ID: 931486645

View in Genome Browser
Species Human (GRCh38)
Location 2:62700425-62700447
Sequence CTATGTTGGGGGAAGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931486645 Original CRISPR CTATGTTGGGGGAAGGGGAT GGG Intronic
901161127 1:7177371-7177393 CTGTGTTGGGGGAGAGGCATTGG - Intronic
901362806 1:8717909-8717931 CTAAGTAGGGGGAAAGGGCTTGG + Intronic
901839347 1:11944344-11944366 CAGGGGTGGGGGAAGGGGATGGG - Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
901878750 1:12181703-12181725 CTCCCTGGGGGGAAGGGGATGGG + Intronic
903006477 1:20302238-20302260 CTTTGGTGGGGGCAGGGGGTTGG - Intronic
903143769 1:21356499-21356521 CTCTGTTGGGGGAAAGAGCTTGG - Intergenic
903365181 1:22801732-22801754 ATCTGGAGGGGGAAGGGGATGGG - Intronic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903785905 1:25861339-25861361 CTTTGCTGGGGGATGGGGTTGGG - Exonic
904955472 1:34279992-34280014 CTTTTTTGGGGGATGGGGTTGGG + Intergenic
905068267 1:35202586-35202608 TTGTGTTGGGGGATGGGGAGAGG + Intergenic
905369730 1:37476647-37476669 CTGTGCTGGGGGATGGGGGTGGG - Intronic
905381421 1:37564233-37564255 CTTTGTTGGGGGGTGGGGGTGGG - Intronic
905712962 1:40122896-40122918 CTATGTTGGGAGAAGGCCCTTGG - Intergenic
905893943 1:41533359-41533381 CTGTGGTGGTGGAAGGGGCTAGG - Intronic
906527136 1:46500545-46500567 CTTTTTTGGGGGAGGGGGGTAGG - Intergenic
906745366 1:48217527-48217549 TAATGATGGGGGAAGGGGTTTGG - Intergenic
906836947 1:49094220-49094242 CTTTGGTGGGGGTAGGGGAGTGG - Intronic
906884428 1:49629317-49629339 CCATGTTGGGGGAATGGTTTAGG - Intronic
908443304 1:64177213-64177235 CTGGGTTGAGGGAAAGGGATAGG + Intronic
908820519 1:68081387-68081409 CAATGTTGGGGGATGGAGTTTGG + Intergenic
910232543 1:85001198-85001220 TTTTGGTGGGGGAGGGGGATTGG - Intronic
911419942 1:97628091-97628113 GGATGTTGGGGGAAAGGGAAAGG + Intronic
911696278 1:100893871-100893893 ATATCTTGGGGGATGGGGAGTGG + Intronic
914234814 1:145799596-145799618 TTTTGTTGGGGGGAGGGGGTGGG + Intronic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915318848 1:155044903-155044925 AGATGGTGGGGGAAGGGGAAAGG + Intronic
915530089 1:156498353-156498375 TTGTGTTGGGGGATGGGCATGGG - Intronic
915899603 1:159836845-159836867 TAATCTTGGGGGAAGGTGATAGG - Exonic
916681659 1:167110236-167110258 CTATGTTGGAGGAAGGATCTGGG - Intronic
917031978 1:170702848-170702870 CGATGTTGGGTGAAATGGATGGG + Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
919582658 1:199396614-199396636 CTATGTTAGATGATGGGGATGGG + Intergenic
920125465 1:203690885-203690907 CTGTGGTGGGGGATGGGGAGGGG - Intronic
920422510 1:205844755-205844777 CTCTGTTGAGGGTAGGGGAGTGG - Intronic
920839894 1:209545460-209545482 CCATGATGGGGGAAGGGCAGGGG - Intergenic
921629493 1:217416862-217416884 TTATGTGCGGGGAGGGGGATGGG + Intergenic
921632488 1:217452750-217452772 CTATGTTGGGGGTCGGGGAAGGG - Intronic
924273382 1:242358821-242358843 CTATGTAGGGTCTAGGGGATAGG + Intronic
1062899905 10:1135700-1135722 CTATTTTGGGGGCAGAGGGTAGG + Intergenic
1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG + Intergenic
1065195632 10:23262344-23262366 CCATGTTAGGGGAGGGGGGTGGG + Intergenic
1066975646 10:42365930-42365952 CTGAGTTGGGGGGAGGGGAGAGG - Intergenic
1067674719 10:48362546-48362568 CTATTTTGGGGGTGGGGGGTGGG + Intronic
1067695492 10:48532330-48532352 ATATGATGGGAGAAGGGGGTGGG - Intronic
1067893977 10:50160208-50160230 CTATTTAGGGGAAAGGGGAAAGG - Intergenic
1068131396 10:52899885-52899907 TTTTGTTGGGGGCTGGGGATGGG - Intergenic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070441725 10:76452659-76452681 TTATGTTGGGGTAAGGAGTTTGG + Intronic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1072161758 10:92773747-92773769 GTATGTTGGAGGTAGGGGAGTGG - Intergenic
1073193497 10:101669117-101669139 GTATGATGGGGGTGGGGGATGGG + Intronic
1073701909 10:105936159-105936181 CAATGTTGGGAGATGGGGACTGG + Intergenic
1074813489 10:117127148-117127170 TGATGGTGGGGGTAGGGGATGGG - Intergenic
1075121162 10:119666055-119666077 GCATGTGGGGGGAAGGGGAAAGG - Intronic
1076319484 10:129567317-129567339 CTATGATGGGGACATGGGATGGG - Intronic
1078161746 11:8846204-8846226 CTATGTCTGGGGAAAGGGAGAGG + Intronic
1078653882 11:13220439-13220461 CTATGTTTGGGGGTGGGGAAAGG - Intergenic
1078901094 11:15643630-15643652 ATATGTTGGGGGCAGGGGGCAGG - Intergenic
1080133089 11:28819347-28819369 CTATTCTGGGGGAGGGGGTTGGG + Intergenic
1080216389 11:29846378-29846400 CTTTTTTGGGGGGAGGGGACGGG - Intergenic
1080820533 11:35801775-35801797 CTTGGTTGTGGGTAGGGGATGGG - Intronic
1081298046 11:41416047-41416069 CTAGGTTTGGGGAAGGAGATAGG + Intronic
1081614554 11:44582959-44582981 GTATGTTGGGGGATAGGGAGGGG - Intronic
1081896671 11:46593232-46593254 GTAAGTGGGGGGAAGGGAATTGG + Intronic
1081984246 11:47290056-47290078 CAGTGTTGGGGGTAGGGAATCGG + Intronic
1083513166 11:63230797-63230819 CTGTCTTGGGGTTAGGGGATGGG - Intronic
1087183390 11:95160822-95160844 GTGTGTTGGGGGCGGGGGATGGG - Intergenic
1089108585 11:116036110-116036132 CTTTGAGGGGTGAAGGGGATGGG + Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1090099434 11:123778584-123778606 CTGGTTTGGGGGAAGTGGATAGG + Intergenic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1090367844 11:126222824-126222846 CTATGCTATGGGATGGGGATAGG + Intronic
1090614598 11:128503675-128503697 GTCTGTTGGGAGCAGGGGATAGG - Intronic
1090636569 11:128693667-128693689 GGATTTTGGGGGAAGGTGATGGG + Intronic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091901512 12:4147979-4148001 CCGTGCTGGGGGAAAGGGATGGG - Intergenic
1092160238 12:6311777-6311799 CTTTATATGGGGAAGGGGATGGG + Intronic
1092173624 12:6388601-6388623 CTATGTTGGGGGTAGGCATTGGG - Intronic
1092347066 12:7724235-7724257 CCTTGTTGGGGGAAGGTCATGGG - Intergenic
1094159717 12:27377833-27377855 CACTGTTGGGCGAAGTGGATAGG - Intronic
1095120712 12:38414913-38414935 TTAAGTTGGTGGAAGTGGATGGG - Intergenic
1099017498 12:77361609-77361631 ATATTTTGGGGGATGGGGAAAGG - Intergenic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1099622851 12:85026169-85026191 CAATGTAGTGGGCAGGGGATAGG - Intronic
1099641631 12:85295770-85295792 CGATGTTGGTGGCAGGAGATAGG + Intronic
1099731361 12:86508200-86508222 GTATGGTGGGGGAAGGGGGGAGG - Intronic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100379307 12:94046868-94046890 ATTTGTTGGGGGGAGGGGAGAGG + Intergenic
1100628316 12:96360069-96360091 CTATGATGGGGGAAGGGATCTGG + Intronic
1100838778 12:98591575-98591597 CGGTGCTGGGGGAAGGGAATAGG + Intergenic
1101200103 12:102426801-102426823 CTATGCTGGGTGAAAGTGATTGG - Intronic
1101785589 12:107880652-107880674 GTATGGTGGGGAAAGGGCATAGG - Intergenic
1101972091 12:109322041-109322063 CTATCCTTGGGGAAGTGGATGGG + Intergenic
1104030047 12:125058499-125058521 CTATTTTGGGGGAAGTTGATTGG + Intergenic
1104628352 12:130378122-130378144 CTTTGTGGGAGGAAGGGTATAGG - Intergenic
1104876617 12:132039353-132039375 CCATGGTGGTGGAAGGGGAGGGG + Intronic
1106027227 13:25966890-25966912 CTGTGCAGGGGAAAGGGGATAGG + Intronic
1106165369 13:27240921-27240943 CTAGATTGGAGGAAGGGGATGGG - Intergenic
1107986544 13:45781367-45781389 TTAGGTTCTGGGAAGGGGATTGG + Exonic
1108023271 13:46151116-46151138 CGATGTTGGGGGAGGGGGGTTGG + Intronic
1108031658 13:46237445-46237467 TAATGTTGGGGGAAGGCTATAGG + Intronic
1108050789 13:46436168-46436190 ATTTGTTGTGGGAAGAGGATAGG - Intronic
1108212237 13:48150480-48150502 CACTGGTGGGGGGAGGGGATGGG - Intergenic
1108624246 13:52211674-52211696 CTTTGCTGGGGGGAAGGGATGGG + Intergenic
1108661802 13:52594748-52594770 CTTTGCTGGGGGGAAGGGATGGG - Intergenic
1109543362 13:63809793-63809815 ATTTGTTGTGGGAAGAGGATAGG - Intergenic
1110561145 13:76911863-76911885 CAGTGTTGGGGGAAGAGGATAGG - Intergenic
1111003497 13:82216372-82216394 CCAACTTGGGGGAAGGGAATGGG + Intergenic
1111521083 13:89405340-89405362 ATATTTTTGGGGGAGGGGATAGG + Intergenic
1112098010 13:96156632-96156654 CTTTGTGTGGGGAAGAGGATTGG + Intronic
1113147614 13:107225611-107225633 AAATGGTGGGGGATGGGGATGGG + Intronic
1113538725 13:111089641-111089663 CTATGTTCAGGAAAGGGTATTGG + Intergenic
1113574510 13:111384937-111384959 GGATGTTGGGGGAAGGGTACTGG + Intergenic
1114794294 14:25695160-25695182 CTATGTTTTGGGCAGGGTATGGG + Intergenic
1115918644 14:38346039-38346061 ATAACTTGGGGGTAGGGGATTGG + Intergenic
1116457395 14:45134965-45134987 TTGTATGGGGGGAAGGGGATGGG - Intronic
1116863141 14:50010381-50010403 CTATGATGAAGGAAGGGGAATGG - Intergenic
1118606669 14:67508987-67509009 CTAGGTTGGAGGATGAGGATTGG + Intronic
1119750901 14:77076610-77076632 CTAAGTTGGGGGAGGGGTCTGGG + Intergenic
1120944577 14:89982129-89982151 CTATGGTGGGGCAAGGGAGTGGG - Intronic
1121429228 14:93874947-93874969 CTATGGTGGGGGTAGAGGGTAGG + Intergenic
1121613630 14:95298208-95298230 CTATTGGGGGGGAAGGGGAAGGG - Intronic
1121693207 14:95892540-95892562 CTATGTTTGGGGAAGTGGCATGG + Intergenic
1122040072 14:98981119-98981141 CAGGGTTGGGGGAAGGGGAATGG + Intergenic
1123943266 15:25226858-25226880 CTCCGTTTGGGGAAGGGGGTCGG - Intergenic
1123984638 15:25634443-25634465 CTTTCTTGGGGGAAGGGGCCTGG - Intergenic
1127161381 15:56190443-56190465 CCAGGTTGGGGGAAGGGGCTGGG - Intronic
1128209376 15:65884028-65884050 CTTTTGTGGGGGAAGGGGAGTGG + Intronic
1128494653 15:68188259-68188281 CTTTGTTGTGGGGAGGGGGTCGG + Exonic
1128786731 15:70403245-70403267 CTATGTTGGGGGAGAGTGAGGGG - Intergenic
1129446887 15:75625242-75625264 CGAAGGAGGGGGAAGGGGATGGG - Intronic
1129455089 15:75672486-75672508 CACTGGTGGGGGAAGGGGACAGG - Intergenic
1129600798 15:76996916-76996938 CAAAGTTGGGGGAAGGGGTAGGG + Intronic
1131616464 15:94021655-94021677 CTAGGTTTGGGGAAGGGTCTTGG - Intergenic
1132422208 15:101680086-101680108 CTGGGTTGGGGGAGGGGGATGGG + Intronic
1132804979 16:1771229-1771251 CGGTGTGGGGGGAAGGGGAGCGG - Intronic
1133723435 16:8516177-8516199 CTTTGGTAGGGGCAGGGGATAGG + Intergenic
1133860737 16:9592575-9592597 CTATGGTGACAGAAGGGGATGGG + Intergenic
1134194310 16:12147300-12147322 CTTTGATGGGGGAAAGCGATGGG - Intronic
1137268672 16:46888074-46888096 CTTTATTGGGGGATGGGGGTTGG + Intronic
1138257183 16:55576133-55576155 CTTGGTTTGGGGAAGGGGAAGGG + Intronic
1138264023 16:55646440-55646462 GGCTTTTGGGGGAAGGGGATTGG + Intergenic
1138321793 16:56120250-56120272 CTATGCTGTGTGAAGGGGTTTGG + Intergenic
1138531448 16:57636558-57636580 CTATGTGAGGGGTAGGGGATAGG - Intronic
1138924012 16:61568383-61568405 CTAGGTTGGGGAATGGGCATTGG - Intergenic
1140699895 16:77572235-77572257 CTTTTTTGGGGGGAGGGGAGGGG + Intergenic
1140727048 16:77822885-77822907 CTCTGTCGGGGGCAGGGGTTCGG - Intronic
1140733421 16:77876562-77876584 ATATGTTGGGGTAGTGGGATGGG + Intronic
1141339315 16:83188304-83188326 CAATGGTGGTGGAAGGGGAGAGG + Intronic
1141340127 16:83195632-83195654 CAATGTTGGAGGAGGGGGCTTGG - Intronic
1142155229 16:88529950-88529972 CCAGGTTGGGGGCAGGGGCTGGG + Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142635086 17:1252104-1252126 CGCTGTTGGGGGAAGGGGGGAGG - Intergenic
1142698664 17:1646883-1646905 GTATGTTGGGGAAAGGGGAAAGG - Intronic
1143450747 17:7035640-7035662 CCCTGTTGGGGGTAGGGGAGGGG - Intergenic
1143938104 17:10508369-10508391 CTTTGTTGGGGCAACGGGAGCGG - Exonic
1144146417 17:12403654-12403676 CTATGTTCAGGGAATGGGCTTGG + Intergenic
1146182396 17:30706573-30706595 CTCTGTAGGGGGAAGTGGGTGGG + Intergenic
1146665277 17:34698116-34698138 GTGTGTTGGGGAAAGGGGTTTGG - Intergenic
1148022309 17:44561522-44561544 TTATGTTGGGGGAGGGGAACTGG + Intergenic
1148221037 17:45862118-45862140 CTGTGTTGGGTGGCGGGGATGGG + Intergenic
1149243954 17:54683197-54683219 TTAGGTTTGGGGCAGGGGATAGG + Intergenic
1149544916 17:57496366-57496388 CTAAGTGGGGAGAGGGGGATTGG - Intronic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151351421 17:73534280-73534302 CGCTGCTGGGGGAAGGGGAGTGG + Intronic
1151365444 17:73613604-73613626 ATATGTAGGGGGAGGGGGCTGGG - Intronic
1151716376 17:75833098-75833120 CCAGGTCAGGGGAAGGGGATGGG - Intronic
1152276481 17:79360858-79360880 TTATGTTGGGGGAAGGGGAGTGG + Intronic
1152574122 17:81132732-81132754 CTGTGCTGAGGGAAGGGGCTGGG - Intronic
1153038086 18:783562-783584 ATCTGTTGGGGGTAGGGAATGGG - Intronic
1153258646 18:3199110-3199132 CTAAGCTGGGGGTAAGGGATGGG - Intronic
1153512444 18:5870224-5870246 CTTTGTTGGGTGGAGGGGAGAGG + Intergenic
1154953866 18:21236184-21236206 CTATGTTTGGAGAAGAGAATGGG - Intergenic
1156260570 18:35441917-35441939 AGATGTTTGGGGAAGGGGCTAGG - Intergenic
1156265266 18:35482413-35482435 TCATGTTGGGGGAAGAGGAGTGG + Intronic
1156481341 18:37438335-37438357 CCATGGTGGGGCAAGGGGCTTGG + Intronic
1157525526 18:48377393-48377415 CTCTGCTTGGGGAAGGGGGTGGG + Intronic
1157891985 18:51426628-51426650 CAATGTTGGAGGAAGGGTCTAGG + Intergenic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1158729974 18:60011542-60011564 CAATCTTGGTGGAAGGTGATGGG + Intergenic
1160042309 18:75356967-75356989 CAATGTTGGGGGAGGGGTCTGGG + Intergenic
1161009818 19:1954730-1954752 CTAGGGCTGGGGAAGGGGATGGG + Intronic
1162348973 19:10137499-10137521 TTAGGGTGGGGGAAGGGGAGTGG + Intronic
1162823772 19:13238536-13238558 CCAGGTTGGGGGAAGAGAATAGG - Intronic
1162976428 19:14209228-14209250 CTCTGTAGGGGGAAGTGGGTGGG - Intergenic
1165259427 19:34599233-34599255 CTATGGTGGAGGAGTGGGATGGG + Intronic
1165386578 19:35513683-35513705 CTAGGTTGGGAGAAGGTGACAGG + Intergenic
1165744562 19:38222860-38222882 CCAGGCTGGGGGAAGGGGACAGG + Intronic
1166383549 19:42368432-42368454 CTGTATGGGGGGGAGGGGATGGG - Intronic
1167055956 19:47111983-47112005 CTGGCTTCGGGGAAGGGGATGGG - Intronic
1167369007 19:49069974-49069996 CAAGGCTGGGGGGAGGGGATTGG - Exonic
1167482506 19:49741824-49741846 TTCTGTTGGGGCAAGGGGAGGGG - Intronic
1167507988 19:49881231-49881253 CTGTGTTGGGGGAAGCGCGTGGG - Intronic
1167517268 19:49930468-49930490 CTGTATTGGGGGAAGGGGTGGGG + Intronic
1167723057 19:51192168-51192190 CAGTGTTTGGGGCAGGGGATGGG + Intergenic
1167829626 19:52008732-52008754 TTATGTTGGGTGAAAGGCATGGG + Intergenic
928132298 2:28661369-28661391 CTATCCTGGAGGAAGGGGTTGGG - Intergenic
930411570 2:51031943-51031965 TTGGGTTGGGGGGAGGGGATGGG - Intronic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
931654350 2:64497472-64497494 CTTTTTTTGTGGAAGGGGATGGG - Intergenic
932414873 2:71567634-71567656 CTGTGGTGGGAGAAGGGGAGAGG + Intronic
933585852 2:84178681-84178703 CTCTGTTGGGGTAGGTGGATAGG + Intergenic
934071125 2:88384667-88384689 ATATTCTGGGGGGAGGGGATGGG + Intergenic
935885870 2:107618426-107618448 TTTTGTGGGGGGAAGGGGATGGG - Intergenic
937992868 2:127674142-127674164 CTTTGCTGGGGAAAGGGGCTTGG - Intronic
938226304 2:129619282-129619304 AGATGTTGGGGGAACGGGAGCGG + Intergenic
938544073 2:132311551-132311573 CAATGTAGGGAGAAGGGGTTAGG - Intergenic
938608821 2:132925126-132925148 CTTTGTTGGGGGGTGGGGAATGG + Intronic
938687410 2:133753409-133753431 ACATGTTGGGTGAAGGGGGTGGG + Intergenic
940197717 2:151114218-151114240 CTCTTTTGGGGGGAGGGGCTGGG - Intergenic
940219163 2:151333764-151333786 CTATGGTGAGGGAATGAGATTGG + Intergenic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
940637930 2:156320606-156320628 CTATGCTGGGAGGAGGGGTTGGG + Intergenic
940725367 2:157330381-157330403 CAATGTTGGAGGCAGGGGAGGGG + Intergenic
940886928 2:158998418-158998440 TTTTGTTGGGGGTAGGGGCTGGG - Intronic
941132009 2:161662997-161663019 TTAAGTTGGGGGAAGGGGGGTGG - Intronic
941494991 2:166189091-166189113 CTATGGTGGGGGGAGGGGGGAGG - Intergenic
942189504 2:173456305-173456327 CCATGCTGGGGGCAGGGGACAGG + Intergenic
942327405 2:174787717-174787739 CTTTGTTGAGGGATGAGGATAGG - Intergenic
942528302 2:176880118-176880140 CTGTGTTGGGGCATGGGGTTGGG - Intergenic
944546667 2:200805586-200805608 CAATGTTGGTGGGAGGTGATTGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945119447 2:206443329-206443351 CTTTGTTGGGGGGCGGGGAAGGG - Intergenic
947014802 2:225607370-225607392 CTATGATGGGGGCAGTGGAAAGG + Intronic
948027564 2:234790207-234790229 CTATGCTGGGGGAAGATGAGAGG - Intergenic
948122194 2:235539381-235539403 CCATTTTGAGGGAAGGGAATGGG + Intronic
948846272 2:240684169-240684191 CCAGGTTGGGGGAAGGGCCTCGG - Intergenic
948847591 2:240690561-240690583 CCAGGTTGGGGGAAGGGCCTCGG + Intergenic
1169253143 20:4075513-4075535 GTATGTGGGGAGAAGGGGAAAGG - Intergenic
1170292419 20:14785456-14785478 ATATTTTGAGGGAAGGGGAGAGG + Intronic
1170712805 20:18807637-18807659 CTGTGTTGGGGGCAGGGTATGGG - Intergenic
1171413463 20:24961901-24961923 CCATGTTAGGGGAAGAGAATCGG - Intergenic
1171413532 20:24962200-24962222 CCATGTTGGGGGAAGAGAGTTGG - Intergenic
1171413562 20:24962320-24962342 CCATGTTGGGGGAAGAGAGTCGG - Intergenic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1172083068 20:32358080-32358102 CGCTGTTCGGGGAAGGGGCTGGG - Intergenic
1172094898 20:32455813-32455835 CTGTTCTGGGGGAGGGGGATGGG + Intronic
1172214154 20:33223136-33223158 CTGTCTTGGAGGAGGGGGATGGG + Intronic
1173485558 20:43438553-43438575 GTGTGTGGGGGGATGGGGATGGG - Intergenic
1173594810 20:44251762-44251784 CTAAGTTGGGGGAAGCTTATGGG + Intronic
1173787983 20:45808872-45808894 CTTTGTTGTGAGAAGGGGGTGGG + Intronic
1174263318 20:49313345-49313367 CTCTGTTGCGGGCAGGGGACTGG - Intergenic
1175752834 20:61510884-61510906 CAATGGTGGGGGAAGGTGAGGGG + Intronic
1175948785 20:62571568-62571590 CTGAGGTGGGGGAGGGGGATGGG + Intergenic
1176510708 21:7745451-7745473 GAGTGTTGGGGGAAGGGTATGGG + Intronic
1177495316 21:21882057-21882079 CTGTGTAGGGGGAAGAGCATGGG - Intergenic
1177994330 21:28077007-28077029 TTATGTTGGGGGAAGAGGCCAGG + Intergenic
1178644821 21:34375980-34376002 GAGTGTTGGGGGAAGGGTATGGG + Intronic
1179889621 21:44328900-44328922 CCATGTCGGGGGAAGTGGAAGGG + Intergenic
1182427742 22:30283797-30283819 TTTTGTTGGGGGAGGGGGGTTGG - Intergenic
1185214288 22:49589718-49589740 CTGTGCTGGGGGCAGGAGATGGG + Intronic
950127212 3:10517299-10517321 CCAGGCTGGGGGAAGGGGAAGGG - Intronic
950874680 3:16260781-16260803 CTTTGTTGGCTGAAGGGGCTGGG + Exonic
951191114 3:19772678-19772700 CCATGATGGTGGAAGGGGAAAGG - Intergenic
952284434 3:31954578-31954600 CTATATTGGGGGCAGGGGGAAGG + Intronic
952387971 3:32856544-32856566 CTCTGTTGGTGGAAGGTGAAAGG + Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
953113403 3:39966620-39966642 CTCAGTTGGGGGCAGGGGGTGGG + Intronic
953606911 3:44418342-44418364 CAATCATGGGGGAAGGGGAAAGG - Intergenic
955404849 3:58619623-58619645 CTATGATGAGGGAAGCAGATAGG - Intronic
955417138 3:58702990-58703012 CAAGGCTGGGGGAATGGGATGGG - Intergenic
955882982 3:63567442-63567464 CCATCTTGGGGGATGGGGAGGGG - Intronic
955979031 3:64506094-64506116 CTGTCATGGGGCAAGGGGATGGG + Intergenic
956018594 3:64910311-64910333 GTATGTTGAGGGGAGGGGAGGGG - Intergenic
956302822 3:67790966-67790988 CTGTCTTGGGGAATGGGGATAGG + Intergenic
956612198 3:71135434-71135456 CTATTTTGGGAGTAGGGGGTAGG - Intronic
957699393 3:83689063-83689085 GCATGTTGGGGGGAGGGGAGGGG - Intergenic
958533601 3:95366574-95366596 CTCTGTTGGGGGATGACGATAGG - Intergenic
958932308 3:100220407-100220429 TTTTGTTGGGGGGAGGGGTTAGG - Intergenic
959971629 3:112416549-112416571 GTGTGGTGGGGGAAGGGCATGGG - Intergenic
960182665 3:114599915-114599937 CTATGGGGGGTGAAGGGGAGTGG + Intronic
960778228 3:121286759-121286781 CTATTTTGGGGGAATGGGTGTGG - Intronic
961009316 3:123425287-123425309 CTCACTTGGGGGAAAGGGATTGG + Intronic
961584795 3:127913524-127913546 CTTTTTTGGGGGAGGGGGATGGG - Intergenic
961751798 3:129100678-129100700 CTAATTTGGGGGAATAGGATGGG - Intronic
963818212 3:149857718-149857740 ATAGAGTGGGGGAAGGGGATGGG - Intronic
964133404 3:153316512-153316534 CTATGGTGGGGGTGGGGGAAAGG - Intergenic
965499753 3:169443358-169443380 CTCTGTGGGGGGAAGGGAAGGGG + Intronic
966143835 3:176787642-176787664 TTATGCAGGGGGAAGGGGCTTGG - Intergenic
966736542 3:183191275-183191297 CTCTGGTGGGGGATGGTGATAGG - Intronic
967415274 3:189210127-189210149 GTGTGTTGGGGGGAGGGTATTGG + Intronic
967482050 3:189983925-189983947 CTTTCTTGGGGGAAGGGGAGAGG + Intronic
968538208 4:1148475-1148497 CTGTGCTGGGGGACGGGGATGGG - Intergenic
969198866 4:5585733-5585755 CTAAGTGGGGGGCAGGGGGTGGG - Intronic
969393433 4:6906126-6906148 CTGAGCTGGGGCAAGGGGATTGG + Intergenic
969484609 4:7465150-7465172 CTCTGCTGGGGCCAGGGGATGGG + Intronic
969860568 4:10032461-10032483 CTATATTTGGGCAAGGGGGTTGG + Intronic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
970599268 4:17627983-17628005 CTATGTTAGAGAAAGGGGAGAGG - Exonic
970616411 4:17772312-17772334 CTGTTTTGGGGGTGGGGGATGGG - Intronic
971157786 4:24102070-24102092 CTATGTTGGGGCAGGGGGTTGGG - Intergenic
971203171 4:24531719-24531741 CTTTTTTAGGGGGAGGGGATGGG - Intronic
971382137 4:26108697-26108719 CTATGTTCTGGTAAGGGGAGTGG + Intergenic
971890369 4:32512268-32512290 CTTTATTGGTAGAAGGGGATGGG + Intergenic
972192981 4:36616993-36617015 ATATGTTGAGGGAAGGTTATTGG - Intergenic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972685213 4:41346008-41346030 GTATGTGGGGGGAAGGGCAGGGG - Intergenic
975599433 4:76083946-76083968 CTATGCTGGGAGAATGGGAAGGG - Intronic
976390497 4:84499805-84499827 AGCTGGTGGGGGAAGGGGATAGG - Intergenic
976417955 4:84801043-84801065 CGATGTTGGGGTTAGGGGAGTGG + Intronic
979525188 4:121708733-121708755 CTTTGTTGGGGAATGGGGGTAGG + Intergenic
979682690 4:123478989-123479011 ATATGTTGGGGGCAGGGCAAGGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981412122 4:144443877-144443899 CAATGTTTGGGGAAAGTGATTGG - Intergenic
981821855 4:148896459-148896481 TTATGGTGAGGGAAGGGGAGTGG + Intergenic
982233160 4:153227755-153227777 TCATGGTGGGGGAAGGGGAAGGG + Intronic
982260011 4:153486856-153486878 CTAAGTGGGAGGAAGGGAATGGG + Intronic
982536661 4:156615455-156615477 GAAAGTTGGGGGAAGGGGAAAGG + Intergenic
984470312 4:180162010-180162032 ATATATTGGGGGACGGGGTTAGG + Intergenic
984596424 4:181673999-181674021 ATTTATTGGGGAAAGGGGATAGG + Intergenic
986341922 5:6796517-6796539 CTGTGTTGGGAAAAGTGGATGGG + Intergenic
986691020 5:10314024-10314046 TTATTTTGGGGGGAGGGGACAGG + Intergenic
987268518 5:16280492-16280514 CAATGTTGGGGGAGGAGGAGAGG - Intergenic
987269702 5:16294024-16294046 CTATGTTGGAGGAACGTGATTGG - Intergenic
987416349 5:17665848-17665870 CTATGTGGGGGAAAGGATATAGG - Intergenic
987912368 5:24164629-24164651 CAAAGTTGGGGGACAGGGATGGG - Intronic
988483099 5:31645937-31645959 CTCAGTAGGGGGAAGGGGGTGGG + Intronic
988995972 5:36715267-36715289 GCATGTTGGGGGAAGGAGTTGGG - Intergenic
989846911 5:46156446-46156468 CTGTCATGGGGTAAGGGGATGGG - Intergenic
990731235 5:58811642-58811664 GTATCTTGGGGAAAGGGGAGGGG - Intronic
994990482 5:106990240-106990262 CTAGGTTTGGGAAAGGGGGTGGG + Intergenic
995531162 5:113093152-113093174 CAAAATGGGGGGAAGGGGATGGG + Intronic
995858788 5:116620397-116620419 CTATGTGGAAGGGAGGGGATAGG + Intergenic
996189498 5:120521818-120521840 CTATGGTGGGGTAAGGGAAAGGG - Intronic
996680878 5:126227304-126227326 GTTTTTTGGGGGAATGGGATTGG - Intergenic
996764191 5:127019327-127019349 GTATGTTGGGGGATGGGGTAGGG - Intronic
997039754 5:130238048-130238070 TTATCTTGGGTGAAGGGGAAGGG - Intergenic
997844562 5:137275280-137275302 CTATGGTGGGGGAAGGGAGCAGG - Intronic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998176040 5:139902699-139902721 GTATGTAGGGGGAATGGGAGTGG + Intronic
998514431 5:142739874-142739896 CTACGTTGGGGTTAGGGCATAGG - Intergenic
998830429 5:146152224-146152246 GTGTGGTGGGGGAAGGGCATTGG - Intronic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999293075 5:150440325-150440347 CTTTGTTTGGGGTTGGGGATGGG + Intergenic
999782273 5:154858834-154858856 GTCTGTAGGGGGAAGGGGAGTGG + Intronic
999897205 5:156047969-156047991 CTGTTTTGGGGTGAGGGGATGGG - Intronic
1000285618 5:159823837-159823859 TTTGGGTGGGGGAAGGGGATGGG + Intergenic
1000400842 5:160825459-160825481 CAATGTTGGTGGAAGGTGAAAGG - Intronic
1000450734 5:161383716-161383738 CTATGGTGGGGGAAGAGGGTTGG - Intronic
1000999713 5:167994327-167994349 TTATGTTGAGGGAAGGGGCAAGG - Intronic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001148583 5:169206128-169206150 CTATGTTGGGGGCAGGGAAGAGG + Intronic
1001518426 5:172373538-172373560 CTATTTTTGGGAAATGGGATGGG + Intronic
1002159189 5:177304885-177304907 CTATCTCGGGGGGAGGGGAGAGG - Intronic
1002394923 5:178945242-178945264 GTATGTTGGGGTATGGGTATGGG + Intronic
1002953858 6:1842725-1842747 CTATTTTGAGGGGTGGGGATAGG + Intronic
1005198738 6:23319101-23319123 CTATGTTGGAGGCAGGGCAGTGG + Intergenic
1005582617 6:27248955-27248977 CAATGTTGGGGGAAAGGAGTTGG + Intronic
1005773168 6:29098068-29098090 CTACCTTGGGGGTAGGGGATGGG + Intergenic
1005913570 6:30331678-30331700 CTATGGTGGAGGATGGGGAGGGG - Intronic
1006186078 6:32182387-32182409 CCCTGGTGGGGGAAGGGGAGAGG + Exonic
1006315822 6:33290848-33290870 CCATGGTGGGGGGAGGGGAGGGG + Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006461556 6:34162117-34162139 CTCTGATGGGGGAAGGAGTTGGG + Intergenic
1006790330 6:36697127-36697149 CTATGTTGGGAGAATGGGCTAGG - Intergenic
1007314085 6:40970540-40970562 CTATGTTGGGTGCCAGGGATAGG - Intergenic
1008704545 6:54142404-54142426 TTATGTTGGGGTATTGGGATAGG + Intronic
1010806826 6:80246882-80246904 GTATGTTGGGGGAGAGGGGTGGG - Intronic
1010949962 6:82023892-82023914 CTATGATGGGGGAAATGGAAAGG - Intergenic
1011260941 6:85468938-85468960 CAGTGTGGGGGGAAAGGGATGGG + Intronic
1012503760 6:99920722-99920744 CTATATTGTGGGTAGGGAATGGG - Exonic
1012765149 6:103357906-103357928 CAATGTTGGTGGATGGGGCTGGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013189739 6:107792013-107792035 TTACTTTGGGGGAAGGGGAGGGG + Intronic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013430315 6:110049618-110049640 CTATCTTGTTGGAAAGGGATAGG + Intergenic
1015072304 6:129109211-129109233 CTGTGTTGGGGGCAGAGGCTGGG + Intronic
1015232659 6:130934091-130934113 CATTGTTGGGGGAGGAGGATGGG + Intronic
1015413937 6:132927164-132927186 CTATTTTGGGGGATGGGGTGGGG + Intergenic
1015541056 6:134314339-134314361 CTTGGTTGGGGGAGGGGGGTAGG + Intronic
1018953181 6:168392000-168392022 GTATGCTGGGGGATGGGGACAGG - Intergenic
1018953196 6:168392054-168392076 GTATGCTGGGGGATGGGGACAGG - Intergenic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019967458 7:4511476-4511498 CTATTCAGGAGGAAGGGGATTGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022224062 7:28345469-28345491 TTGTGATGGGGGATGGGGATGGG + Intronic
1022477866 7:30723537-30723559 TTATGGTGGGGGGAGGAGATGGG + Intronic
1022958818 7:35405598-35405620 CTATGCTGGGCTAAGGGGTTGGG - Intergenic
1023786306 7:43712015-43712037 CTCGGTGGAGGGAAGGGGATGGG - Intronic
1024619385 7:51144697-51144719 CTGGGGTGGGGAAAGGGGATTGG - Intronic
1026101838 7:67390270-67390292 CTGTGCTGTGGGAAGGGGAGGGG - Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026772389 7:73210833-73210855 CTATGATGGGGAAAGAGGAAGGG + Intergenic
1027013257 7:74764232-74764254 CTATGATGGGGAAAGAGGAAGGG + Intergenic
1027074783 7:75181802-75181824 CTATGATGGGGAAAGAGGAAGGG - Intergenic
1028579265 7:92388322-92388344 CAATGTTGGGAAAAGTGGATGGG + Intronic
1029226207 7:99030427-99030449 TTCTGTTGGGGGAGGGGGATGGG - Exonic
1030036875 7:105415497-105415519 CTTTTTTGGGGGAGGGGGCTGGG + Intergenic
1031558931 7:123214512-123214534 CAATGTTGGTGGGAGGTGATTGG + Intergenic
1031873061 7:127108445-127108467 TTGTGTGGGGGGAAGGGAATAGG + Intronic
1031951394 7:127896168-127896190 CTATTTTGGCGGATGGGGGTGGG - Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032070135 7:128799708-128799730 AGAAGTTGGGGGAAGGGGATGGG + Intronic
1032286204 7:130540032-130540054 GTGGGTTGGGTGAAGGGGATGGG + Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033600769 7:142886944-142886966 CTTTGTTGTGGGAAGACGATGGG - Intergenic
1034356467 7:150454147-150454169 CAATGTGAGGGGAAGGGGGTGGG + Intronic
1034763123 7:153692607-153692629 TTATGTTGGGAAAAGGGGTTTGG - Intergenic
1035142615 7:156777902-156777924 GTATGGTGGGGGTAGGGTATGGG - Intronic
1035462905 7:159056217-159056239 CAAGATTGGGGGAGGGGGATTGG - Intronic
1035567196 8:649592-649614 CTCTCTCGGGGGAGGGGGATTGG + Intronic
1036146244 8:6257644-6257666 CAATGTTGGGGGAGGGGGCCTGG - Intergenic
1036619947 8:10418198-10418220 CTTTGGTGGGTGTAGGGGATGGG + Intronic
1037134119 8:15441950-15441972 CTATTTTGGGGGAATGAGACCGG - Intronic
1037986337 8:23292919-23292941 CTGTGGTGGGGGAGGGGTATAGG - Intronic
1038090491 8:24247750-24247772 CTGTGTTGGGGTAAGTGGAGTGG - Intergenic
1038405070 8:27315476-27315498 CTGCGTTGGGGGGAGGGGAGAGG - Intronic
1040482898 8:47842259-47842281 CTGTGCTGGGGGTAGGGGAAGGG - Intronic
1041184575 8:55285833-55285855 CTGTTTTGGGGGAGGGGTATAGG - Intronic
1042322917 8:67496916-67496938 CTATAGTGAGGGAAGAGGATAGG - Intronic
1042416103 8:68521400-68521422 CTGGGTTGGGGTCAGGGGATAGG - Intronic
1043050239 8:75377049-75377071 ATGGGTTGGGGGAAGGGGGTGGG - Intergenic
1043703353 8:83318659-83318681 CTATCTTGAGGGAATGGCATAGG - Intergenic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1047144340 8:122180118-122180140 CTATATTAGGGGAAGTGAATAGG - Intergenic
1047295457 8:123566817-123566839 GGGTGGTGGGGGAAGGGGATAGG + Intergenic
1048069718 8:131008886-131008908 CTATGTTTTGGCAAGGAGATTGG + Intronic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1050180193 9:2914175-2914197 ACATGATGGGGGAAGGGGAGGGG + Intergenic
1050653233 9:7795713-7795735 GTAAGATAGGGGAAGGGGATGGG - Intergenic
1051273191 9:15374851-15374873 CACTGTTGGGGGTAGGGGAGTGG - Intergenic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1051648338 9:19293429-19293451 GATTGTTGGGAGAAGGGGATGGG + Intronic
1053151313 9:35745056-35745078 CTGTTTTGGAGGTAGGGGATTGG - Intronic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1054894099 9:70287729-70287751 GTATGTTGGGAGAAGGGGATTGG + Intronic
1055251967 9:74318459-74318481 CTTTGTAGGGGGAATGGGAGGGG - Intergenic
1055320526 9:75079744-75079766 ATAGGATGGGGGAAAGGGATAGG + Intronic
1055572423 9:77630919-77630941 TAATGTTGGGGGAAGGGTATAGG - Intronic
1055659876 9:78492055-78492077 CTATGTTGGGGGACAGCCATAGG + Intergenic
1057373394 9:94495195-94495217 CTGTGTTGGAGGAAAGGGCTTGG + Intergenic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1058332746 9:103784314-103784336 CTATGATGGGGAATGGGAATTGG - Intergenic
1059672149 9:116501899-116501921 CTGAGTTTGGGGAATGGGATGGG - Intronic
1060725656 9:126003945-126003967 GTATGGTGGGGGCAGGGGAGGGG + Intergenic
1061074224 9:128331413-128331435 CTGTGGTGGGGGGAAGGGATGGG + Intronic
1062446443 9:136597346-136597368 CGATGATGGGGGCAGGGGCTGGG - Intergenic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1186336586 X:8596206-8596228 CCATGTTGGGGGAGGGGGCAGGG - Intronic
1186611395 X:11140925-11140947 CCATGTTGGGGACAGGGGAGTGG + Intronic
1186634354 X:11386455-11386477 CTGTCTTGTGGGAAGGGGAGAGG + Intronic
1186885244 X:13906408-13906430 CCCTATTGGGGGAAGGGGGTGGG + Intronic
1188485599 X:30678460-30678482 CTAAGTTGTGGGATGGGGAATGG + Intronic
1189682273 X:43529123-43529145 CCAAGTTGGGGCAAGGGGACTGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190115552 X:47624156-47624178 CTACTTTTGGGGAAGGGGATAGG + Intergenic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1192256880 X:69468853-69468875 CAATCTTGGGAGAAGGGGAAGGG - Intergenic
1192589320 X:72346761-72346783 CTATGGTGGGGGAGGGGGCGGGG + Intronic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1194307380 X:92265069-92265091 CTTTTTTGGAGGTAGGGGATGGG + Intronic
1195339055 X:103887198-103887220 ATGTGTTGGGGGATAGGGATGGG + Intergenic
1195962599 X:110401572-110401594 CTGTGTTGTGGTAAGGGGAAGGG + Intronic
1196008017 X:110856065-110856087 CCATGTTTGGGGAGGAGGATTGG - Intergenic
1196053092 X:111326151-111326173 ATGAGTTGGGGGAAGGGGAATGG + Intronic
1196645486 X:118113172-118113194 CTCTGTTTAGGTAAGGGGATGGG - Intronic
1197018655 X:121659169-121659191 CTCTATTGGAGGAAGGGGATTGG - Intergenic
1197504977 X:127290249-127290271 CTATGCTGTTGGAAGTGGATGGG - Intergenic
1197729114 X:129795119-129795141 CTAGCTTTGGGGAAGGGGTTGGG + Exonic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198414794 X:136409164-136409186 CAATGCTGGCTGAAGGGGATGGG + Intronic
1198594833 X:138224877-138224899 CTATGTAGGAGGATGTGGATGGG + Intergenic
1201746057 Y:17375208-17375230 CTGTGGTGGGGTCAGGGGATGGG - Intergenic