ID: 931485199

View in Genome Browser
Species Human (GRCh38)
Location 2:62683721-62683743
Sequence GTGGAAAAACTAGGAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 552}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931485196_931485199 -6 Left 931485196 2:62683704-62683726 CCTAAACTACACAGAAAGTGGAA 0: 1
1: 0
2: 0
3: 34
4: 328
Right 931485199 2:62683721-62683743 GTGGAAAAACTAGGAAAGAAGGG 0: 1
1: 0
2: 3
3: 77
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931485199 Original CRISPR GTGGAAAAACTAGGAAAGAA GGG Intronic
901901005 1:12362466-12362488 GTGAAGAAACTAGGAATTAAGGG + Intronic
902143826 1:14379660-14379682 GTGGAAAGGGGAGGAAAGAATGG + Intergenic
902357438 1:15915331-15915353 GTGGAAAAACTAGCTAGGCATGG + Intronic
905413474 1:37788504-37788526 GTGAAAAAAATCAGAAAGAAGGG - Intergenic
905621812 1:39454884-39454906 GTGGAAAAAGAAGGAAACCATGG - Intronic
905680228 1:39865223-39865245 GAAGAAAAACCTGGAAAGAATGG - Intronic
905862104 1:41358678-41358700 GTGGAAAAACGAGGAATGAAAGG + Intergenic
906005506 1:42466123-42466145 GTGGAAAATAGAAGAAAGAAAGG + Intronic
906353516 1:45083594-45083616 GTTGAACAACTGGGAAAGACAGG + Intronic
906906070 1:49893639-49893661 GTGGAAAAATGAGGAAAACATGG + Intronic
907396821 1:54196675-54196697 GTGGCAAAACTAGGGGAAAAAGG - Intronic
908407419 1:63828953-63828975 ATGGAAAAATAAAGAAAGAAAGG - Intronic
908594666 1:65674313-65674335 ATGGTAAAACTTTGAAAGAAAGG - Intergenic
908800726 1:67877526-67877548 TAGGAAAAAGAAGGAAAGAATGG + Intergenic
908966625 1:69772800-69772822 GGAGGAAAACAAGGAAAGAAGGG + Intronic
909047672 1:70729549-70729571 GTGGAAGAAGTAGAACAGAAAGG - Intergenic
909758070 1:79252655-79252677 GTGGAAAAATTAAGAAAAGAAGG + Intergenic
909986471 1:82166553-82166575 GTAGAGAAACTAGGAGAAAACGG + Intergenic
911240053 1:95455160-95455182 GAGGAAAAACAATGAAATAAAGG + Intergenic
911431654 1:97796627-97796649 GAGGAAAATATAGGAAGGAAAGG + Intronic
912754158 1:112310392-112310414 GTGGAAAAATTAGGTCAGAGAGG - Intergenic
913369817 1:118085640-118085662 GGGGGAAAACGAGGAAAAAAGGG + Intronic
915673729 1:157511889-157511911 GCAGACAAACTAGGAAAGAAGGG - Intergenic
915721934 1:157992452-157992474 ATGGAGGAACTAGGAAGGAAGGG - Intergenic
915983560 1:160439876-160439898 GTGGAAAAAACAGCAAAAAAAGG - Intergenic
916153807 1:161824486-161824508 GTAGAAAAATGAAGAAAGAAAGG - Intronic
916268741 1:162918264-162918286 GCAGACAAACTAGGAAAGAAGGG + Intergenic
916954492 1:169818203-169818225 GTGGAAAACCTTGGTAAGTAAGG + Intronic
917220333 1:172721800-172721822 GCAGACAAACTAGGAAAGAAGGG + Intergenic
917282092 1:173386900-173386922 AAGGAAGAAATAGGAAAGAAGGG - Intergenic
917300515 1:173569891-173569913 GTGGAAAAAGGAGGAAAGAGTGG - Intronic
917370351 1:174286568-174286590 ATGGAAAAAATAGTAAAGACTGG - Intronic
917387214 1:174490796-174490818 GTGGAAAGAGGAGGGAAGAACGG - Intronic
918141110 1:181720651-181720673 GGGGAAAAAGTAGGGAAGAGGGG + Intronic
919158664 1:193801019-193801041 GTAGAAAAACTAGAAAAAATGGG - Intergenic
920644435 1:207788998-207789020 GTAGAAGAATTAGTAAAGAAAGG - Intronic
921279909 1:213556274-213556296 GTGGAGAAACATGTAAAGAATGG + Intergenic
921548327 1:216500910-216500932 GTGAAACAAATAGAAAAGAAAGG - Intergenic
922274571 1:224065400-224065422 GTAGACAAACTAAGATAGAAAGG + Intergenic
923932477 1:238717823-238717845 ATGGAAAAATTAAGAAAGGAAGG - Intergenic
924188520 1:241522287-241522309 GGGGAAACATTAGGAAAAAATGG + Intergenic
924618641 1:245639227-245639249 TTGGAAAATCTAGGAAAAAATGG - Intronic
924761401 1:246990159-246990181 GAGGAAAAGGAAGGAAAGAAAGG + Intronic
1063249422 10:4257821-4257843 TTGGAAAAATAAGGAAAGAAAGG - Intergenic
1063801240 10:9580836-9580858 GTTGATAAAATAGGAATGAAAGG + Intergenic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064224477 10:13470564-13470586 GTGGAGAAACTTGTTAAGAAGGG - Intronic
1064516951 10:16160467-16160489 GACGAAAATGTAGGAAAGAAAGG - Intergenic
1064738920 10:18412399-18412421 GGGAAAAAAATAGGACAGAAGGG - Intronic
1064976557 10:21122873-21122895 GGAGGAAAACTAGGAAATAAAGG - Intronic
1066109103 10:32180739-32180761 ACAGACAAACTAGGAAAGAAGGG - Intergenic
1066161683 10:32739468-32739490 CTAGAAAAACTAAGAAAAAAAGG - Intronic
1067358354 10:45552361-45552383 GTGGAGAAAATTGAAAAGAATGG - Intronic
1068069227 10:52175132-52175154 CTGGAAAAATTAGGAGAAAATGG - Intronic
1068812833 10:61275843-61275865 GTGGCAAAAATATGGAAGAAAGG + Intergenic
1069086102 10:64141458-64141480 CTGGAAAATCTATGAAAGCAAGG - Intergenic
1069726687 10:70584682-70584704 GTGGAAACACTAACAAAGGAGGG + Intergenic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1070399982 10:76044982-76045004 GGGGAAAAACTAGCAAGGGAGGG - Intronic
1070445435 10:76496125-76496147 GTGGAAAATCTAGTAAACCATGG - Intronic
1070534456 10:77364993-77365015 GGGGAAAAATTAGGAAACAAGGG + Intronic
1071604861 10:86978801-86978823 AAGGATAAACTAGGAAATAAAGG + Intronic
1071749027 10:88453749-88453771 GAGGAAGAACTTAGAAAGAAAGG - Intronic
1072058009 10:91779934-91779956 GGGGAAAAAAAAGAAAAGAAAGG + Intergenic
1072761368 10:98059793-98059815 GAGGGAAAACTAGGAATGAAGGG - Intergenic
1072795658 10:98352581-98352603 GAAGACAAACGAGGAAAGAAAGG - Intergenic
1073809858 10:107141159-107141181 GTGGAAAAGCAAGGAATGAAAGG + Intronic
1074779093 10:116787756-116787778 GTGAAAAGAAGAGGAAAGAAGGG + Intergenic
1075083046 10:119396716-119396738 GATGAAAAACTGGGAGAGAAAGG + Exonic
1075233010 10:120700047-120700069 GTGGGAAAACTAGCAGAGTAGGG + Intergenic
1076341532 10:129750487-129750509 GTTCAACAACAAGGAAAGAATGG + Intronic
1077747261 11:4920349-4920371 GTGGAAACAGTATGAAAGGAAGG - Intronic
1079186205 11:18239661-18239683 GGAGGAAAACTAGGAAAGCATGG - Intronic
1079428100 11:20363259-20363281 GTGGAAAGGCTAGAAAAGAAAGG + Intergenic
1079688936 11:23398322-23398344 GTGGAAAGAGGAGGAAAGAAAGG + Intergenic
1079806393 11:24935792-24935814 ATGGTAAAATTTGGAAAGAATGG + Intronic
1080212534 11:29803548-29803570 GAGGACAAAGAAGGAAAGAAGGG + Intergenic
1080629661 11:34062322-34062344 CTGGAAAAACTGGTAAAGATTGG + Intronic
1080735085 11:35006223-35006245 GTGGAAATACTATGTAATAATGG - Intronic
1081073660 11:38642085-38642107 GTGGAAAAGGGAGGAAAGAGTGG - Intergenic
1081422472 11:42887131-42887153 TTGGAAAACCTAGGAAGAAATGG + Intergenic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1082115046 11:48319155-48319177 GGGGAAAAACTAGTGAAGGATGG + Intergenic
1082258617 11:50060145-50060167 GGGGAAAAACTAGTGAAGGAAGG - Intergenic
1082675637 11:56098508-56098530 TTGGAATAACTAGTATAGAATGG + Intergenic
1083891106 11:65596157-65596179 GTGTAAACACCAGGAAGGAAAGG - Intronic
1085358116 11:75858330-75858352 GTGTAAAAAAGAGGAGAGAAAGG - Intronic
1085364632 11:75928395-75928417 GTGGAAAATCTAGGACAAAGAGG + Intronic
1086249684 11:84798399-84798421 GTGGAAAAGAGAGGAAAGAGGGG - Intronic
1086404085 11:86485559-86485581 GTGGAATAAGCTGGAAAGAAAGG - Intronic
1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG + Intergenic
1087264628 11:96046682-96046704 GTGGAAAGAGAAGGAAAGGAAGG - Intronic
1087694151 11:101356580-101356602 TTGGAAAACCTAGAAAAAAATGG + Intergenic
1087848295 11:102998414-102998436 GTGGAAAAATCTGGAAAGGATGG - Intergenic
1088182159 11:107125210-107125232 TTGGAAAATCTAGAAAAAAATGG + Intergenic
1088217303 11:107525733-107525755 GTGGAAAAACAAAGAAATAAAGG + Intronic
1088236676 11:107732473-107732495 AAGGAAAAAGTAGCAAAGAAAGG + Intergenic
1088304195 11:108390645-108390667 GTGGAAAAGAGAGGGAAGAAAGG - Intronic
1088615602 11:111624522-111624544 ATGTAAGAAATAGGAAAGAAAGG - Intronic
1089308832 11:117544529-117544551 GTGGAACCAAAAGGAAAGAAAGG - Intronic
1090016495 11:123090787-123090809 GCAGACAAACTGGGAAAGAAGGG + Intronic
1090474672 11:127009060-127009082 GTGGAAATATTACGAATGAAAGG - Intergenic
1090754203 11:129774308-129774330 GGGGAAAAAAAAGGAGAGAAAGG + Intergenic
1090860395 11:130647723-130647745 GAGAGAAAACTGGGAAAGAAGGG - Intergenic
1091521372 12:1247292-1247314 GTGGAAAAACAATGAAAGTAAGG + Intronic
1091610325 12:2002119-2002141 GAGGAGAAATTAGGAAGGAAAGG - Intronic
1091958883 12:4673257-4673279 GGGGAGAAACTAGGGCAGAAAGG + Intronic
1092014522 12:5147100-5147122 ATGGCAAAATTAAGAAAGAACGG - Intergenic
1092606115 12:10121311-10121333 GTCCAAAAAGGAGGAAAGAAAGG + Intronic
1092978171 12:13766374-13766396 GTGGGAGAACTGGGAAAGAGAGG - Intronic
1093101388 12:15033856-15033878 GCAGACAAACTAAGAAAGAAGGG + Intergenic
1093631454 12:21414159-21414181 GCAGACAAACTAGGAAATAAGGG - Intronic
1093710582 12:22325676-22325698 TAGGAAAAAATAGGAAAAAACGG - Intronic
1093851692 12:24047042-24047064 GGGGAAAAAATAAGAAGGAAAGG - Intergenic
1094444975 12:30519648-30519670 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1094533787 12:31303211-31303233 GTGGAAATACAAGGAAAAATGGG - Intronic
1094597321 12:31876959-31876981 GCAGACAGACTAGGAAAGAAGGG + Intergenic
1094643673 12:32300542-32300564 GTTGAAATACTAGGAAAGGTTGG + Intronic
1095417806 12:41995184-41995206 CTGGAAAAAAAAGGAAAGAAAGG + Intergenic
1097177273 12:57150645-57150667 GTGGAAAAGGTGGGAAAGGATGG + Intronic
1097392500 12:59032819-59032841 GTGGAAAAGATAGGAGAGGAGGG + Intergenic
1097798926 12:63891357-63891379 GTGGAGATGGTAGGAAAGAACGG - Intronic
1098873759 12:75845543-75845565 GTGGACAAAAAAGGAAGGAAGGG + Intergenic
1099704707 12:86137214-86137236 GAGGAAAAAGTAGTCAAGAATGG - Intronic
1099889161 12:88568820-88568842 GGGAAAGAACAAGGAAAGAAGGG + Intronic
1099906979 12:88782984-88783006 GTGGAGAAAAGAGGAAAGCAGGG - Intergenic
1100112145 12:91258855-91258877 GGGGAAAAACTAGAAACTAAAGG + Intergenic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1100524774 12:95409051-95409073 GTGTAAAACCTAGGAATGACAGG - Intergenic
1100798116 12:98203016-98203038 GAGGAAAAACCAGCAAAAAAAGG + Intergenic
1101493762 12:105235100-105235122 GTTGAGACACTAGGAAATAAAGG + Intronic
1101580573 12:106037980-106038002 GAGGAAGAAAAAGGAAAGAAAGG - Intergenic
1102713738 12:114952127-114952149 GTAGTAAAAGTAGGTAAGAATGG + Intergenic
1102997715 12:117362474-117362496 GGGGAAAATCAAGGAAAGAGAGG + Intronic
1103104619 12:118212685-118212707 GGGGAAAAAATAGAAAAGATAGG + Intronic
1103138702 12:118529998-118530020 TTGGAAAAAATAATAAAGAAAGG - Intergenic
1103453636 12:121047786-121047808 GCAGAGAAACTAGAAAAGAAGGG + Intergenic
1103829246 12:123765064-123765086 GAGGAAAAAAAAGGAAACAAAGG - Intronic
1104033810 12:125084404-125084426 GTCGAAAAGAAAGGAAAGAAAGG - Intronic
1105432906 13:20353253-20353275 GAAGAAAAATTAGGAAAGAGGGG + Intergenic
1105814101 13:24017689-24017711 GTGCAGAAACTCGGTAAGAAGGG + Exonic
1105821730 13:24086496-24086518 ATGGGAAAAATATGAAAGAAAGG + Intronic
1106189632 13:27439789-27439811 GTGGAAAAACAGTGAAAAAAAGG + Intronic
1106391039 13:29336243-29336265 GAGGAAAAACTAGCACAAAAAGG - Intronic
1106615172 13:31319916-31319938 GTGGGGAAAGAAGGAAAGAAAGG - Intronic
1106649385 13:31673444-31673466 GGGGAAAAAAAAGGAAAGAAAGG + Intergenic
1108029957 13:46219703-46219725 GAGGAAAAACTAGCACAAAAAGG - Intronic
1108569039 13:51731085-51731107 GTGGGAAAACAAGGAATGGATGG + Intronic
1108676515 13:52741571-52741593 GTAGAAAAAATGGCAAAGAATGG + Intergenic
1108858087 13:54820329-54820351 GTGGAAAGAGGAAGAAAGAATGG + Intergenic
1108981148 13:56516364-56516386 ATGTAAAGACTAGGAAAAAAAGG - Intergenic
1109061379 13:57625116-57625138 GCTGACAAATTAGGAAAGAATGG + Intergenic
1109633131 13:65079421-65079443 GTGGAAAGGCTAGGGCAGAAAGG + Intergenic
1109777020 13:67054092-67054114 GTGAAATAACTGGCAAAGAAAGG + Intronic
1109901636 13:68780560-68780582 GTATAAAAACTGGGAAGGAAGGG - Intergenic
1110159270 13:72356102-72356124 GTTGGATAGCTAGGAAAGAAAGG - Intergenic
1110801794 13:79706330-79706352 TTGGGAAAAAAAGGAAAGAAAGG - Intergenic
1111267357 13:85834716-85834738 GTAGAAAATCTATTAAAGAAAGG + Intergenic
1111755959 13:92396323-92396345 ATGGAAACTCTAAGAAAGAATGG - Intronic
1111934688 13:94546971-94546993 AGGGAAGAACTAGGGAAGAAGGG + Intergenic
1112116518 13:96361032-96361054 CTGGAAACACTATGCAAGAATGG + Intronic
1112489093 13:99845848-99845870 GTGGAAAAACCAGAAAACGAAGG - Intronic
1112535605 13:100252118-100252140 GAGAAAGAACTAGGACAGAAAGG - Intronic
1113060006 13:106312979-106313001 GTGAAAAAATTAGGAACTAATGG + Intergenic
1114968006 14:27988086-27988108 GTGGGAAATGTAGGAAAGAGTGG + Intergenic
1115088745 14:29548802-29548824 GTGGAAAAAATACTTAAGAACGG + Intergenic
1115282329 14:31678030-31678052 GTGGAAAGAAGAGGAAAGAATGG - Intronic
1115365518 14:32552807-32552829 GTGGACACACTGAGAAAGAAGGG + Intronic
1115717966 14:36126768-36126790 CTGGAAAATTTAGGAAGGAAAGG - Intergenic
1116072424 14:40065515-40065537 CTATAAAAACTTGGAAAGAATGG - Intergenic
1116234744 14:42264613-42264635 GTGGTAAAACTAGAAATCAATGG - Intergenic
1116583680 14:46674822-46674844 CTGGAAAAACTGGGCCAGAAGGG + Intergenic
1117212293 14:53513150-53513172 GAGATAAAACTAGGAAAGCATGG + Intergenic
1117609403 14:57466495-57466517 GAGGAAAAACCATGAATGAAGGG - Intergenic
1117944334 14:61001571-61001593 GCGATAAAACTAGGGAAGAATGG - Intronic
1118000679 14:61520268-61520290 GAGGAAAAAGGAGGAAAGACAGG - Intronic
1118676318 14:68188369-68188391 AGGGAAAAACAAGGAGAGAAGGG - Intronic
1120146797 14:80987713-80987735 GTGAAGAATATAGGAAAGAAAGG - Intronic
1120251633 14:82066137-82066159 GGAGAAAAAAAAGGAAAGAAAGG - Intergenic
1120251821 14:82067849-82067871 CTGGAAGAAATAGGAAAGAGTGG + Intergenic
1120505076 14:85345980-85346002 GTAGAAAAATTAGGGAAGTATGG - Intergenic
1120839777 14:89075245-89075267 GTGGCAAAACTTGGAAAGATGGG + Intergenic
1121060789 14:90907688-90907710 TTGGTAAAACAAGGAAAGAAAGG + Intronic
1121603463 14:95223423-95223445 GTGGAAAAATTGGAAGAGAAAGG - Intronic
1121670013 14:95701924-95701946 GCAGATAATCTAGGAAAGAAGGG - Intergenic
1122930611 14:104931608-104931630 CTGGAAATATGAGGAAAGAAGGG - Intronic
1125315763 15:38429602-38429624 GTGGAAAAAATAGGTATTAAAGG + Intergenic
1126260320 15:46681948-46681970 GTAGCAGAATTAGGAAAGAAGGG + Intergenic
1126264852 15:46742051-46742073 GAGGAAAAACTAGCACAAAAAGG + Intergenic
1126285290 15:47003358-47003380 GCAGAAAAACTAGGAAAGAAGGG + Intergenic
1126414747 15:48406058-48406080 GTGGAATAACTAGAAAGGGATGG + Intergenic
1126874840 15:53030120-53030142 GTGGAAGAACAAAGAAAGACAGG - Intergenic
1127373851 15:58363944-58363966 GAGGAAAAACCAGCACAGAAAGG + Intronic
1127929825 15:63586777-63586799 GTGGGAAATTGAGGAAAGAATGG + Intronic
1128424640 15:67528755-67528777 GTGGAAAAACCAAGACACAAAGG - Exonic
1128606377 15:69039396-69039418 GTGGAGTAGCAAGGAAAGAAGGG + Intronic
1129163360 15:73760360-73760382 GTGGAAAAAACTGGAAGGAAGGG + Intergenic
1130442040 15:83964062-83964084 GTGGAAAAACCAGCACAAAAAGG + Intronic
1131868693 15:96738953-96738975 ATGGAAAAACTAGGCCAGGAGGG + Intergenic
1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG + Intergenic
1134754748 16:16657040-16657062 GTGGAAAAACTAGAAAAATAAGG - Intergenic
1134991312 16:18702002-18702024 GTGGAAAAACTAGAAAAATAAGG + Intergenic
1135129364 16:19839541-19839563 ATGAACAAAATAGGAAAGAAAGG - Intronic
1137682198 16:50358661-50358683 GTGGAAAAAGTACCAAAGGAGGG + Intronic
1137825822 16:51493986-51494008 GTAGAAAAAGTAGGGAAGGAAGG - Intergenic
1137930670 16:52584320-52584342 GTGCAAAATTTAAGAAAGAATGG - Intergenic
1137997545 16:53235158-53235180 GTGGAAAAACAAAGAATGAATGG - Intronic
1138291945 16:55855314-55855336 ATGGAAAAAGGAGAAAAGAAAGG + Intronic
1138618810 16:58196278-58196300 GTGGAAAAAGAAGTAATGAAGGG + Intronic
1138896770 16:61215289-61215311 GTGGAAAAGAAAGGATAGAATGG - Intergenic
1139287635 16:65829834-65829856 GGGGAGAAACCAGGAGAGAATGG + Intergenic
1139496127 16:67319612-67319634 GGAGAAAAATTAGGAAAGAAAGG + Intronic
1140617569 16:76684718-76684740 ATGGAAGAACTGAGAAAGAAGGG - Intergenic
1145401710 17:22543000-22543022 TTGGAAAAATGAAGAAAGAAAGG + Intergenic
1146135355 17:30315617-30315639 GGGGAAAAAAGAAGAAAGAATGG + Intergenic
1146254414 17:31382087-31382109 GTGGAATAAACAGGAAAGCATGG + Intronic
1146309727 17:31758290-31758312 GTGCAAATACTGGGAAAAAAGGG - Intergenic
1146664787 17:34692149-34692171 GTTGGACATCTAGGAAAGAATGG + Intergenic
1146672848 17:34753837-34753859 GTGGAAAAGGTAGGGAGGAAGGG + Intergenic
1146749973 17:35369377-35369399 GTGGAAAAAGGAGGGAAGAATGG + Intronic
1146946174 17:36875188-36875210 ATGGAATGACAAGGAAAGAAAGG + Intergenic
1147340081 17:39748085-39748107 GGGGCAGAACTAGGACAGAAAGG - Intergenic
1148147967 17:45377888-45377910 GTGGAAAAGGAGGGAAAGAAGGG - Intergenic
1148367598 17:47068426-47068448 ATGGAAAAAATAAGAAAGATTGG - Intergenic
1148720682 17:49750971-49750993 GGGAAATAAGTAGGAAAGAAAGG + Intronic
1149231324 17:54537376-54537398 GTGGAATAAGTAGGGAAGAGTGG + Intergenic
1149535908 17:57433130-57433152 GTGGAACAACTCGGAAAGGGAGG + Intronic
1150812344 17:68366567-68366589 ACGAAAAAACTAGGCAAGAATGG + Intronic
1151038915 17:70835330-70835352 GTGTAAACACAAGGAAAGAATGG - Intergenic
1155515617 18:26621495-26621517 GTGGAAAAACGAGACAAGCAGGG + Intronic
1155613600 18:27696683-27696705 GTGGAAGAACAAGGAAAACATGG + Intergenic
1156259390 18:35430516-35430538 CTGGAAAAACCATGAGAGAAGGG + Intergenic
1156323757 18:36053880-36053902 GTGAGAAAACTATGAAGGAAGGG + Intronic
1157782502 18:50452259-50452281 GCAGACAAACTAGGAAATAAGGG - Intergenic
1157833124 18:50875889-50875911 GTGCAAAAACATGTAAAGAATGG - Intergenic
1158153197 18:54394995-54395017 GCAGACAAACTAGGACAGAAGGG + Intergenic
1159509469 18:69377593-69377615 TTGGAATAAATCGGAAAGAAAGG + Intergenic
1159583385 18:70260192-70260214 AAGGAAAAAAAAGGAAAGAATGG + Intergenic
1161762095 19:6181294-6181316 GGGGAGAAAGAAGGAAAGAAAGG + Intronic
1162235608 19:9306831-9306853 CTGGTAAAACTAGGGAATAAGGG - Intronic
1163181330 19:15606051-15606073 GCAGACAAACTAGGAAAGAAAGG + Intergenic
1165000726 19:32759649-32759671 CTGGAAAACTTTGGAAAGAAAGG - Intronic
1165543939 19:36517547-36517569 GTGGAGAAACTGGGCAAGAGTGG + Intronic
1165694245 19:37888506-37888528 GAAGAGAAACTAGCAAAGAAAGG - Exonic
1167479241 19:49719403-49719425 TTGGAAAAAAAAAGAAAGAAAGG - Intergenic
1168381416 19:55926977-55926999 GTGGAAAAAATAAGAAGAAAAGG + Intronic
924975453 2:170186-170208 GTGAACAAAATAGGAAAGTATGG - Intergenic
925459704 2:4049952-4049974 GCAGACAAACTAGGAAAGAAGGG - Intergenic
926177020 2:10602674-10602696 ATGGAAAATCAAGAAAAGAATGG + Intronic
926884943 2:17588376-17588398 ATGGAGTAACTAGGAAGGAAAGG + Intronic
927868282 2:26606914-26606936 ATGGAACAAATAGGGAAGAAAGG + Intronic
927953987 2:27194958-27194980 GTGGTAAAACCATGAAAAAAAGG - Intergenic
928074065 2:28246991-28247013 TTGGAAAAGCTAAGATAGAAAGG - Intronic
928125248 2:28611093-28611115 TTGGAAAAAAAAGAAAAGAAGGG + Intronic
928128826 2:28634452-28634474 ATGAAAAAACTGGGAAGGAAGGG - Intronic
930225282 2:48785794-48785816 GTGGGAAAACAAGAAAAGAATGG + Intergenic
930658421 2:54029927-54029949 GCAGACAAACTAGGAAAGAAGGG + Intronic
930895016 2:56435672-56435694 TTGGAAAACCTAGAAAAAAATGG - Intergenic
931212694 2:60213070-60213092 GAGGAAAAAGAAAGAAAGAAAGG - Intergenic
931287981 2:60848760-60848782 GCAGACAAACTAGGAAAGAAGGG - Intergenic
931485199 2:62683721-62683743 GTGGAAAAACTAGGAAAGAAGGG + Intronic
931566559 2:63621057-63621079 GAGGAAAAACCAGTACAGAAAGG + Intronic
931656673 2:64515622-64515644 GTGGAAAAAAGTAGAAAGAATGG + Intergenic
932646450 2:73508162-73508184 GTGGAAAGAAAAGAAAAGAAAGG - Intronic
933273061 2:80254381-80254403 GTAGAAAAAATAAGAAAGAAAGG + Intronic
933280093 2:80323372-80323394 GAGGAAAAGCTAGAAATGAAGGG - Intronic
933403802 2:81832313-81832335 TTGGAAAACCTAGAAAAAAATGG + Intergenic
933617828 2:84501562-84501584 TTCCAAAAACTAGGAAAGGACGG - Intergenic
934151093 2:89148291-89148313 GCAGAGAAACTAGGAAAGAAGGG - Intergenic
934216167 2:90033616-90033638 GCAGACAAACTAAGAAAGAAGGG + Intergenic
935300044 2:101686145-101686167 AGGGAAGAATTAGGAAAGAAGGG - Intergenic
936500670 2:113063540-113063562 GTAGAAAAATTAGGAAATACAGG - Exonic
937055996 2:118937287-118937309 GCAGACAAACTGGGAAAGAAGGG + Intergenic
937112916 2:119380572-119380594 GAAAAAAAACTGGGAAAGAAAGG + Intergenic
937724944 2:125152153-125152175 GTGGAAAAAATAGCAAAATATGG - Intergenic
937773367 2:125747493-125747515 ATGAAATAACTTGGAAAGAATGG + Intergenic
937836288 2:126473239-126473261 GTGGAAAAACTATGAAACTGTGG + Intergenic
938144860 2:128824730-128824752 GAGGAGAAACCAGGACAGAAAGG + Intergenic
938519144 2:132048795-132048817 AAGGAAAAAGGAGGAAAGAAAGG - Intergenic
939153381 2:138498126-138498148 GAAGAAAATTTAGGAAAGAAGGG + Intergenic
939617671 2:144378969-144378991 GAGGGAAAAATGGGAAAGAAGGG - Intergenic
941496289 2:166208684-166208706 TTGGAAAAACTAGTAAAATAGGG + Intronic
941838384 2:170051848-170051870 GTAGAAGAACTAGGAAAGGATGG - Intronic
942623891 2:177878056-177878078 AGGGAAAAAATAGAAAAGAAGGG + Intronic
943367779 2:186982025-186982047 GTGGTAAAACTAGGGAAAAAGGG - Intergenic
944756770 2:202770961-202770983 GGGGGAATACTAAGAAAGAAAGG - Intergenic
944864939 2:203850965-203850987 GAGGAAACACTTAGAAAGAATGG + Intergenic
944990221 2:205226910-205226932 GTGGATCAATTAAGAAAGAATGG - Intronic
945198169 2:207256808-207256830 GTAGAAAAATGAGGAAACAAAGG - Intergenic
945438335 2:209846000-209846022 AAAGAAAAACAAGGAAAGAAGGG - Intronic
945552469 2:211237192-211237214 GTGAAAACACTAGGCGAGAAGGG + Intergenic
945628137 2:212237178-212237200 GAGGAAAAACTAGCGCAGAAAGG - Intronic
945690294 2:213025766-213025788 GTGGTAACACTAGCAAAGAAGGG - Intronic
946114662 2:217450868-217450890 ATGGCAAAGCTAGGAAGGAAAGG + Intronic
946503716 2:220276863-220276885 ATAGAAAAACTAGAAATGAAGGG + Intergenic
946630757 2:221665750-221665772 ATGGGAAAACTAGAAAATAAAGG - Intergenic
947581240 2:231320169-231320191 GTGGAAAACACAGGAAAGGAAGG - Intronic
1168897962 20:1336952-1336974 ATGGAAAAACTAGAAAACGAAGG - Intronic
1169166780 20:3430902-3430924 GTGTAGAAAATAGGAAGGAAGGG - Intergenic
1169647646 20:7831761-7831783 GTGGAAAAAGAACCAAAGAAAGG - Intergenic
1169827829 20:9789490-9789512 TTAGAAAAATTAGAAAAGAATGG - Intronic
1173027498 20:39322420-39322442 TTTGAAAAACTAGAAAATAAAGG - Intergenic
1173074831 20:39807804-39807826 ATGGAAAAAGAAGGAAAGAAAGG - Intergenic
1173422103 20:42910433-42910455 GGGGAAAAACTATGTAAGATAGG + Intronic
1174074902 20:47927388-47927410 TTGAAAAAAATAGAAAAGAAAGG + Intergenic
1174672967 20:52325012-52325034 GAGGAAAAAGTAAGAGAGAAGGG - Intergenic
1174833145 20:53832288-53832310 GAGGAAAAAATATGCAAGAATGG - Intergenic
1175493750 20:59397847-59397869 GTGGAATAACGAGGAATGAAGGG - Intergenic
1175706089 20:61178230-61178252 TTGCAAAAATTATGAAAGAAGGG + Intergenic
1176291145 21:5045394-5045416 GGGGAGAAAGGAGGAAAGAAAGG - Intergenic
1176349119 21:5776229-5776251 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
1176355933 21:5896813-5896835 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
1176543440 21:8174299-8174321 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
1176562391 21:8357344-8357366 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
1176676611 21:9784483-9784505 GTGGAAAATCTAGAAAAGTCTGG + Intergenic
1176888585 21:14286227-14286249 GTAGAAAAACTAGCCAGGAATGG + Intergenic
1177199296 21:17935722-17935744 GGAGAATAATTAGGAAAGAAAGG + Intronic
1177343329 21:19834624-19834646 GAGGAAAAAAGAGGAAAGGAAGG - Intergenic
1177959854 21:27649874-27649896 CTGGACAAACTTGGAAAGACAGG + Intergenic
1178473686 21:32917854-32917876 GAGGAGATACTAGGAATGAAAGG + Intergenic
1179866110 21:44218247-44218269 GGGGAGAAAGGAGGAAAGAAAGG + Intergenic
1179958868 21:44757269-44757291 TTGGAGAAATTAGAAAAGAAAGG - Intergenic
1180867968 22:19130269-19130291 GCAGACAAACTAGGAAAGAAGGG + Exonic
1181784793 22:25219277-25219299 GGGGAAGAACAAGTAAAGAAGGG - Intergenic
1183643036 22:39103893-39103915 ATGGAAAAAGGAGGAAAGGAAGG - Exonic
1183840782 22:40499074-40499096 GTAGAAAAAAAGGGAAAGAAAGG + Intronic
1203248307 22_KI270733v1_random:90518-90540 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
949351467 3:3127904-3127926 GCAGATAAACTAGGAAAGAAAGG + Intronic
949440869 3:4078823-4078845 GTGAAAAAACTGGGACAGAGAGG + Intronic
950616928 3:14167266-14167288 GTGAAAAATCTGGGAATGAAGGG + Intronic
950768473 3:15291906-15291928 GGGGAAGAAGTAGAAAAGAAAGG + Intronic
951134000 3:19082013-19082035 GTGGAAATACTAGAAGAAAAAGG + Intergenic
951582065 3:24175276-24175298 CTGGAAATACTATGCAAGAAAGG - Intronic
951622020 3:24612847-24612869 GTGGTACAAATAGTAAAGAATGG + Intergenic
952702397 3:36341003-36341025 CTGGCAAAGCAAGGAAAGAATGG + Intergenic
952842476 3:37659783-37659805 GAGGAAAAACTAGCACAAAAAGG - Intronic
955942626 3:64160569-64160591 TTGGAAAAACAGGGAAACAAAGG + Intronic
956063053 3:65368159-65368181 GTGGAAAAAATATAAAAGAAGGG + Intronic
956492059 3:69783370-69783392 GTTGAACAAATAGAAAAGAAAGG + Intronic
956579941 3:70799186-70799208 GTGAAATAATTAGGAATGAATGG + Intergenic
956780543 3:72599780-72599802 AAGGAAACACTGGGAAAGAAAGG - Intergenic
956995064 3:74817711-74817733 CAGGAAAGAATAGGAAAGAAAGG - Intergenic
957001026 3:74884946-74884968 GTGGAGAAATTGGGGAAGAAGGG - Intergenic
957217359 3:77337774-77337796 TTGCAAAAATTAGGGAAGAAAGG + Intronic
958099443 3:88989600-88989622 GTGGAAAAGGGAGGAAAGAGTGG + Intergenic
958772662 3:98444331-98444353 GCAGACAAACTAGGAAAGATGGG - Intergenic
958878744 3:99645386-99645408 TTGGAAGAATGAGGAAAGAAAGG + Intronic
960067379 3:113387962-113387984 GTGGAAAAGGGAGGGAAGAATGG + Intronic
960085478 3:113585941-113585963 GTGAAACAACTACAAAAGAATGG + Intronic
960531746 3:118773066-118773088 GTGGGAAAACAAGAAAACAAAGG + Intergenic
960820991 3:121731316-121731338 GTGAAACTACTATGAAAGAAGGG - Intronic
960855596 3:122099083-122099105 GGAGAAAAACCAGGAAAGTATGG + Intronic
962612618 3:137092608-137092630 GAAGTAAAACCAGGAAAGAATGG - Intergenic
962655374 3:137538799-137538821 CTGGAAAACCTAGAAAAAAATGG - Intergenic
963259461 3:143177834-143177856 GAGGAAAAAGTTGGAAAAAAGGG - Intergenic
963305106 3:143642890-143642912 GGGGAAAAATTAGAAAAGAATGG - Intronic
963325092 3:143853426-143853448 TTGTAAAAACTAACAAAGAAAGG + Intergenic
963995994 3:151709343-151709365 GTGGAAAGAATAGGGAAGAATGG + Intergenic
964239548 3:154575042-154575064 TTGGAAAAAGGAGGAAAGAGTGG + Intergenic
964754381 3:160080651-160080673 GGAGAAAATCTAGGTAAGAAAGG - Intergenic
965177421 3:165353357-165353379 GTGGAAGAATTAGAAAGGAATGG - Intergenic
966007630 3:175035636-175035658 GTGAAAAAACTGGAAAAGACTGG + Intronic
967333266 3:188314073-188314095 GTTGTAAAAATTGGAAAGAAAGG - Intronic
968027059 3:195451336-195451358 GTGGAAAGACTTGGAAACAGTGG - Intergenic
969651566 4:8471224-8471246 GGGGAAAAAGAAGGAAAGAACGG - Intronic
970100606 4:12517117-12517139 GTGGACAGACTAGGTAAGCAAGG + Intergenic
970115616 4:12691826-12691848 GTTTAAAAACTTGGAAAAAATGG - Intergenic
970599179 4:17627436-17627458 GAGGAGAAAAGAGGAAAGAAGGG - Exonic
970618748 4:17795190-17795212 GCGGAAAGACTATGAAAGCAAGG - Intergenic
971092920 4:23365721-23365743 GTAGAAAATGTAGAAAAGAATGG - Intergenic
971420515 4:26469947-26469969 GTGGAAATACTATAAAATAATGG + Intergenic
971613618 4:28758776-28758798 GTGGAAAAATCAGGAAACAGTGG + Intergenic
971644406 4:29179348-29179370 GTGTAAAAACTAGGATGGAGAGG + Intergenic
971861014 4:32105640-32105662 GTTAAAAAAATAAGAAAGAAAGG - Intergenic
972193258 4:36620750-36620772 ATGAAAAAACAAGTAAAGAATGG + Intergenic
972608833 4:40638345-40638367 GAGGAAAAAGAAAGAAAGAAAGG + Intergenic
973066112 4:45795363-45795385 GCAGACAAACTAGGAAAGAAGGG + Intergenic
973186544 4:47336593-47336615 GGAGAAAACCTAGGAGAGAAGGG + Intronic
973816238 4:54621981-54622003 GTAGGAAAAGTAGGAAAGAATGG - Intergenic
973936448 4:55851469-55851491 GTGGACAAGCTGGCAAAGAAAGG + Intergenic
974092097 4:57322117-57322139 GTGGAAAAGCTGGCCAAGAAAGG - Intergenic
974553795 4:63416708-63416730 GTGAAAAAACAAGCACAGAATGG - Intergenic
974842628 4:67315870-67315892 GTGGATAAAGCAGGAAAAAATGG - Intergenic
975832405 4:78383515-78383537 GTGGACAGACTAGGGAAGGATGG - Intronic
976227202 4:82804876-82804898 ATGGAAAGGCCAGGAAAGAAGGG + Intergenic
976750578 4:88448178-88448200 GCAGACAAACTAGGAAAGAATGG - Intergenic
977120766 4:93098027-93098049 ATGGAAAAACTAGAATAGCAAGG - Intronic
977170151 4:93751862-93751884 GTGGAAAGCCTAGGAAAATAAGG - Intronic
977278203 4:95005622-95005644 AAAGAAAAACTAGGAAAGAAAGG - Intronic
977285626 4:95102677-95102699 GTGGACAAACTTGGAACAAATGG + Intronic
978342476 4:107733412-107733434 GCAGACAAACTTGGAAAGAAGGG - Intergenic
978343503 4:107741460-107741482 GCAGACAAACTAGGGAAGAATGG - Intergenic
979016783 4:115444530-115444552 ATGAAAAAATTATGAAAGAAAGG - Intergenic
979731443 4:124027941-124027963 GTGGAAGAAGGAAGAAAGAAAGG + Intergenic
979838916 4:125412117-125412139 GTTGAAAAAATAGAAAAAAATGG + Intronic
980327671 4:131369231-131369253 GTGGAAAAAACTGGAAAGGAAGG + Intergenic
980431144 4:132697973-132697995 CTCAAAAAACTAGGAAAGAAAGG + Intergenic
980580895 4:134748751-134748773 CTGGAAAACCTAGAAAAAAACGG + Intergenic
980777501 4:137455144-137455166 ATGGAAAAAGGAGGAAATAAAGG + Intergenic
981518292 4:145634289-145634311 TTGGAAAAGGGAGGAAAGAATGG - Intronic
981874224 4:149521266-149521288 GAACAAAAACAAGGAAAGAAAGG + Intergenic
982637902 4:157919979-157920001 TTGGGAAAAGTAGGAAATAAAGG - Intergenic
982968643 4:161949569-161949591 GTTCAAAAAGGAGGAAAGAAAGG - Intronic
983040725 4:162922488-162922510 CAGTAAAAACTAGGAGAGAATGG + Intergenic
984039195 4:174707920-174707942 GTGGACAGACTAGAAGAGAATGG + Intronic
984481849 4:180314291-180314313 GAGGAAAGACTAGGAAATTATGG - Intergenic
985097686 4:186429130-186429152 GCAGACAAACTAGGAAAGAAGGG - Intronic
985398927 4:189574285-189574307 GTGGAAAATCTAGAAAAGTCCGG - Intergenic
986334630 5:6744782-6744804 GTCCAAAAACTATGGAAGAAAGG - Intronic
986432758 5:7698012-7698034 GGGGAAAAAATGAGAAAGAAGGG - Intronic
987525678 5:19046208-19046230 CTGGAAAACGTAGGTAAGAAAGG - Intergenic
987546660 5:19319273-19319295 ATGTAAAGACTAGTAAAGAAGGG - Intergenic
987761534 5:22169131-22169153 GAGGCAAAAATAGGACAGAAAGG - Intronic
989128987 5:38085384-38085406 TTGGAAAAACTAAGAAAACATGG - Intergenic
990410053 5:55533507-55533529 GTGGAATAACTAGGAACTACTGG + Intronic
990698542 5:58450410-58450432 AGAGAAAAACTAAGAAAGAAAGG + Intergenic
990858781 5:60302422-60302444 TTGGAAAAACTAGAAAAAATGGG - Intronic
991154882 5:63421421-63421443 GTGCACAAATTAGGAAAAAATGG - Intergenic
991439410 5:66631030-66631052 GTGGAAAAACTATAAAAATAAGG - Intronic
991896323 5:71402598-71402620 GAGGCAAAAATAGGACAGAAAGG - Intergenic
992029514 5:72707814-72707836 CTGTAAATACTAGGAAATAATGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992761201 5:79952212-79952234 GTGGAAGGAATAAGAAAGAATGG - Intergenic
993091819 5:83435496-83435518 ATGGAAAAACTAAGAACCAAAGG - Intergenic
993115762 5:83718581-83718603 TTGGAAGAAGTAGGAAAGGATGG - Intronic
993539439 5:89130347-89130369 ATGGAAAACTTAGGAAAGCAAGG - Intergenic
993899471 5:93574575-93574597 GTGGAAAGAAAAGAAAAGAAAGG + Intergenic
994633883 5:102320438-102320460 TTGGAAAAAGGAGGGAAGAATGG - Intergenic
994661264 5:102656976-102656998 GTGGAGAAGCTATGAAAGAGTGG + Intergenic
994974163 5:106780383-106780405 GTGGTAAAAGAAGGGAAGAATGG + Intergenic
996091783 5:119358561-119358583 ATAGAATAAATAGGAAAGAAGGG + Intronic
996151254 5:120037960-120037982 CTGGAAAAACTAGAAAAAAATGG + Intergenic
996270907 5:121603190-121603212 GAGGAAAAACCAGCAAAAAAAGG + Intergenic
996341796 5:122446672-122446694 TTGGCAAAACTAGAAATGAATGG + Intronic
996541460 5:124633738-124633760 GTGGAAAACCTGGAAAAAAATGG - Intergenic
996597107 5:125217740-125217762 GTTAACAAACTAGGAATGAAAGG + Intergenic
997021766 5:130010862-130010884 GTAGAAAACCTAGGAAAAAATGG + Intronic
997935042 5:138103072-138103094 GAGGAAAAACTAGAAGAGAGTGG + Intergenic
998160843 5:139812226-139812248 GAAGAAAAAGTAGGAAAAAAGGG + Intronic
998742350 5:145218520-145218542 GTGAAAAAGGTAGGAAAGGAAGG - Intergenic
999075849 5:148794608-148794630 GTGCAAAGACTATGAAATAAAGG + Intergenic
999803381 5:155058669-155058691 GGAGAAAAATCAGGAAAGAATGG - Intergenic
1000020079 5:157311067-157311089 GTGGAAAGAGAAGGAGAGAAGGG + Intronic
1000696196 5:164387262-164387284 GAGGAAAAGAAAGGAAAGAAAGG + Intergenic
1000858533 5:166429724-166429746 GTGGAAAAGCCAGAAAACAAGGG - Intergenic
1002005711 5:176232628-176232650 GAAGAAGAACTAGGAAAGAGAGG + Intergenic
1002220668 5:177677996-177678018 GAGGAAGAACTAGGAAAGAGAGG - Intergenic
1004732358 6:18370243-18370265 GTGGAAAAGGTAGGGAAGAATGG + Intergenic
1005082120 6:21966563-21966585 GTGGAAGAAAAAGGAAAAAAGGG - Intergenic
1005150412 6:22742323-22742345 GTTGAAGATGTAGGAAAGAATGG - Intergenic
1005459943 6:26058505-26058527 GTCGAAAAAAAAAGAAAGAAAGG + Intergenic
1005702064 6:28412071-28412093 GTTGAAAAAGGAAGAAAGAAAGG + Intergenic
1005869888 6:29967017-29967039 GAGGAAAAGCTAGGCAAGATAGG + Intergenic
1006178668 6:32139945-32139967 GCAGACAAACTAGGAAAGAAGGG + Intergenic
1006923584 6:37641685-37641707 GTGCTAAAATTAGGAAAGATGGG + Intronic
1007018831 6:38498213-38498235 GTGGAAAAACTGGGATAGGTTGG - Intronic
1007349341 6:41257463-41257485 GCAGGCAAACTAGGAAAGAAGGG - Intergenic
1007515471 6:42407132-42407154 GTGGAAAAAGCAGGAAGGAAAGG - Intronic
1007529713 6:42531055-42531077 ATGGAAAAATTAGCAAATAAAGG + Intergenic
1007826148 6:44602339-44602361 TTGGGGAAAGTAGGAAAGAAAGG + Intergenic
1008162990 6:48101766-48101788 GTGGACAAACAACAAAAGAAAGG + Intergenic
1008495168 6:52125564-52125586 GGGGAAAAAAAAGGAGAGAAAGG + Intergenic
1008593628 6:53018797-53018819 AGGGAAAAACTAAGAGAGAAAGG + Intronic
1008937535 6:57007884-57007906 GCAGACAAACTAGGAAAGAAGGG + Intronic
1009646919 6:66416175-66416197 GTGGAAAGAATATGAAAAAAAGG + Intergenic
1010404193 6:75484074-75484096 GTGGAAAAAGAAGTAAAGCAAGG - Intronic
1010835361 6:80580818-80580840 GTAGAAACACTTGGAAATAAAGG + Intergenic
1011744373 6:90395590-90395612 GATGAAAAACTAGAATAGAAAGG - Intergenic
1012145950 6:95681916-95681938 GCAGACAAACTAGGAAAGAAGGG + Intergenic
1012646321 6:101686874-101686896 TTGCATAAACTATGAAAGAAGGG + Intronic
1012988323 6:105898625-105898647 GTGGGAAAACTTGGAATTAAAGG + Intergenic
1013189660 6:107791459-107791481 CTGAGAAACCTAGGAAAGAAGGG + Intronic
1013317721 6:108957946-108957968 GTGGAAAGAGTAGGATAGTAGGG + Intronic
1013369898 6:109459547-109459569 GAAGGAAAAATAGGAAAGAATGG - Intergenic
1013584663 6:111567458-111567480 GTGCAAAGACTTGGAAAGGAAGG - Intronic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1014692481 6:124578489-124578511 GTGGAAAAGAGAGGAAAGAGTGG + Intronic
1014862317 6:126484931-126484953 GTGGAAGAAATAGGCAAGAGTGG + Intergenic
1014942201 6:127455812-127455834 GTGGGAAAGATAGCAAAGAAAGG - Intronic
1014959554 6:127666540-127666562 AGGGAAAAAGTAGAAAAGAAAGG - Intergenic
1014990729 6:128072718-128072740 GTAGAAAAACTAGACAAGAAAGG - Intronic
1015439378 6:133230996-133231018 GTGAAAAGACAAAGAAAGAATGG + Intergenic
1015649597 6:135440927-135440949 ATGGAAAAAACAGGAAAGAGTGG + Intronic
1015706127 6:136089630-136089652 GTTGAAAAACAAGAAATGAATGG + Intronic
1015803342 6:137083088-137083110 GTGGAGAAGGAAGGAAAGAAGGG - Intergenic
1016091489 6:139984661-139984683 ATGGCAAATATAGGAAAGAATGG - Intergenic
1016463565 6:144303728-144303750 TTTGAAAAAGTAGCAAAGAAAGG + Intronic
1017060925 6:150484261-150484283 GGGGAAAAACTAGGAGAGTTTGG - Intergenic
1017156583 6:151327897-151327919 GTGGAAAAAGTAAAAATGAAAGG + Intronic
1017518439 6:155179843-155179865 GGGGAAGAAAGAGGAAAGAAGGG - Intronic
1017607116 6:156146358-156146380 GAGGAAAAAAGAGGACAGAATGG - Intergenic
1017778295 6:157696666-157696688 GTAGACAGACTGGGAAAGAAAGG - Intergenic
1017782525 6:157727201-157727223 GCAGACAAACTAGGAAAGAAGGG + Intronic
1018297890 6:162368658-162368680 ATAGAACATCTAGGAAAGAAAGG + Intronic
1018503001 6:164432895-164432917 GTGCAAAACCAAAGAAAGAAAGG + Intergenic
1019585677 7:1801618-1801640 CTGGAAAAACTTGGAAAGTCTGG + Intergenic
1020583774 7:10038690-10038712 TTTGAAAAAATAGGAAACAAGGG - Intergenic
1020726767 7:11825149-11825171 GGGGAATAACTGGTAAAGAATGG + Intronic
1021025597 7:15662693-15662715 GTGGAAAAACTTTGAAGGAATGG - Intronic
1021123303 7:16821349-16821371 GTGGAAAAACTTAGGAGGAAAGG + Intronic
1021975786 7:26009939-26009961 TTGGAAAAAATAGAAAACAAAGG + Intergenic
1021997193 7:26191195-26191217 GTGGGAAAAGAAGGAAAAAAAGG + Exonic
1022013105 7:26326190-26326212 GTAGAAAAACTAAAAAAGCAAGG - Intronic
1022844470 7:34196132-34196154 GTAGAAAAACTAGAAAATATAGG - Intergenic
1022999827 7:35797298-35797320 GGAGAAAAACTAGGAAAGTGTGG + Intergenic
1023482271 7:40646622-40646644 GTGCAAAGACTGGGAAAGACTGG - Intronic
1023541006 7:41265753-41265775 ATGGAAAAGCCAAGAAAGAATGG + Intergenic
1024007683 7:45239400-45239422 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1024402679 7:48943526-48943548 GCAGACAAACTGGGAAAGAAAGG + Intergenic
1027835316 7:83234393-83234415 GTGGTAGAAATAGGAAAGAAGGG - Intergenic
1028443772 7:90895301-90895323 GAGGAAAGAAGAGGAAAGAATGG - Intronic
1028450611 7:90977962-90977984 GGGGACAAACTAGGAAAAATAGG + Intronic
1028841520 7:95434666-95434688 GTGAAAAAACTAGCAAAGTTTGG - Intronic
1029180769 7:98700108-98700130 GAAGAAAAAGAAGGAAAGAAAGG + Intergenic
1030159661 7:106493926-106493948 GAGGAAAAACTAGCACAAAAAGG + Intergenic
1030239621 7:107307302-107307324 GTAGAAAATACAGGAAAGAATGG - Intronic
1030402455 7:109069239-109069261 GAGGAAAAAAAGGGAAAGAAAGG - Intergenic
1030480187 7:110093590-110093612 ATGGAAAAAAAAAGAAAGAAGGG + Intergenic
1030906144 7:115185121-115185143 TCCAAAAAACTAGGAAAGAATGG - Intergenic
1031005474 7:116465962-116465984 GTGGAAAAAGAAGATAAGAAAGG - Intronic
1031714195 7:125086825-125086847 TTTGAAGAAATAGGAAAGAAGGG + Intergenic
1031905882 7:127458992-127459014 GTGGAAAGAGGAGGAAAGAGTGG + Intergenic
1032235761 7:130121099-130121121 GTGAAAAAAAAAGAAAAGAAAGG - Intronic
1033034334 7:137859284-137859306 GTGGAAAACCTCTGAAAGAAGGG + Intergenic
1033935132 7:146574958-146574980 GGGGAAAAAGGAAGAAAGAAAGG - Intronic
1035066247 7:156107222-156107244 GAAGAAAAGGTAGGAAAGAAGGG + Intergenic
1035139385 7:156742498-156742520 CTGGAAAATCTAGAAAAAAATGG + Intronic
1035958662 8:4112450-4112472 GTGGAAGAACCAGGGGAGAATGG - Intronic
1036777982 8:11626678-11626700 CTGGAAAACCTGGGAAAGAGTGG - Intergenic
1037147424 8:15589901-15589923 GAGGATAGAGTAGGAAAGAACGG + Intronic
1038039444 8:23711431-23711453 GTGTACCAACTAGGAAAGAAAGG - Intergenic
1038194754 8:25357061-25357083 GTAGAAAAATGAGTAAAGAATGG + Intronic
1038412625 8:27369819-27369841 ATAGAAAAACTAGCAAAGCATGG + Intronic
1038803041 8:30766382-30766404 GCAGACCAACTAGGAAAGAAGGG + Exonic
1039056313 8:33539964-33539986 GTGAAAAAAAGAGGAAAGAAAGG + Intergenic
1039237435 8:35517300-35517322 GTGGAAAAACTAGAAAGGGTAGG + Intronic
1039320588 8:36426091-36426113 GTGGAAAAAAGAGGAAAAGAGGG - Intergenic
1039525427 8:38210464-38210486 CTGGAAAAATTAGAAAAAAAAGG + Exonic
1039848776 8:41344606-41344628 ATGGAAAAAGAGGGAAAGAAAGG - Intergenic
1040624334 8:49129081-49129103 GGGGGACAACTAGGCAAGAAAGG - Intergenic
1040990482 8:53344364-53344386 ACAGACAAACTAGGAAAGAAAGG + Intergenic
1041267494 8:56079171-56079193 CTGCAAAAATTAGTAAAGAAAGG - Intergenic
1041364769 8:57090591-57090613 TTGGAGGAACTAGTAAAGAAAGG + Intergenic
1041644863 8:60240943-60240965 CTGGAAAAAGAAGGAAAAAAAGG + Intronic
1042263080 8:66879967-66879989 GTTGTAAAGCTATGAAAGAAAGG - Intronic
1043190136 8:77210257-77210279 TGTGAAAAACAAGGAAAGAATGG + Intergenic
1044789110 8:95828263-95828285 GTAGAAAAATTAAGAAATAAAGG + Intergenic
1046534492 8:115491618-115491640 GTAGAAAAGAAAGGAAAGAAAGG + Intronic
1046608207 8:116394123-116394145 CTGGAAAACCTAGAAAAAAAAGG + Intergenic
1046843999 8:118895109-118895131 GTATAAAAATTAGGAAAAAAAGG - Intergenic
1046864919 8:119136740-119136762 GTGGAAAAAATAGAAAACTAAGG + Intergenic
1047562706 8:126007118-126007140 GAGGAGGAAGTAGGAAAGAAAGG + Intergenic
1047662812 8:127056489-127056511 GTGGTAAAACTATGAAAAGAAGG - Intergenic
1048910974 8:139134776-139134798 GTGGCAAAACTAGCAGTGAAGGG + Intergenic
1049958426 9:714323-714345 GTGGTCAAACTTGGAGAGAAGGG + Intronic
1050016283 9:1237454-1237476 GTAGAAAAACCAGTAAGGAAAGG + Intergenic
1050201096 9:3146995-3147017 GAGGAAAAACTAGCACAAAAAGG - Intergenic
1050282221 9:4062342-4062364 GTGGAAAGAAAAGGAAAGAAGGG + Intronic
1050580386 9:7048499-7048521 GTGAAAAAAGTAGGAAACTAGGG + Intronic
1050714251 9:8503685-8503707 GTGGACAAATTAAGAAACAATGG - Intronic
1051095288 9:13459204-13459226 TTGCAAATACTAGGAAAGAAAGG - Intergenic
1051162399 9:14222863-14222885 GTCCAAAGAGTAGGAAAGAAGGG - Intronic
1051595136 9:18817713-18817735 AGGGAAATACTAGGACAGAAAGG + Intronic
1052013827 9:23442673-23442695 GGGGAAAAAAAAGGAAGGAAGGG + Intergenic
1052751051 9:32491110-32491132 GTGGAAGAACTAGGAGAGAATGG + Intronic
1055158793 9:73098185-73098207 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1055268606 9:74529237-74529259 ATAGAAAAATTAGGGAAGAAAGG + Intronic
1055359382 9:75473117-75473139 GTGGAACAAATAAGCAAGAAAGG - Intergenic
1056861292 9:90185333-90185355 GTACAAAAACTAGCACAGAATGG - Intergenic
1057052153 9:91933662-91933684 GTATAAAAACAAAGAAAGAATGG + Intronic
1057917856 9:99071506-99071528 GAGGAAAAACAAAGAAAAAAAGG + Intergenic
1057930389 9:99188443-99188465 GTGGAAGAAGTTGGAGAGAATGG - Intergenic
1058156453 9:101521465-101521487 CTGGAAAACCTAGAAAAGATGGG - Intronic
1058176226 9:101738581-101738603 GTGGAAAAATAACGAAAGAAAGG - Intergenic
1058397134 9:104567419-104567441 GTGAATAAACAAGTAAAGAATGG + Intergenic
1058427949 9:104892016-104892038 GTGGAAAATTTAGAAAAGACAGG - Intronic
1058510208 9:105710205-105710227 GTGGAAAAAGAACCAAAGAAGGG - Intronic
1059803488 9:117773992-117774014 ATGGAAAAAAAAGGAAGGAAAGG - Intergenic
1059894966 9:118853145-118853167 GAAGAAAAACTGGGAAAAAATGG + Intergenic
1059934919 9:119300138-119300160 GTTGAAATAGGAGGAAAGAAGGG - Intronic
1060006331 9:120003321-120003343 GGGGAAGGACCAGGAAAGAAAGG - Intergenic
1060370478 9:123065323-123065345 GTGGAAACATAAGGAAAGAGAGG - Intronic
1060854219 9:126901969-126901991 GTAGACAAACTAAGAAAGAAGGG + Intergenic
1203719111 Un_GL000216v2:256-278 TTGAAAAAACTAGTAAGGAATGG - Intergenic
1203464710 Un_GL000220v1:73769-73791 GTGGAAAACCTAAAAAAGCAAGG + Intergenic
1203669934 Un_KI270755v1:713-735 GTGGAAGAAGGAGGAAAGAATGG - Intergenic
1185829902 X:3291135-3291157 GTGGAAAATATAAGAAAGCACGG + Intergenic
1187041696 X:15603226-15603248 GTAGAAAAACTAGCCCAGAATGG + Intergenic
1187114055 X:16331339-16331361 GTGGAAAAAAAGGGAAGGAAAGG - Intergenic
1187672000 X:21677182-21677204 CTGGAAAAAGGAGGAAAGAGAGG - Intergenic
1187680940 X:21767419-21767441 CAGGAAAAACCAGGAAACAAGGG + Intergenic
1188780082 X:34271532-34271554 CTGGAAAAAGTTGGAGAGAATGG - Intergenic
1189110783 X:38286655-38286677 GAGGAAAAAGGAGGAAAGAGCGG - Exonic
1189233368 X:39469459-39469481 GGGGAAAATTTAGGAAAGAAAGG + Intergenic
1189506213 X:41613823-41613845 GTAGAAAAACTTGGAAAGTATGG - Intronic
1190093779 X:47462737-47462759 GAAGAAAAAGAAGGAAAGAATGG - Intronic
1190571574 X:51787651-51787673 GAAGAAAAACTAGTAAAGAAAGG - Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1190944688 X:55080163-55080185 TTGGAAAATCTAGAAAAAAATGG - Intergenic
1191083459 X:56538303-56538325 TTGGAAAAAGGAGGAAAGAGTGG + Intergenic
1192025215 X:67443007-67443029 GTGAGGAAAATAGGAAAGAAAGG - Intergenic
1192188726 X:68977717-68977739 ATGGAAAAACAAGGTAACAAAGG - Intergenic
1192260083 X:69500909-69500931 GGGGAAAAAGATGGAAAGAAGGG - Intergenic
1192391637 X:70734806-70734828 CTCAAAAAACTAGGAATGAAGGG + Intronic
1192557008 X:72098254-72098276 TTGGAAAGAATAGGACAGAAAGG + Intergenic
1192826669 X:74704448-74704470 GTGGAAAAAGAAGAAAAGAGTGG - Intergenic
1192887534 X:75351196-75351218 CTAGAAAATCTAGGAAAAAATGG - Intergenic
1192968770 X:76208304-76208326 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1193185343 X:78505715-78505737 TTGGAAAATCTAGAAAAAAATGG + Intergenic
1193389285 X:80907147-80907169 GAGGAAAAACTAGCACAAAAAGG + Intergenic
1193554430 X:82934799-82934821 GTTGAAAAGAAAGGAAAGAAAGG + Intergenic
1194398508 X:93414746-93414768 GTGGAAAGTCGAGGAAAGAGTGG + Intergenic
1194502442 X:94698312-94698334 GTAGACAAATTGGGAAAGAAAGG - Intergenic
1194784607 X:98066592-98066614 GTAGAATCACTAGGTAAGAATGG - Intergenic
1194785304 X:98076650-98076672 GTGGAATAACATGGGAAGAAAGG - Intergenic
1195666825 X:107439300-107439322 CTGGAAACCCTAGGTAAGAAAGG + Intergenic
1195843413 X:109199600-109199622 CTTAAAAAACGAGGAAAGAAAGG - Intergenic
1195937765 X:110141863-110141885 GTGGAAAAAGAAGGAGAGAAAGG - Intronic
1196253725 X:113491797-113491819 TTTGAAAACCTAGGAAAGAAAGG + Intergenic
1196910928 X:120483549-120483571 GAAGAGAAACTTGGAAAGAATGG - Intergenic
1197032603 X:121835627-121835649 CTGGAAAGAGTAGGAAGGAAAGG + Intergenic
1197332045 X:125165207-125165229 GAGGAGAAAGCAGGAAAGAACGG + Intergenic
1197398084 X:125952490-125952512 CTGGAAAAACAAGGAGAAAAAGG - Intergenic
1197789191 X:130234228-130234250 GTGGAAACAATAAGAAAGCAAGG + Intronic
1199156190 X:144551441-144551463 TTGGAAAGAGTAGGAAAGAGTGG + Intergenic
1199288383 X:146078615-146078637 GTGGAGAAAGGGGGAAAGAAGGG + Intergenic
1200558920 Y:4674423-4674445 GTTGAAAAAGTGGGAAAGATAGG + Intergenic
1201798918 Y:17932713-17932735 AAAGAAAAATTAGGAAAGAAAGG - Intergenic
1201802635 Y:17973244-17973266 AAAGAAAAATTAGGAAAGAAAGG + Intergenic
1201910770 Y:19131479-19131501 TTGGCAAAACTGGGAAGGAATGG + Intergenic
1201926409 Y:19292812-19292834 GAGGAAATATTAGGAGAGAAGGG - Intergenic
1202360220 Y:24101326-24101348 ACAGAAAAATTAGGAAAGAAAGG - Intergenic
1202510557 Y:25568788-25568810 ACAGAAAAATTAGGAAAGAAAGG + Intergenic