ID: 931485672

View in Genome Browser
Species Human (GRCh38)
Location 2:62688932-62688954
Sequence CTTTGCTTCATGAAGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931485672 Original CRISPR CTTTGCTTCATGAAGGGTCC TGG Intronic
900569324 1:3350641-3350663 CTTGGCTCCATGCAGGGCCCTGG + Intronic
902321418 1:15669862-15669884 CTTTGCCCCATGTAGGTTCCAGG + Intergenic
903797397 1:25940128-25940150 CTTGTTTACATGAAGGGTCCAGG + Intergenic
907761735 1:57368044-57368066 CTTTGCTTCAAGATGGGAGCAGG - Intronic
908577772 1:65479068-65479090 CTTTGCTTCATGAATCCTCTGGG - Intronic
910010389 1:82453910-82453932 CCTTCATTCCTGAAGGGTCCAGG - Intergenic
910565463 1:88638150-88638172 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
912040476 1:105383639-105383661 CTATGATTCATGAAGGGTGAGGG + Intergenic
917825138 1:178812026-178812048 CTCTCCATCATGAAGGGTCAAGG + Intronic
918259061 1:182777568-182777590 CTTTGGTGCATGCAGGGTCAAGG - Intergenic
918755461 1:188335907-188335929 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
918917978 1:190669971-190669993 CCTTCCTTCACGAAGGGTCTAGG + Intergenic
922502041 1:226104444-226104466 CTTTGCTTCTTGTATGCTCCAGG - Intergenic
923437267 1:233979197-233979219 CTGTGCTTCAGGAAGGTACCTGG + Intronic
924840510 1:247705918-247705940 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
1064900491 10:20290791-20290813 ACTTGCTTCATGAAAGCTCCTGG - Intergenic
1070891017 10:79942270-79942292 CTTTGCAGCATCAAGGGTCTGGG + Intronic
1071308767 10:84323990-84324012 CCTTCATTCATGAAGGGTCTGGG - Intergenic
1071555501 10:86598397-86598419 CTTTGCTTTAGTCAGGGTCCTGG + Intergenic
1074052009 10:109888534-109888556 GTGTGCTTCCTGAAGGATCCAGG - Exonic
1074128183 10:110547079-110547101 CTTTGCATGATGAAGAGTCCTGG - Intergenic
1074309439 10:112309406-112309428 ATTTGCTTAATGAAAAGTCCTGG - Intergenic
1075172600 10:120129610-120129632 CTGTGCTTCATAAAATGTCCAGG - Intergenic
1075462978 10:122631063-122631085 CTCAGCTTCCTGAATGGTCCAGG - Exonic
1078013859 11:7595386-7595408 ATTTCAATCATGAAGGGTCCTGG - Intronic
1078662165 11:13296343-13296365 CTTTGCCTCCTGAAGGGGTCTGG + Intronic
1080042000 11:27768914-27768936 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
1083624409 11:64064749-64064771 CTTTGCTGGATGGTGGGTCCAGG - Intronic
1084530093 11:69722075-69722097 CTCTGCGAGATGAAGGGTCCAGG + Intergenic
1085375249 11:76054492-76054514 GTTTACATCATGCAGGGTCCTGG - Intronic
1086869495 11:92019258-92019280 CTTTGTGTCAAGAAGGGACCTGG - Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088739361 11:112754321-112754343 CTTTGCTTCCTGAAAGGTGAAGG - Intergenic
1089303993 11:117515546-117515568 CTTTGTTTCATGCCTGGTCCTGG - Intronic
1089317542 11:117602248-117602270 CTTTGCTCCACGACGGGCCCTGG + Intronic
1091879341 12:3964321-3964343 TCTTGCTTCATGAAGCTTCCTGG - Intergenic
1093184510 12:16004314-16004336 TTTTGCTTTATGTAGGGTCTGGG - Intronic
1097843083 12:64340866-64340888 CCTTCATTCATGAAGGGTCTGGG + Intronic
1099840975 12:87966808-87966830 CTTTGCTTCATCCAGGTACCTGG + Intergenic
1101816080 12:108147231-108147253 CTTTGCTTGAGGAAGCTTCCTGG + Intronic
1101885906 12:108661738-108661760 CTATGGTTCATGGAGGGCCCTGG + Intronic
1102211017 12:111127297-111127319 CTTTCATTCCTGAAGGGTCTGGG + Intronic
1103035894 12:117655954-117655976 CCTTCATTCCTGAAGGGTCCGGG - Intronic
1103132288 12:118479745-118479767 CATGGCTTCAGGAAGGGCCCCGG + Intergenic
1106140629 13:27007967-27007989 CTTTACTTCATCAAGATTCCTGG - Intergenic
1109392564 13:61711205-61711227 CCTTCATTCTTGAAGGGTCCAGG - Intergenic
1110584585 13:77173576-77173598 CTTTCCTTCATGAAGAGTCTAGG - Intronic
1111768292 13:92562656-92562678 CTTTGCTTCATCATAGGTCTGGG + Intronic
1114627042 14:24136599-24136621 CTTTCCCTCAGGGAGGGTCCCGG + Intronic
1120594432 14:86416552-86416574 CCTTCCTTCCTGAAGGGTCTTGG + Intergenic
1121512857 14:94525593-94525615 ATTTGCATCATGAAGTTTCCTGG + Intergenic
1123060343 14:105591583-105591605 TTTTGCTTCCAGAAGGGGCCAGG + Intergenic
1123084820 14:105712554-105712576 TTTTGCTTCCAGAAGGGGCCAGG + Intergenic
1123908207 15:24941493-24941515 CTTTGATTTCTGAAGGGTCTAGG + Intronic
1127605943 15:60588931-60588953 CTCTACTTCATGGAGGGTCCAGG + Intronic
1128549694 15:68590301-68590323 CTTTGCTTTTTGAAGAGCCCTGG + Intronic
1130045847 15:80443908-80443930 TTTTGCTTCATGAAGGGGAGCGG + Intronic
1130953154 15:88607951-88607973 CTTTCCTTTATGAATTGTCCGGG + Intergenic
1133184689 16:4087149-4087171 CCCTGCTTCATGAGGGGTGCAGG - Intronic
1136554918 16:31001935-31001957 CTGGGCTCCATGAAGGGTCCTGG + Intronic
1137504323 16:49039060-49039082 CTTTTCTCCATGAATGGTCTTGG + Intergenic
1137817471 16:51412438-51412460 TTCTCCTTCATGAAGGCTCCAGG + Intergenic
1147447713 17:40484852-40484874 CTTTGCATCAGGCAGGGCCCTGG - Intronic
1148572187 17:48678798-48678820 CTATGCTTCTGGAAGGGTGCAGG - Intergenic
1148653895 17:49269015-49269037 CTTTGCCTCATGCTGGGCCCAGG - Intergenic
1149628325 17:58096727-58096749 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
1151056652 17:71039255-71039277 CTTTTCTTCATCAAGGGTCTTGG + Intergenic
1151444791 17:74156183-74156205 CTCTGCTTCAAGCAGAGTCCAGG + Intergenic
1151717090 17:75836422-75836444 CTTTCCATCTTGCAGGGTCCTGG - Exonic
1152045124 17:77930413-77930435 CTTTGCTTCAGGAAGGAGGCTGG - Intergenic
1156846551 18:41672575-41672597 CTTTGCTTCTTCAATGGTTCTGG + Intergenic
1157607191 18:48933264-48933286 CCTGGCTTCATGGAGGGACCAGG + Intronic
1158004707 18:52659306-52659328 CTTTGCTTTGTGTAGGATCCTGG - Intronic
1160372542 18:78386445-78386467 CTTTAGTTAATGAAGTGTCCCGG + Intergenic
1160422214 18:78754907-78754929 CTCTGCTTCATGATGGGCCTGGG + Intergenic
1160737083 19:667808-667830 CGTTGCTTCATCAAGTGTCGTGG + Intergenic
1161847725 19:6721218-6721240 CTCTGCTTCTTGGAGGGTCAGGG + Intronic
1166195066 19:41200294-41200316 CTTTGCAACATGAAGAGTTCTGG - Intronic
1168618566 19:57858057-57858079 CTTTACATCATGAAGCCTCCTGG + Intronic
926380543 2:12283682-12283704 CTTTCCTTGTTGAAGGGTCTTGG - Intergenic
926827024 2:16915546-16915568 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
927660680 2:24990544-24990566 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
929620896 2:43353042-43353064 ATTTGCTACATGAATGGACCAGG - Intronic
931485672 2:62688932-62688954 CTTTGCTTCATGAAGGGTCCTGG + Intronic
931707952 2:64963480-64963502 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
931858417 2:66328485-66328507 CTTAGCTACGTGAAGGGCCCAGG - Intergenic
935133947 2:100282311-100282333 CTTTACTTCAGGAAGGCTCGTGG + Exonic
940046051 2:149410812-149410834 ATTTGCATTATGAAGGGCCCAGG + Intronic
940471831 2:154111237-154111259 CTTTCATTCTTGAAGGGTCTGGG + Intronic
941387333 2:164869322-164869344 CTCTGCTTCATGGAGAATCCAGG + Intergenic
942322194 2:174745425-174745447 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
947995701 2:234525432-234525454 CTTTGGATCAGGAAGGGTTCAGG + Intergenic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
1169216487 20:3797251-3797273 CCATCCTTCAGGAAGGGTCCTGG + Intronic
1169332183 20:4724717-4724739 CCTTGCTTGATGAAGGCTCCCGG - Exonic
1170418619 20:16170547-16170569 CTTTCCTTAATGAAGGCACCTGG - Intergenic
1170974255 20:21147559-21147581 CTATGCTTCAGGAAAGGCCCTGG - Intronic
1172123254 20:32610788-32610810 CTTTGCTTCATGAGTGAGCCTGG + Intergenic
1173722927 20:45275784-45275806 ATTTGCTTCAGGAAGGCTACAGG - Intergenic
1173912913 20:46683628-46683650 CTCTGCTACAAGAGGGGTCCTGG - Intronic
1175201875 20:57283648-57283670 CTTTGGTTCATGCAGAATCCAGG + Intergenic
1181461318 22:23087614-23087636 CTTTGCTTCCTGAATGCTCCAGG - Intronic
1182080286 22:27524076-27524098 CTTTGGTTTCAGAAGGGTCCGGG - Intergenic
1184655141 22:45937282-45937304 CCTTGCTTCCAGAAGGCTCCAGG - Intronic
953279091 3:41535114-41535136 CTTTGTTTCATGAGGAGTACTGG + Intronic
956147742 3:66208540-66208562 CTCTGCTACAGGGAGGGTCCCGG - Intronic
956692445 3:71890613-71890635 CTTTGCTTCATGAACCCTCTTGG + Intergenic
957975330 3:87436096-87436118 CTTTGCTTTATGAAGCATGCTGG - Intergenic
960964021 3:123092167-123092189 CTGTGCTGCAAGAATGGTCCTGG - Intronic
961916826 3:130384660-130384682 CTGTGCTTAATGAAGTGTGCAGG + Intronic
965958181 3:174396759-174396781 CCTTCATTCATGAAGGGTCTGGG - Intergenic
968630540 4:1648696-1648718 ATTTGCTTCATGTGGGGGCCAGG - Intronic
971304475 4:25467626-25467648 CTTTTCTTTAGGAAGGGGCCTGG + Intergenic
974727524 4:65814732-65814754 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
977205341 4:94159291-94159313 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
984762087 4:183371129-183371151 TTTTGCTTCTAGATGGGTCCCGG - Intergenic
985832578 5:2245202-2245224 CCTTCATTCCTGAAGGGTCCGGG - Intergenic
986422483 5:7598854-7598876 CTCTGCTTAATGAAGGCACCTGG - Intronic
986531148 5:8738454-8738476 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
987122616 5:14781307-14781329 CTTTGACTCCTGAAGGGACCAGG - Intronic
989677895 5:43993777-43993799 ATTTGCTTCATGAGCGGTTCTGG + Intergenic
989796056 5:45474163-45474185 TTTTGCTTCATTAAAGGTCAAGG - Intronic
1000422635 5:161055997-161056019 CTTTCATTCCTGAAGGGTCTGGG + Intergenic
1001429351 5:171647220-171647242 CTGTGCATCAGGCAGGGTCCAGG + Intergenic
1001822580 5:174721385-174721407 GGTTGCTTCAAGAAGGGGCCTGG + Intergenic
1006488864 6:34368408-34368430 CTTTGCTTTATGAGGTCTCCTGG - Intronic
1007208738 6:40173963-40173985 CTTTGCTTCATGAAGCTTTTAGG - Intergenic
1007735545 6:43980154-43980176 CTTTGCTTCATTCTGGCTCCCGG - Intergenic
1009851631 6:69206878-69206900 CTTTCTTTCTTGAAGGGTCTGGG + Intronic
1019578688 7:1749649-1749671 CTGTCCTCCATGAGGGGTCCCGG + Intergenic
1023178796 7:37459900-37459922 CTTGGCTGCATGGAGGGACCAGG - Intergenic
1024329154 7:48139387-48139409 CTGTGCTTCATGTAGGGATCAGG + Intergenic
1025015610 7:55436731-55436753 CTTTTCCTCTTGAAGGATCCTGG - Intronic
1029584704 7:101462918-101462940 CTTTGATGCACGAAGTGTCCCGG - Intronic
1033076519 7:138254901-138254923 CTTTCATTCCTGAAGGGTCTGGG - Intergenic
1033628741 7:143136270-143136292 GTGTCCTTCATGAAGGGTCTGGG - Intronic
1034503395 7:151466627-151466649 CTTGGCTTCAGGAAGGCCCCAGG - Exonic
1035243373 7:157546807-157546829 CCTCACTTCACGAAGGGTCCTGG + Intronic
1036155925 8:6341756-6341778 CTTGGCTTCATGAAGGGAGCTGG - Intergenic
1037287616 8:17318117-17318139 GTTTTCCTCATGCAGGGTCCAGG - Intronic
1038016473 8:23519960-23519982 CTTTGCTACCTGAAGGATCGTGG + Intergenic
1038169073 8:25112342-25112364 CATTGCCTTCTGAAGGGTCCCGG + Intergenic
1041707048 8:60857687-60857709 CACTGCTTGAAGAAGGGTCCAGG - Intronic
1041850982 8:62392544-62392566 CTTTGCATAATGAAGTGGCCAGG - Intronic
1043738676 8:83778761-83778783 CTTTGCATCATGAAGTGACCTGG - Intergenic
1043833789 8:85021701-85021723 CTTTGCTCCATTAAGACTCCTGG - Intergenic
1044632888 8:94296527-94296549 CTTTCGTTCCTGAAGGGTCTGGG + Intergenic
1045045158 8:98267853-98267875 TTTTGCCTCATGTAGGTTCCAGG - Intronic
1045222034 8:100208443-100208465 CTTTCATTCCTGAAGGGTCTGGG - Intronic
1045667636 8:104506696-104506718 CTTGGCTTCAAGCAGGGTGCTGG + Intronic
1046241854 8:111506941-111506963 CTTTGCAGCAGGAAGGGGCCTGG - Intergenic
1047044451 8:121036457-121036479 CATTGCTTAATGAAGGGAGCAGG + Intergenic
1047513874 8:125536771-125536793 CTTTGCCCCATGAGGGGACCAGG - Intergenic
1048305720 8:133283211-133283233 CTTTGGTTCATGCAGGTCCCAGG - Intronic
1050219727 9:3373597-3373619 CTTTTATTCCTGAAGGGGCCAGG - Intronic
1050888524 9:10794882-10794904 CTTTCATTTCTGAAGGGTCCGGG + Intergenic
1056064595 9:82920933-82920955 CTGAGCTTCATGAAGGCACCAGG + Intergenic
1057859825 9:98632160-98632182 CTTTCATTTGTGAAGGGTCCTGG - Intronic
1058954512 9:109932949-109932971 CTTTGCTTCATGAAATATTCAGG - Intronic
1193979135 X:88159294-88159316 CTTTTATTCATGAAGGGTTTGGG - Intergenic
1195782090 X:108478003-108478025 CCTTCCTTCCTGAAGGGTCTGGG + Intronic
1199602773 X:149552462-149552484 ATTTGCTTGATGCTGGGTCCTGG + Intergenic
1199647616 X:149927013-149927035 ATTTGCTTGATGCTGGGTCCTGG - Intergenic
1201792395 Y:17856673-17856695 CTGTTCTTCCTGAAGAGTCCTGG - Intergenic
1201809159 Y:18049313-18049335 CTGTTCTTCCTGAAGAGTCCTGG + Intergenic
1202353932 Y:24025921-24025943 CTGTTCTTCCTGAAGAGTCCTGG - Intergenic
1202516847 Y:25644191-25644213 CTGTTCTTCCTGAAGAGTCCTGG + Intergenic