTATTTAAAGGGCATTCACAGG + Intronic
1022607650 7:31832098-31832120 TTTGTTTATAGTGCCTTCACTGG - Intronic
1027801982 7:82765786-82765808 TTTTTTAAAAGGAGCTTCACAGG + Intronic
1028009787 7:85627101-85627123 TTTTTTTAAAATTCCTTCTCTGG - Intergenic
1028269946 7:88776103-88776125 TTGTCTTATAGGGCCTTTGCAGG + Intronic
1028981659 7:96973858-96973880 TCTTTTTAAAATGCCTTCACTGG - Intergenic
1029097638 7:98101591-98101613 CATTTTTAAAGGGCCTTTCCTGG + Intergenic
1030749481 7:113213173-113213195 TTTTTTAAAAGGGACTTTGCAGG + Intergenic
1032772778 7:135076074-135076096 TTTTTTTAAATTGCATTCACTGG + Intronic
1033154630 7:138946482-138946504 TTTTTTTAAAAGGCCTGGCCGGG + Intronic
1033171203 7:139086141-139086163 TTTTTTCATAGGGCTTTGGCAGG - Intronic
1033811860 7:145023669-145023691 TTTATTTGAAGGGCCATCCCAGG - Intergenic
1037658693 8:20908916-20908938 TTTCTTAAAAGGGCTTTTGCTGG + Intergenic
1039187519 8:34933856-34933878 TTTTTTGAAAGGGCCTATGCTGG - Intergenic
1039555966 8:38475193-38475215 TTTTTTTATAGGCCCTGGGCTGG + Intergenic
1040417790 8:47210625-47210647 TTTTTCTAAAGGGCTTTCATTGG + Intergenic
1040972019 8:53145618-53145640 TTTTGTTAAAGGACATTGGCTGG + Intergenic
1042608717 8:70574776-70574798 TTTTTTTAAAGGGCATTTGAGGG - Exonic
1042768147 8:72349431-72349453 TTTTTTTATATGTCCTTCCCTGG + Intergenic
1043309053 8:78835498-78835520 TTTTTTAAAAGTGCCTTCAGAGG - Intergenic
1044705006 8:95000051-95000073 TTTTTTTAAAGAAGCTTAGCTGG + Intronic
1044854760 8:96463935-96463957 ATTTTTTAAAGGTCCTTGGAAGG - Intergenic
1045020646 8:98040968-98040990 TTTTTGTAAAGGGACTGCACTGG - Intronic
1046151276 8:110229680-110229702 TTTTTTTAAAGGTTCTACTCTGG + Intergenic
1046504713 8:115122705-115122727 TTTGTTTATAGGGCCACCGCAGG + Intergenic
1047517545 8:125568310-125568332 TGTTTGTAAAGGGCCTTCCCAGG + Intergenic
1048480721 8:134790106-134790128 TTTTTTAAATGGGCCTCCGATGG + Intergenic
1048511041 8:135063077-135063099 TTTTATTAAAGTTCCTTTGCAGG + Intergenic
1049126444 8:140793485-140793507 TTTCTTTAAAGGGTCATTGCTGG - Intronic
1051222882 9:14869007-14869029 CTTTGTTAAAGGGATTTCGCCGG - Exonic
1054330535 9:63750504-63750526 TTTTTATAAAGACCCTTGGCTGG + Intergenic
1056233741 9:84571598-84571620 TTTCTTTAGAGGGCTTTGGCTGG + Intergenic
1057348276 9:94271825-94271847 TATTTTTAAAGGACTTTTGCAGG + Intronic
1059509420 9:114830156-114830178 TTTTTTTCAAGGGCAATCTCAGG + Intergenic
1060240938 9:121902597-121902619 TTTTTTTAAAGGTCCTTAATGGG + Intronic
1202797923 9_KI270719v1_random:143421-143443 TTTTTATAAAGACCCTTGGCTGG + Intergenic
1186742447 X:12532899-12532921 TATTTTTAAAAGGCTGTCGCAGG - Intronic
1189999815 X:46675168-46675190 TTTGCTTAGAGGGCCTTGGCAGG - Intronic
1198583188 X:138089951-138089973 TTTTTTTAAATGTCCTTTCCTGG - Intergenic
1200248149 X:154537007-154537029 TTTTTTAAAAGGGCATAGGCCGG + Intronic