ID: 931484970

View in Genome Browser
Species Human (GRCh38)
Location 2:62681599-62681621
Sequence TAGCCAACCCTGTTTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931484968_931484970 1 Left 931484968 2:62681575-62681597 CCAGAAACATTGACAGGCCATTT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG 0: 1
1: 1
2: 1
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931484970 Original CRISPR TAGCCAACCCTGTTTTGTTC AGG Intronic
901300415 1:8196321-8196343 TAGCCAACCCTATTTTGCCCAGG - Intergenic
903759224 1:25686110-25686132 AAGCCTTCCCTGTTTTGCTCTGG - Intronic
905738690 1:40350459-40350481 CAGCCCACCCTCTTCTGTTCTGG - Intronic
905838534 1:41152270-41152292 TAGCCACCGCTGTGTTGCTCTGG + Intronic
906031562 1:42724349-42724371 TAGCCATCCCTGCTTTCTTTTGG - Intergenic
907836557 1:58114390-58114412 TTGCCAACATTTTTTTGTTCGGG - Intronic
907879525 1:58533792-58533814 TAGCCAATCACGTTTTTTTCAGG + Intronic
908040003 1:60102254-60102276 TAGACAACACAGTTTTTTTCTGG + Intergenic
909696163 1:78470260-78470282 TAGCCTAACCATTTTTGTTCTGG - Intronic
915817403 1:158983201-158983223 TAGGCAACTTTGTCTTGTTCTGG + Intergenic
916229223 1:162522776-162522798 TGGGCAACCCTTTTTTGTGCGGG + Exonic
923036589 1:230288777-230288799 GAGCCTGCACTGTTTTGTTCTGG + Intergenic
1064171973 10:13041814-13041836 TGGCCAACCCTGGTCTCTTCTGG - Intronic
1066007716 10:31162536-31162558 TAGCCAGCCCTGTTTTCTTTTGG + Intergenic
1067727026 10:48778264-48778286 TCGCCAACCCTGTTATGTGATGG + Intronic
1070352449 10:75606153-75606175 TGGCCAACCCTGTTTTCTAATGG + Intronic
1072337278 10:94408908-94408930 AATTCAAACCTGTTTTGTTCAGG + Intronic
1072468788 10:95692996-95693018 TAGACAACTCTGTTATCTTCAGG - Exonic
1074424461 10:113338776-113338798 TGGCCAACCCTTTTTTGAGCTGG + Intergenic
1076277482 10:129214972-129214994 TAACCAGCCATGTTTTCTTCTGG + Intergenic
1079261307 11:18884610-18884632 TAGACAACCCTGTGATTTTCAGG + Intergenic
1080423115 11:32130288-32130310 TAGGCATCCTTGTCTTGTTCTGG - Intergenic
1083995868 11:66272008-66272030 TGGCCAGCCCTGTCTTGTTCAGG - Intronic
1085812993 11:79702617-79702639 TTGCAACCCCTGTTTTTTTCTGG - Intergenic
1088179840 11:107096700-107096722 TGGGCATCCTTGTTTTGTTCCGG - Intergenic
1092501076 12:9048769-9048791 TAGACATCCCCGTCTTGTTCAGG - Intergenic
1092679371 12:10961026-10961048 TATGGAACCCTTTTTTGTTCTGG - Intronic
1092930849 12:13314449-13314471 TTGCCAACCCTGTCTTTCTCAGG + Intergenic
1093800011 12:23361813-23361835 AAGCCTACGCTGTTTTGTTTAGG - Intergenic
1094645452 12:32319199-32319221 CAGCCATCCTTGTTTTGCTCTGG + Intronic
1098613295 12:72488338-72488360 TAGCCAGCCCTGCTTTCTTTTGG - Intronic
1099952145 12:89315701-89315723 TATCAAACCCTGGTTTGTTTTGG + Intergenic
1103081996 12:118031589-118031611 TAGCCTACCCCATTTTGGTCTGG + Exonic
1108083937 13:46764951-46764973 TAGCCAACCATTCTTTGTACTGG + Intergenic
1109080153 13:57888723-57888745 TAGCCACCTCTGTTTTCTTTTGG - Intergenic
1110525897 13:76536674-76536696 GAAACAACCCTGCTTTGTTCTGG + Intergenic
1110543887 13:76735462-76735484 TAGCCATCACTGTGATGTTCTGG - Intergenic
1111286063 13:86093663-86093685 AATCTAACCCTGTTTTGATCAGG - Intergenic
1112772836 13:102810250-102810272 TAGCCACCCCTGCTCTCTTCTGG + Intronic
1112998103 13:105598996-105599018 TGGCTAACCCTGTGTTGCTCTGG - Intergenic
1115782093 14:36781134-36781156 TAGCCATCCCTGCTGTGTTTTGG + Intronic
1118114921 14:62764456-62764478 TAGGCATCCTTGTCTTGTTCTGG - Intronic
1119019725 14:71098858-71098880 TGGACATCCTTGTTTTGTTCTGG + Intronic
1119598923 14:75961402-75961424 TAGCCAACTCAGCTTTGTTGAGG + Intronic
1120125394 14:80736032-80736054 TATCCAACCCTGTTAGGTTGTGG + Intronic
1120603163 14:86537796-86537818 TAGCTAACCCTATTTTTTGCTGG - Intergenic
1123997850 15:25731227-25731249 TAGCCAACCCTGTTCTCCTTTGG - Intronic
1124898367 15:33798683-33798705 TAACAAACCCCATTTTGTTCAGG - Intronic
1126893201 15:53228714-53228736 TAACTAACCCTATTTTGTTATGG + Intergenic
1127882374 15:63169673-63169695 GTGCCAATCCTGTTTTGTTCTGG + Intergenic
1130358886 15:83161738-83161760 TAAACAACCCTGTTTTTTTCTGG + Intronic
1132543387 16:521785-521807 TCGGGAACCCTGTTTTCTTCTGG + Exonic
1133798762 16:9067848-9067870 AACCGAACCCTGTTTTTTTCAGG + Intergenic
1134418493 16:14065516-14065538 TAGGCATCCTTGTCTTGTTCTGG + Intergenic
1135349747 16:21718732-21718754 TAGCCCATCCTGGTTTATTCTGG + Intronic
1135727366 16:24866710-24866732 TAGCCACTCCTGCTTTTTTCTGG - Intronic
1139118427 16:63985790-63985812 TAGCCAAGAATGTTGTGTTCTGG + Intergenic
1142948010 17:3451138-3451160 TAGCCACCCCTGTTTTCTTTTGG - Intronic
1144767550 17:17740819-17740841 TAGCACAGCCTGCTTTGTTCTGG - Intronic
1147229943 17:39010199-39010221 AAGCCAGCCCAGTTTTGGTCTGG + Intergenic
1148400255 17:47353137-47353159 TAGGCATCCTTGTTTTGTTTTGG + Intronic
1149266514 17:54933236-54933258 AAGCCAACCATGTCTAGTTCAGG + Intronic
1159178970 18:64876642-64876664 TAGCCACCCCTGCTATCTTCTGG - Intergenic
1159486338 18:69063042-69063064 TAGGCATCCCTGTTTTGTTCTGG - Intergenic
1164299013 19:23942773-23942795 TAGCTACCCCTGTTTTCTTTTGG + Intronic
926353899 2:12022259-12022281 TAGCAAACCCTGCTCTGTCCAGG + Intergenic
926837264 2:17037005-17037027 TACCCACTCCTGTTTTGTTTTGG + Intergenic
928018989 2:27686149-27686171 TAGCCAAGCCTGGTTTGTTGTGG - Intronic
930156948 2:48115433-48115455 TAACCAACTCTGTCTTCTTCTGG + Intergenic
930930324 2:56874704-56874726 AAGACCACCCTGTTCTGTTCAGG - Intergenic
931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG + Intronic
931502024 2:62879224-62879246 TGGGCATCCTTGTTTTGTTCTGG - Intronic
933578281 2:84094569-84094591 TAGCCAACCCAGCTTTCTTTGGG - Intergenic
936969114 2:118159110-118159132 TAGCCACCCCTGTTCTCTTTTGG - Intergenic
939000033 2:136724012-136724034 TGGGCATCCCTGTCTTGTTCCGG + Intergenic
941095549 2:161237328-161237350 TAGCAAACTCGGTTTTCTTCTGG + Intergenic
942391433 2:175498007-175498029 TGGGCATCCTTGTTTTGTTCTGG + Intergenic
946713676 2:222531839-222531861 CTTCCAACCCAGTTTTGTTCAGG - Intronic
947516413 2:230808705-230808727 TGGCCATCCCTGTTATGATCAGG + Intronic
1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG + Intergenic
1170021209 20:11838469-11838491 GAGCCAACATTGTCTTGTTCTGG - Intergenic
1173902101 20:46598415-46598437 GAGCAAACACTTTTTTGTTCAGG + Intronic
950819954 3:15746266-15746288 TAGGCATCCCTGTCTTGTTCTGG + Intronic
955528424 3:59845895-59845917 TAGCCAACTCTGCTCTGTTTTGG + Intronic
955774589 3:62419864-62419886 TAGCCAACCCTGTTTTAAGACGG - Intronic
958576908 3:95962064-95962086 TAGCCACCCCTGCTTTTTTTTGG - Intergenic
958687798 3:97423087-97423109 TAGGCATCCTTGTCTTGTTCCGG - Intronic
964052775 3:152417195-152417217 TAGTCAGCCCTGTTTTGATGAGG + Intronic
967560812 3:190917478-190917500 TGGACATGCCTGTTTTGTTCTGG + Intergenic
970357091 4:15265990-15266012 TAGCCACCCCTGCTTTCTTGTGG - Intergenic
973652707 4:53012477-53012499 TAGCCAGCCCTGGGTTCTTCTGG - Intronic
974633540 4:64528062-64528084 TAGACATCCTTGTCTTGTTCAGG - Intergenic
979398531 4:120219117-120219139 TGGGCATCCTTGTTTTGTTCTGG + Intergenic
979753871 4:124315149-124315171 TAGCCAATCCTGGTCTGTTTTGG - Intergenic
981627297 4:146773275-146773297 TAGGCATCCTTGTCTTGTTCTGG + Intronic
988846810 5:35135783-35135805 TGGGCAGCCATGTTTTGTTCTGG + Intronic
989422555 5:41256720-41256742 AAGCCAACCTTCTTTTTTTCTGG + Intronic
990236524 5:53773992-53774014 TAGCCAACCCTGGTCTCTTTTGG - Intergenic
994500005 5:100563328-100563350 TAGCAACCCCTGCTTTGTTTTGG - Intronic
994956066 5:106534557-106534579 TAGCCAACCCTGTTTTCTTCTGG + Intergenic
995907037 5:117137016-117137038 TTGCTACCCCTGTTTTGTTTTGG + Intergenic
997085665 5:130795203-130795225 TGTCCCACCCTGTTCTGTTCTGG - Intergenic
998274527 5:140739814-140739836 CAGACATCCCTGTCTTGTTCTGG + Intergenic
999089437 5:148922583-148922605 TAGCTCAGCCTGTTGTGTTCAGG + Intergenic
1001503643 5:172259003-172259025 TGGGCATCCTTGTTTTGTTCTGG + Intronic
1001838783 5:174855381-174855403 TGGAGAACCCTCTTTTGTTCTGG - Intergenic
1005775196 6:29123749-29123771 TATCCAATCTTGTTTTGTTTTGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1012206599 6:96468705-96468727 CAGCCAATCTTGTATTGTTCTGG + Intergenic
1012704552 6:102504877-102504899 TAGCCATCCCTGCTTTCTTTTGG + Intergenic
1012746928 6:103103218-103103240 TAGGCATTCCTGTCTTGTTCTGG + Intergenic
1019014739 6:168871751-168871773 CAGCCAACCCAGTTTTCTTATGG + Intergenic
1020614792 7:10444798-10444820 TAGCTAACCCTGCTTTTTTTTGG - Intergenic
1020651640 7:10883291-10883313 TAGGCAATCTTGTCTTGTTCTGG + Intergenic
1023758198 7:43439816-43439838 TAGCTAACCTTCTTTTGGTCGGG - Intronic
1024268001 7:47621413-47621435 AAGATAACCCAGTTTTGTTCAGG - Intergenic
1024778566 7:52818589-52818611 TAGCCATCCCTGATCTCTTCTGG - Intergenic
1030459741 7:109818545-109818567 TTGCCATACCTTTTTTGTTCAGG - Intergenic
1031680129 7:124662901-124662923 TAACCAATTCTGATTTGTTCAGG - Intergenic
1031726574 7:125247234-125247256 TAGCAAACCCTGTGTTCTGCTGG - Intergenic
1033036306 7:137879287-137879309 TACCCCACCCTGCTTTGTTGAGG + Exonic
1034027873 7:147726644-147726666 TAAACAACTCTGTTTTGTTAAGG - Intronic
1038834994 8:31109987-31110009 AACCCAACCCTGTTTTCTTATGG + Intronic
1039005510 8:33032158-33032180 TAGGCATCCTTGTCTTGTTCTGG - Intergenic
1041220317 8:55644472-55644494 TAGGCATCCTTGTCTTGTTCTGG + Intergenic
1046074072 8:109296179-109296201 TAACCACTCCTGTTTTGATCTGG - Intronic
1046290144 8:112148509-112148531 GAGCAAAACATGTTTTGTTCAGG - Intergenic
1050353226 9:4760078-4760100 TTGACAACCCTGTTTTATGCTGG - Intergenic
1050400383 9:5247524-5247546 TAGCCACCCCTGTTCTTTTTTGG - Intergenic
1055968585 9:81889200-81889222 GAGCCAGCCCTGTGTGGTTCAGG + Intergenic
1057344227 9:94234028-94234050 TGGCCCACCCTGTTTTCTTCTGG - Intergenic
1059824528 9:118013363-118013385 TAGGCAACCTTGTGTTGTTGGGG + Intergenic
1187615160 X:20985521-20985543 TAGGCATCCTTGTCTTGTTCCGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1191747446 X:64504929-64504951 TAGCCATCCTTGTCTTGTTCTGG - Intergenic
1191822188 X:65323203-65323225 TTGGCATCCCTGTGTTGTTCTGG + Intergenic
1193061257 X:77210098-77210120 TAGCCTGCCCTGTTATGTTGGGG + Intergenic
1193944818 X:87722587-87722609 AAGATAACCCTGTTTTGTCCAGG + Intergenic
1194873052 X:99156784-99156806 TAGGCATCCTTGTCTTGTTCTGG - Intergenic
1196407816 X:115383794-115383816 TCGCCAGCCCTTTTTTTTTCTGG - Intergenic
1199636221 X:149814568-149814590 TATGCATCCTTGTTTTGTTCTGG - Intergenic
1200358342 X:155575931-155575953 TGGACATCCTTGTTTTGTTCTGG - Intronic