ID: 931487489

View in Genome Browser
Species Human (GRCh38)
Location 2:62707005-62707027
Sequence TAAATCCCATCTTAGATGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931487489_931487491 -8 Left 931487489 2:62707005-62707027 CCATTCATCTAAGATGGGATTTA 0: 1
1: 0
2: 1
3: 36
4: 418
Right 931487491 2:62707020-62707042 GGGATTTACCCTGTGAAACAGGG 0: 1
1: 0
2: 2
3: 24
4: 137
931487489_931487494 5 Left 931487489 2:62707005-62707027 CCATTCATCTAAGATGGGATTTA 0: 1
1: 0
2: 1
3: 36
4: 418
Right 931487494 2:62707033-62707055 TGAAACAGGGAGAAGACTTATGG 0: 1
1: 0
2: 1
3: 24
4: 343
931487489_931487490 -9 Left 931487489 2:62707005-62707027 CCATTCATCTAAGATGGGATTTA 0: 1
1: 0
2: 1
3: 36
4: 418
Right 931487490 2:62707019-62707041 TGGGATTTACCCTGTGAAACAGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931487489 Original CRISPR TAAATCCCATCTTAGATGAA TGG (reversed) Exonic
902069531 1:13722539-13722561 CAAACCCCATCTGAGATGAAAGG + Intronic
906911694 1:49958921-49958943 CATATCCCATCTTAGAGGAAAGG + Intronic
906992555 1:50754820-50754842 CAAGTCACATCTTACATGAATGG + Intronic
907411031 1:54283306-54283328 TAACTTCCAACTTTGATGAAAGG + Intronic
908627374 1:66059561-66059583 TAAGTCACATCTCACATGAATGG + Intronic
909096240 1:71291877-71291899 CAAGTCACATCTTACATGAATGG - Intergenic
909410518 1:75345123-75345145 TAAATTTCAACTTAGATTAAAGG + Intronic
909703240 1:78551693-78551715 CAAGTCCCATCTTACATGGATGG - Intergenic
909750002 1:79147426-79147448 CAAGTCACATCTTACATGAATGG + Intergenic
909783530 1:79580968-79580990 TTAATCCCATATCAGATGCATGG + Intergenic
909808936 1:79906737-79906759 TAAGTCACATCTTACATGGATGG + Intergenic
910233396 1:85009366-85009388 CAAGTCCCATCTTACATGGATGG + Intronic
910606995 1:89097883-89097905 CAAATCACATCTTACATGGATGG - Intergenic
911500702 1:98681121-98681143 TAAGTCACATCTTACATGGATGG + Intronic
915692401 1:157702937-157702959 CAAGTCACATCTTACATGAATGG + Intergenic
916313826 1:163426040-163426062 TAAAACCCATATAAAATGAAAGG + Intergenic
916403885 1:164477663-164477685 CAAGTCACATCTTACATGAACGG - Intergenic
916469777 1:165111914-165111936 TGAATTCCATCTTACCTGAAAGG - Intergenic
916509569 1:165460044-165460066 CAAGTCACATCTTAGATGGATGG + Intergenic
917681685 1:177374485-177374507 CAAGTCCCATCTTACATGGATGG + Intergenic
917759080 1:178135783-178135805 CAAGTCCCATCTTACATGGATGG + Intronic
918090415 1:181288660-181288682 TAAAGCACATCTTAGAAGAGTGG - Intergenic
918436273 1:184516592-184516614 CAAGTCCCATCTTACATGGATGG + Intronic
918883484 1:190158250-190158272 CAAGTCACATCTTACATGAATGG - Intronic
918914493 1:190616982-190617004 TAAGTCACATCTTACATGGAAGG + Intergenic
919135530 1:193503833-193503855 CAAATCACATCTTACATGGAGGG - Intergenic
919163590 1:193863534-193863556 CAAGTCCCATCTTATGTGAATGG - Intergenic
919597319 1:199580293-199580315 TTAATTCCATATTAGATTAAAGG - Intergenic
920599179 1:207305255-207305277 TAAATCACATCTTAGGTAAAGGG + Intergenic
920784121 1:209024271-209024293 AAAATCTCATCTTAGTTGATGGG + Intergenic
921530723 1:216279342-216279364 TGAATCCCATCTTAAAAGCAAGG - Intronic
921763063 1:218939619-218939641 CAAATCACATCTTACACGAACGG - Intergenic
921763318 1:218941512-218941534 TAAGTCACATCTTACATGGATGG - Intergenic
922044327 1:221928741-221928763 TAAATGCCATCTAAAATGCAAGG - Intergenic
922115192 1:222606801-222606823 CAAGTCACATCTTACATGAATGG + Intergenic
922636506 1:227178360-227178382 CAAGTCCCATCTTACATGGATGG - Intronic
923876970 1:238059749-238059771 CAAGTCACATCTTAGATGAATGG + Intergenic
1064320723 10:14302055-14302077 TAAATCCCATCGTAATGGAAAGG + Intronic
1064575830 10:16745511-16745533 CAAGTCACATCTTACATGAATGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064933884 10:20658152-20658174 TAAATGGCATCTTCAATGAAGGG + Intergenic
1066277883 10:33886779-33886801 TAAATCCCATCTTACATGGATGG - Intergenic
1066480090 10:35787173-35787195 CAAGTCACATCTTACATGAATGG + Intergenic
1066536642 10:36399015-36399037 TAAATTCTATATTATATGAATGG + Intergenic
1067358445 10:45553772-45553794 CTAATCCCGTCTTAGGTGAATGG - Intronic
1068510807 10:57963576-57963598 CAAGTCACATCTTACATGAATGG + Intergenic
1070633379 10:78104608-78104630 TAAGTCCCACCTTACGTGAATGG - Intergenic
1070633647 10:78106561-78106583 CAAGTCCCATCTTACATGGATGG - Intergenic
1070869272 10:79735251-79735273 TAAATACCATTCTCGATGAAAGG - Intergenic
1071159173 10:82726526-82726548 CAAGTCACATCTTACATGAATGG - Intronic
1071539457 10:86467242-86467264 TAATTCTCATCTTAGAAGGAAGG + Intronic
1071636191 10:87257438-87257460 TAAATACCATTCTCGATGAAAGG - Intergenic
1071659050 10:87480505-87480527 TAAATACCATTCTCGATGAAAGG + Intergenic
1073638803 10:105228705-105228727 TAAATCCACTCTTGGTTGAATGG + Intronic
1074078537 10:110150606-110150628 TAAACCCCATCTAAGAGGACAGG - Intergenic
1074223499 10:111461244-111461266 TAAGTCACATCTTACATGGATGG - Intergenic
1074262594 10:111869334-111869356 CAAGTCCCATCTTACATGAATGG - Intergenic
1075194100 10:120339917-120339939 CAAATCCCATCTCAGAAGAAAGG - Intergenic
1076181113 10:128408817-128408839 TTAATCCCTTGTCAGATGAATGG + Intergenic
1079617856 11:22517344-22517366 TAATGCCTATCTTATATGAAAGG - Intergenic
1079686124 11:23362209-23362231 CAAGTCCCATCTTACATGGATGG + Intergenic
1079709454 11:23663550-23663572 CAAATCACATCTTACATGGATGG - Intergenic
1079763649 11:24361499-24361521 CAAGTCACATCTTACATGAATGG - Intergenic
1080151600 11:29057814-29057836 CAAGTCCCATCTTACATGGAAGG - Intergenic
1081278707 11:41182932-41182954 CAAATCACATCTTACATGGATGG + Intronic
1081688275 11:45057756-45057778 GAAATCCCAGCCTAGATTAAGGG - Intergenic
1083122000 11:60521954-60521976 CAAGTCACATCTTACATGAATGG + Intronic
1085577518 11:77620338-77620360 CAAATCACATCTTACATGGAAGG - Intronic
1086075839 11:82851260-82851282 TAAATCCCATCCAAGTTCAAAGG - Intronic
1086576414 11:88343161-88343183 TTAATCCAATCATAGATTAATGG - Intergenic
1086580220 11:88390916-88390938 CAAGTCACATCTTACATGAATGG + Intergenic
1086651823 11:89301163-89301185 CAAATCACATCTTACATGGATGG + Intergenic
1086854368 11:91848821-91848843 TAAAGACCACTTTAGATGAAGGG + Intergenic
1087255409 11:95947763-95947785 TAAATCACATCTTATTTGGATGG + Intergenic
1087981593 11:104620643-104620665 TTATTCCCATTTTAGATGTAGGG - Intergenic
1088340416 11:108759177-108759199 TAAATAGCATCTGAGATAAATGG - Intronic
1088443992 11:109902970-109902992 CAAATCCCATTTTACATGGATGG + Intergenic
1088479260 11:110279184-110279206 TATATCCCATTTTATATGCAAGG + Intronic
1089022011 11:115225889-115225911 TTATCCCCATCTAAGATGAATGG - Intronic
1089732626 11:120528677-120528699 CAAGTCACATCTTACATGAATGG + Intronic
1089948190 11:122499726-122499748 AAAATACCATTTAAGATGAATGG + Intergenic
1093392130 12:18635923-18635945 TATATCCCTTCTAAGATAAAGGG - Intronic
1093581226 12:20785995-20786017 CAAGTCACATCTTAGATGGATGG - Intergenic
1094577174 12:31697516-31697538 TAAAACACATGTTTGATGAATGG - Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1096017695 12:48293516-48293538 TTAATCCCAATATAGATGAATGG - Intergenic
1096935972 12:55276746-55276768 TAAATCCCATATCAGATATAAGG - Intergenic
1097410871 12:59251205-59251227 TAAATACAATCTTTGATGATGGG + Intergenic
1097643239 12:62206238-62206260 GTATTCCCATCATAGATGAAAGG + Intronic
1099091838 12:78320813-78320835 CAAGTCCCATCTTACATGGATGG - Intergenic
1099329807 12:81269745-81269767 TAAATTCCATATTGAATGAAAGG - Intronic
1099635348 12:85205144-85205166 CAAGTCCCATCTTACATGGATGG - Intronic
1099692153 12:85969662-85969684 AAAATCCCATCTTAGACAAATGG + Exonic
1099839985 12:87953293-87953315 TAAAACCTGTCTTTGATGAAAGG + Intergenic
1100002024 12:89848816-89848838 TAAAGCCCATTTTAGATTTATGG - Intergenic
1100030929 12:90190137-90190159 CAAGTCACATCTTACATGAATGG - Intergenic
1100758715 12:97781828-97781850 CAAGTCCCATCTTACATGGATGG - Intergenic
1101084492 12:101222008-101222030 TAAATACCATAAAAGATGAAAGG + Intergenic
1101540579 12:105661214-105661236 TAAATGCCACCTTAGCTGAAAGG + Intergenic
1104176733 12:126340487-126340509 TAAATCACATCTTATGTGGATGG + Intergenic
1104213287 12:126711208-126711230 TAAATACCTCCTAAGATGAAGGG - Intergenic
1107678088 13:42817850-42817872 CAAGTCCCATCTTACATGGATGG + Intergenic
1107863165 13:44680391-44680413 TAAGTCACATCTTACATGGATGG - Intergenic
1107864673 13:44692173-44692195 GGAATCCCAGCTTAGATGCAAGG - Intergenic
1108931947 13:55835982-55836004 CAAATCCCATCTTATATGGATGG - Intergenic
1109649555 13:65308872-65308894 CAAATCACATCTTACATGGATGG + Intergenic
1110046411 13:70838533-70838555 CAAGTCACATCTTACATGAATGG - Intergenic
1110377730 13:74813529-74813551 TAAGTCACATCTTACATGGATGG - Intergenic
1110532089 13:76609639-76609661 CAAGTCACATCTTACATGAATGG + Intergenic
1111568035 13:90042296-90042318 CAAATCACATCTTACATGTATGG - Intergenic
1111799484 13:92964413-92964435 CAAATCACATCTTACATGGATGG - Intergenic
1112259433 13:97864651-97864673 TAAGTCCCGTCTTACATGGATGG + Intergenic
1113170506 13:107496765-107496787 CAAGTCACATCTTAGATGGATGG + Intronic
1113300391 13:109012729-109012751 TAAATCTCATCTGAGAGCAAAGG - Intronic
1113387718 13:109865044-109865066 TAAATCCCAACTTAGTTTGATGG - Intergenic
1115482480 14:33875020-33875042 CAAGTCACATCTTACATGAATGG + Intergenic
1115968342 14:38916834-38916856 CAAATCACATCTTACATGGATGG + Intergenic
1117367456 14:55043502-55043524 TAAATTCCAAATCAGATGAATGG + Exonic
1117379947 14:55151717-55151739 AAAATAGCATCTTAGAAGAAGGG - Exonic
1117886636 14:60371283-60371305 CAAATCACATCTTATGTGAATGG + Intergenic
1118239467 14:64042667-64042689 TAAATCACATCTTAGGTGGATGG - Intronic
1118239759 14:64044775-64044797 TAAGTCATATCTTACATGAATGG - Intronic
1120606359 14:86583406-86583428 TAAGTCACATCTTACACGAATGG - Intergenic
1120664536 14:87290667-87290689 TAAATTCCATTTTAGATTCAAGG + Intergenic
1120815574 14:88854260-88854282 TAAATGCCATCGTATATGGATGG - Intronic
1121844251 14:97159303-97159325 CAAATCACATCTTACATGGATGG + Intergenic
1124140639 15:27074029-27074051 CAAGTCCCATCTTACATGGATGG + Intronic
1124934028 15:34152586-34152608 TTCATCCCATCTTAGAGAAATGG + Intronic
1125053434 15:35328892-35328914 CAACTCCCATCTTACATGGATGG + Intronic
1126411624 15:48377906-48377928 CAAATCACATCTTACATGGATGG - Intergenic
1126903377 15:53337663-53337685 TAAATCCAATCTTATAGGATTGG - Intergenic
1127226087 15:56930848-56930870 TAAATCTGATCTTATCTGAAGGG + Intronic
1128485884 15:68088197-68088219 TATATCCCATTTTAAATTAAAGG + Intronic
1129563068 15:76592225-76592247 AAAATGGCATCTTAGAGGAAAGG + Intronic
1129574422 15:76726090-76726112 TAAATTCTATCTTTGATAAAGGG + Intronic
1130029653 15:80300285-80300307 TAAGTCCCTTATTAGATAAATGG + Intergenic
1130671633 15:85918036-85918058 TAAGTCACATCTTACATGGATGG - Intergenic
1131004195 15:88963047-88963069 TTAATCCCCTGTCAGATGAAAGG + Intergenic
1131005077 15:88971352-88971374 CAAGTCACATCTTAGATGGATGG + Intergenic
1131596659 15:93804458-93804480 TAAATCCCAAATAAAATGAAAGG - Intergenic
1132134010 15:99314712-99314734 TAAAACCCAGGTTAGGTGAAGGG - Intronic
1132194231 15:99898226-99898248 CAAATCACATCTTACATGGATGG + Intergenic
1136642866 16:31581406-31581428 CAAGTCACATCTTACATGAATGG + Intergenic
1137645378 16:50068472-50068494 TAAATCACATCATGTATGAAGGG - Intronic
1138019919 16:53469506-53469528 AAAATCACATCTTACATGAGTGG + Intronic
1139104946 16:63817409-63817431 TAAGTCGCATCTTACATGGATGG - Intergenic
1139186410 16:64811007-64811029 CAAATCCTATCTAAGCTGAAAGG - Intergenic
1139232012 16:65292536-65292558 TTAATCCCAACTTAAATAAATGG - Intergenic
1140758487 16:78090036-78090058 TAAAACCCACATTTGATGAAAGG + Intergenic
1140997468 16:80275106-80275128 AAGATCCCATCCTAGAGGAAGGG + Intergenic
1143721326 17:8812067-8812089 CAAGTCACATCTTAGATGGATGG + Intronic
1143915782 17:10291839-10291861 CAAGTCCCATCTTACATGGACGG - Intergenic
1146504794 17:33395376-33395398 CAAGTCACATCTTACATGAATGG + Intronic
1147679492 17:42231808-42231830 TTAAGCCCATCTTAGATTGAGGG - Intronic
1148569810 17:48659332-48659354 CAAATCACATCTTACATGGATGG - Intergenic
1149216327 17:54358505-54358527 AAAGTCACATCTTACATGAATGG + Intergenic
1149533101 17:57411399-57411421 CAAATACCAACTTAGTTGAATGG - Intronic
1151138729 17:71971758-71971780 CAAGTCCCATCTTACATGGATGG - Intergenic
1151341332 17:73472898-73472920 CAAATCACATCTTACATGGATGG - Intronic
1152884652 17:82842436-82842458 AAATTCCCATCTTCCATGAAGGG - Intronic
1155090912 18:22510152-22510174 CAAGTCCCATCTTACATGGATGG + Intergenic
1156395080 18:36691960-36691982 AAAATGCCATCTGAGTTGAAGGG + Intronic
1156808935 18:41224010-41224032 CAAGTCCCATCTTACATGGATGG - Intergenic
1156826439 18:41435137-41435159 GAAATCACATCTTACATGGATGG - Intergenic
1158026960 18:52910937-52910959 TAAAATCCATCTTATTTGAAAGG + Intronic
1159282281 18:66301582-66301604 CAAGTCCCATCTTACATGGATGG - Intergenic
1159367499 18:67487896-67487918 TAAATACCATTCTAGAAGAAAGG + Intergenic
1159433226 18:68383323-68383345 CAAGTCCCATCTTACATGGATGG - Intergenic
1159437493 18:68438091-68438113 CAAATCACATCTTACATGGATGG + Intergenic
1159622395 18:70653655-70653677 TAAATGCAATCTAAGATAAAGGG - Intergenic
1159751171 18:72304032-72304054 TAAGTCCCAGCTTACATGGATGG + Intergenic
1160217573 18:76946274-76946296 CAAATCACATCTTACATGGATGG - Intronic
1161562369 19:4980791-4980813 TAAATGCCCACTGAGATGAATGG - Intronic
1168453235 19:56482743-56482765 TTAATCCCTTGTTAGATGCATGG + Intergenic
924984875 2:261994-262016 AAAATTCCATCTAAGATCAAAGG + Intronic
925526882 2:4813153-4813175 CAAATCACATCTTACATGGATGG + Intergenic
925845574 2:8030346-8030368 TAAGTCCCAGCTCAAATGAATGG + Intergenic
926496488 2:13594811-13594833 CAAATCACATCTTATATGGATGG + Intergenic
926663096 2:15490482-15490504 CTGATCCCATCTTAGAGGAAGGG - Intronic
927245516 2:20954464-20954486 AAAGTCCCATCTTACATGGATGG + Intergenic
927360071 2:22222891-22222913 CAAGTCACATCTTATATGAATGG - Intergenic
927360341 2:22224809-22224831 TAAGTCACATCTTACATGGATGG - Intergenic
929077558 2:38091064-38091086 CATATCCCCTCTTAGATGAATGG + Intronic
929377509 2:41307395-41307417 TAAAACCATTCTTAGCTGAAGGG - Intergenic
930263262 2:49171175-49171197 AAAGTCCCATCTTACATGGATGG - Intergenic
930556581 2:52903378-52903400 TAAATAACATTTTAGATGACTGG - Intergenic
931033642 2:58212199-58212221 CAAGTCCCATCTTACATGGATGG + Intronic
931083258 2:58799857-58799879 TGAATCCCATATGAGATGACTGG - Intergenic
931154809 2:59615895-59615917 AAAGTCACATCTTATATGAATGG + Intergenic
931487489 2:62707005-62707027 TAAATCCCATCTTAGATGAATGG - Exonic
932205022 2:69872677-69872699 TGACCCCCATCTTACATGAAAGG + Intronic
933267459 2:80197477-80197499 TTATTCCCATCTTACAAGAATGG + Intronic
934105055 2:88687873-88687895 CAAGTCACATCTTACATGAATGG - Intergenic
934107043 2:88704392-88704414 CAAGTCCCATCTTACATGGATGG + Intronic
934625138 2:95841435-95841457 TAGATTCCATCTCAGATGGATGG - Intronic
934808427 2:97259834-97259856 TAGATTCCATCTCAGATGGATGG + Intronic
934829082 2:97497352-97497374 TAGATTCCATCTCAGATGGATGG - Intronic
938241616 2:129746760-129746782 CAAGTCACATCTTACATGAATGG + Intergenic
939498413 2:142950467-142950489 CAAATCACATCTTACATGGATGG + Intronic
939694803 2:145311335-145311357 CAAATCACATCTTACATGTATGG + Intergenic
940969861 2:159884146-159884168 CAAGTCACATCTTACATGAATGG - Intronic
941274162 2:163469720-163469742 CAAATCTCAGCTAAGATGAAAGG - Intergenic
943313361 2:186354373-186354395 CAAATCACATCTTACATGGATGG - Intergenic
943417662 2:187629455-187629477 CAAGTTCCATCTTACATGAATGG - Intergenic
943825608 2:192387369-192387391 TAAGTCACATCTTACATGGATGG + Intergenic
943913318 2:193595525-193595547 CAAGTCCCATCTTACATGGATGG + Intergenic
944342603 2:198620933-198620955 CAAGTCACATCTTACATGAATGG + Intergenic
945360268 2:208887664-208887686 CAAATCACATCTTACATGGATGG - Intergenic
945399347 2:209361245-209361267 AAAATGGCATCTTAGATCAAGGG + Intergenic
946897523 2:224339460-224339482 TAAATCCCTTCATAGTTGATAGG + Intergenic
947345478 2:229185559-229185581 TAAGTCACATCTTACATGAATGG + Intronic
947345731 2:229187443-229187465 CAAGTCACATCTTACATGAACGG + Intronic
948518045 2:238518480-238518502 TAAATACCATCTTAGACTCAGGG + Intergenic
1169569758 20:6893075-6893097 TCAAGCACATCTTATATGAAAGG - Intergenic
1169933476 20:10858365-10858387 TAAATCCCATCTAACTTAAAAGG + Intergenic
1170079146 20:12451693-12451715 CAAGTCACATCTTACATGAATGG - Intergenic
1170079746 20:12460921-12460943 TTAATCCCTTATTAGATAAATGG + Intergenic
1170185861 20:13589698-13589720 TAAATCCCTTATTAGATACATGG - Intronic
1171096620 20:22338171-22338193 TAAATCCCATCTGTGATGCATGG + Intergenic
1172338537 20:34136814-34136836 TTAATCCCTTGTTAGATGAATGG - Intergenic
1175183381 20:57164093-57164115 CAAGTCACATCTTACATGAATGG - Intergenic
1175408504 20:58750971-58750993 CAAGTCCCATCTTACATGGATGG - Intergenic
1176358379 21:5971790-5971812 CAAGTCACATCTTACATGAATGG - Intergenic
1177130567 21:17249387-17249409 TAAGTCACATCTTACATGGATGG - Intergenic
1177841309 21:26236840-26236862 TAAATACAATCTGGGATGAAGGG - Intergenic
1177872514 21:26590548-26590570 AAAATGCCATCTTAGAAGAAGGG + Intergenic
1179284546 21:39966300-39966322 CAAATCACATCTTACATGGATGG + Intergenic
1179331934 21:40412075-40412097 CAAGTCACATCTTAGATGGATGG - Intronic
1179450333 21:41464203-41464225 CAAATCACATCTTACATGGATGG - Intergenic
1179765139 21:43566760-43566782 CAAGTCACATCTTACATGAATGG + Intronic
1181285265 22:21747566-21747588 TAAATGGCAACTTAGATGAATGG + Intergenic
1182438289 22:30345503-30345525 TAAATCCCATCCAAGAGGGATGG + Intronic
1182863196 22:33579291-33579313 CAAGTCCCATCTTACATGGATGG - Intronic
1182864109 22:33587184-33587206 TAAATCCCAACATTCATGAAAGG - Intronic
1183043453 22:35200886-35200908 CAAGTCCCATCTTACATGGATGG - Intergenic
1184266273 22:43348350-43348372 CAAGTCCCATCTTACATGGATGG + Intergenic
949131053 3:501712-501734 AAAATCCTTTCCTAGATGAAAGG - Intergenic
949155609 3:823509-823531 CAAATCACATCTTACATGGATGG - Intergenic
952741630 3:36739571-36739593 CAAGTCCCATCTTACATGGATGG - Intronic
953343034 3:42151512-42151534 TCTATCCCATTTTGGATGAAGGG + Intronic
953358487 3:42274710-42274732 CAAGTCACATCTTACATGAATGG + Intergenic
953862802 3:46559621-46559643 TAGTTCCCATCTTAGAGGAATGG + Intronic
955872669 3:63456026-63456048 CAAGTCACATCTTAGATGGATGG + Intronic
956169665 3:66422890-66422912 CAAATCACATCTTACATGGATGG + Intronic
957433504 3:80144938-80144960 TGTTTCCCATCTTAGAGGAAAGG + Intergenic
957835357 3:85581601-85581623 TAAATGCCCTCTTAAATTAAAGG - Intronic
957936640 3:86952160-86952182 AAAATCCCATTTGAGTTGAAAGG - Intronic
957950106 3:87113710-87113732 CAAGTCACATCTTACATGAATGG + Intergenic
957958531 3:87220378-87220400 CAAGTCACATCTTACATGAATGG + Intergenic
958423828 3:93958770-93958792 CAAGTCCCATCTTATATGAATGG - Intronic
958550712 3:95608265-95608287 TAAGTCACATCTTACATGGATGG + Intergenic
958577595 3:95973025-95973047 TAAGTCGCATCTTACATGGATGG - Intergenic
958831569 3:99097009-99097031 TAAATCCCCTCTTCCAAGAATGG + Intergenic
958837065 3:99158202-99158224 CAAATCACATCTTAGGTGGATGG - Intergenic
959649788 3:108740426-108740448 TAAATCCCCTCTTAGGTGAGAGG - Intergenic
959973556 3:112432950-112432972 TAAGTCACATCTTACATGGATGG - Intergenic
960053785 3:113261896-113261918 TAAATCCCACCTCAACTGAAAGG + Intronic
960626654 3:119687835-119687857 CAAGTCCCATCTTACATGGATGG + Intergenic
961067648 3:123890031-123890053 CAAGTCACATCTTACATGAATGG + Intergenic
961764745 3:129200629-129200651 CAACTCCCATCTAAGATGAAAGG + Intergenic
962166713 3:133056863-133056885 TAAATCTCACTTTACATGAAAGG - Intronic
962946125 3:140172724-140172746 CAAGTCCCATCTTACATGCATGG + Intronic
963072961 3:141320046-141320068 CAAGTCACATCTTACATGAATGG + Intergenic
963477467 3:145825003-145825025 TAAATCACATCTTACATGGATGG - Intergenic
963568702 3:146964345-146964367 CAAATCACATCTTATATGGATGG + Intergenic
963802785 3:149694087-149694109 TTAATCCCTTGTTAGATGGATGG - Intronic
964353501 3:155826629-155826651 AAAATCCCATCCTAGAGGCAAGG - Exonic
964580488 3:158230012-158230034 TAGATCGCATCCTAGGTGAAGGG - Intronic
964646720 3:158966543-158966565 TAATTCCCCTCTTAGAGAAAAGG + Intronic
965282828 3:166775639-166775661 CAAGTCACATCTTACATGAATGG + Intergenic
965823179 3:172705416-172705438 TACATCCCATGTTACATGATGGG - Intronic
965863925 3:173182376-173182398 CAAGTCACATCTTACATGAATGG - Intergenic
965864936 3:173194877-173194899 CAATTCGCATCTTACATGAATGG - Intergenic
966352679 3:179047282-179047304 TAAGCCCCATCCTAGAGGAAAGG + Intronic
967521148 3:190434435-190434457 CAAGTCACATCTTAGATGGATGG - Intronic
967908460 3:194521085-194521107 TAAGTCACATCTTACATGAATGG - Intergenic
970366732 4:15366686-15366708 TAAGTCCCATGTTATTTGAAAGG - Intronic
970838411 4:20438368-20438390 TAAGTCACATCTTACGTGAATGG + Intronic
971150806 4:24029569-24029591 TAATGCCTATCTTAGAGGAAGGG + Intergenic
972176570 4:36414902-36414924 TCAATTTCAACTTAGATGAAAGG + Intergenic
972959232 4:44431709-44431731 AAAAGACCATCTTAGAGGAATGG - Intronic
973107894 4:46362326-46362348 TAAGTCACATCTTACATGGATGG - Intronic
973261702 4:48171764-48171786 TAAATAATATTTTAGATGAATGG + Intronic
973552168 4:52047152-52047174 CAAGTCACATCTTACATGAATGG + Intergenic
974309339 4:60184304-60184326 TGAATTCCATCTTACCTGAAAGG + Intergenic
974352845 4:60772626-60772648 CAAGTCACATCTTACATGAATGG + Intergenic
974517599 4:62937138-62937160 TAAGTCACATCTTACATGGATGG - Intergenic
974717047 4:65680372-65680394 CAAGTCACATCTTACATGAATGG - Intergenic
974808173 4:66909305-66909327 TAAATCCAATGGTATATGAAAGG - Intergenic
975896565 4:79099650-79099672 CAAGTCACATCTTAGATGGATGG - Intergenic
976635814 4:87285466-87285488 CAAATCACATCTTACATGGATGG - Intergenic
976947584 4:90789719-90789741 CAAGTCACATCTTACATGAATGG - Intronic
977369328 4:96115212-96115234 CAAGTCACATCTTACATGAATGG + Intergenic
977695248 4:99957535-99957557 CAAGTCCCATCTTACATGGATGG - Intergenic
978266479 4:106832280-106832302 CAAATCTCATATTAGATAAAGGG + Intergenic
978958207 4:114640702-114640724 CAAGTCACATCTTACATGAATGG + Intronic
979136270 4:117115872-117115894 CAAGTCCCGTCTTACATGAATGG + Intergenic
979162371 4:117479734-117479756 CAAATCACATCTTACATGAATGG + Intergenic
979391753 4:120137225-120137247 CAAGTCCCATCTTACATGGATGG + Intergenic
979426539 4:120573573-120573595 TAAGTCACATCTTACATGGATGG + Intergenic
979464508 4:121021372-121021394 TAAGTCACATCTTACATGAATGG + Intergenic
979464766 4:121023311-121023333 TAAGTTACATCTTACATGAATGG + Intergenic
979613907 4:122719779-122719801 TCAAGCCCAGGTTAGATGAAGGG + Intergenic
980494850 4:133577364-133577386 CAAATCACATCTTATATGGATGG - Intergenic
981360308 4:143838570-143838592 TAAATCCTCTGTCAGATGAATGG + Intergenic
981371078 4:143959637-143959659 TAAATCCCCTGTCAGATGAATGG + Intergenic
982901961 4:161017219-161017241 CAAATCACATCTTACATGGATGG - Intergenic
983774030 4:171584042-171584064 TGAATCACATTTTAGATGACTGG + Intergenic
984143500 4:176032978-176033000 TAAATAACAGATTAGATGAATGG + Intergenic
986197848 5:5554401-5554423 CAAATCACATCTTACATGGATGG + Intergenic
986827066 5:11533375-11533397 TAAATCCCACCCTAGGTGGAAGG - Intronic
986852592 5:11830509-11830531 CAAGTCCCATCTTACATGGATGG - Intronic
987471085 5:18329115-18329137 TAAATCCCAGCTTAAGTAAAAGG + Intergenic
987810281 5:22826269-22826291 CAAGTCACATCTTACATGAATGG - Intronic
987860384 5:23479084-23479106 ATAATCCCATCATAAATGAAGGG + Intergenic
988335896 5:29908983-29909005 TAAGTCACATCTTACATGAATGG + Intergenic
988740801 5:34067484-34067506 CAAGTCACATCTTACATGAATGG + Intronic
990264735 5:54062575-54062597 TAAATCACATCTTATGTGGATGG - Intronic
990329734 5:54713802-54713824 CAAACCACATCTTATATGAATGG - Intergenic
990525945 5:56628025-56628047 CAAGTCCCATCTTACATGGATGG - Intergenic
990951217 5:61300259-61300281 CAAGTCACATCTTAGATGGATGG - Intergenic
991205216 5:64042130-64042152 TAAATGTCATCTTAGAGGTAGGG - Intergenic
992651390 5:78864317-78864339 CAAGTCCCATCTTACATGGATGG + Intronic
992924336 5:81566454-81566476 CAAGTCCCATCTTACATGGACGG - Intronic
993247788 5:85473775-85473797 TAAATGTAATGTTAGATGAAGGG - Intergenic
993400089 5:87438887-87438909 TTAATCCCTTATTAGATGTATGG + Intergenic
993840320 5:92870045-92870067 TTAATCCCTTGTCAGATGAATGG + Intergenic
994070076 5:95590863-95590885 GAAATCCCACCTTTGAAGAAGGG - Intronic
994122471 5:96132096-96132118 TCAATCCAATCTTAAATGTATGG + Intergenic
994347817 5:98708059-98708081 TTTAATCCATCTTAGATGAAGGG - Intergenic
994576622 5:101586931-101586953 TAAGTCACATCTTACATGAATGG - Intergenic
994941196 5:106326521-106326543 CAAGTCACATCTTAGGTGAATGG + Intergenic
995147918 5:108807175-108807197 CAAATCACATCTTACATGGATGG - Intronic
995259539 5:110086054-110086076 TAAATTTCATCTTCAATGAAAGG + Intergenic
996031061 5:118704219-118704241 CAAGTCCCATCTTACATGGATGG + Intergenic
997964996 5:138349811-138349833 TGACCCACATCTTAGATGAAGGG - Intergenic
1000473078 5:161670705-161670727 TAAATCCCATTTGAGACCAAAGG - Intronic
1000761786 5:165234452-165234474 CAAGTCACATCTTACATGAATGG - Intergenic
1001122887 5:168994510-168994532 TAAATCCCATCTTACCTCCAAGG + Intronic
1001356844 5:171035136-171035158 TAAATGCCATCTTATCAGAAAGG - Intronic
1002016722 5:176330089-176330111 TAAATTCCAGTTTACATGAAAGG + Intronic
1004031254 6:11871609-11871631 TAAGTCCCATCTCACATGGATGG + Intergenic
1004508414 6:16264894-16264916 CAAGGCCCATCTTAGGTGAAAGG - Intronic
1008248324 6:49206734-49206756 CAAGTCACATCTTACATGAATGG + Intergenic
1009951327 6:70400168-70400190 CAAGTCACATCTTACATGAATGG + Intergenic
1010060521 6:71617107-71617129 TAAATCACATCTTACATGGATGG - Intergenic
1010920502 6:81674168-81674190 CAAGTCCCATCTTACATGGATGG + Intronic
1011009297 6:82685825-82685847 TAAATCTCATCTTAGGTTAGGGG + Intergenic
1011152384 6:84289118-84289140 TAAGTCACATCTTACATGGATGG + Intergenic
1011152699 6:84291384-84291406 TAAGTCACATCTTACATGGATGG + Intergenic
1012194045 6:96317296-96317318 TAAGTCACATCTTACATGGATGG + Intergenic
1012382547 6:98637730-98637752 CAAATCCCAGCTTAGGAGAAGGG + Intergenic
1012812756 6:103981804-103981826 TAAGTCACATCTTACATGGATGG - Intergenic
1013918020 6:115365804-115365826 CAAGTCACATCTTAGATGGATGG - Intergenic
1014038476 6:116796157-116796179 TCAATCCCATGTTGAATGAAGGG + Intronic
1014407146 6:121065653-121065675 CAAACCCCATCTTACATGTATGG - Intergenic
1014973853 6:127853812-127853834 TTATTCCCATTTTACATGAAAGG + Intronic
1015013310 6:128377293-128377315 CAAATCACATCTTACATGGATGG + Intronic
1015130739 6:129806185-129806207 CAAGTCACATCTTACATGAATGG - Intergenic
1015367956 6:132418297-132418319 CAAGTCACATCTTACATGAATGG + Intergenic
1016153323 6:140771587-140771609 TAAGTCACCTCTTACATGAATGG - Intergenic
1016537761 6:145127286-145127308 CAAATCACATCTTACATGGATGG - Intergenic
1018320745 6:162606038-162606060 CAAATCTAATCTTGGATGAAAGG - Intronic
1018962935 6:168461135-168461157 CAAGTCCCATCTTACATGGATGG + Intronic
1019098514 6:169608479-169608501 CAAGTCCCATCTTACATGAATGG + Intronic
1021765084 7:23940731-23940753 TAAAACCCATCCTGGAGGAATGG - Intergenic
1022734680 7:33064638-33064660 CAAGTCCCATCTTACATGGATGG - Intergenic
1023190604 7:37576889-37576911 TAAATCCCAACTTTAATGAAAGG + Intergenic
1023316588 7:38944130-38944152 TAAAACCCAACTAAGATCAATGG - Intergenic
1023929732 7:44697909-44697931 GACATCCCATCTGAGATGGATGG - Intronic
1024139548 7:46447944-46447966 TAAATGCAATCTTAGTTTAATGG + Intergenic
1024438682 7:49389206-49389228 CAAGTCCCATCTTACATGAATGG + Intergenic
1026049227 7:66930996-66931018 AAAATCTCATTTAAGATGAATGG + Intronic
1026066424 7:67077639-67077661 TTAATCCCTTGTTTGATGAATGG + Intronic
1026663074 7:72319324-72319346 CAAGTCACATCTTACATGAATGG + Intronic
1026710502 7:72734700-72734722 TTAATCCCTTGTTTGATGAATGG - Intronic
1027860130 7:83567259-83567281 TAAAACAAATATTAGATGAAGGG + Intronic
1027885496 7:83899456-83899478 CAAATCACATCTTACATGCAAGG - Intergenic
1027979503 7:85199985-85200007 TAAATCACATCTTACGTGGATGG - Intergenic
1029862734 7:103591162-103591184 TACCTGCCATCTTATATGAATGG + Intronic
1029874703 7:103737988-103738010 GAAATAGCATCTTAGATGACTGG - Intronic
1030070272 7:105692324-105692346 TAAATCCCATAGGAGAAGAAAGG + Intronic
1030628681 7:111871555-111871577 TAAATCCTAACATAAATGAATGG + Intronic
1031042514 7:116853664-116853686 TCAATCACTTCTTAGATGAGTGG - Intronic
1031257728 7:119477823-119477845 TAAATCCCATATTTCTTGAAAGG + Intergenic
1031692776 7:124811094-124811116 TAGATCACATGTTAGATGAAAGG + Intergenic
1031769751 7:125828992-125829014 CAAGTCCCATCTTACATGGATGG - Intergenic
1032275889 7:130455008-130455030 CAAATCACATCTTACATGAATGG + Intergenic
1032320774 7:130884733-130884755 TAGATCCCATCACAGAAGAAAGG + Intergenic
1032608910 7:133389864-133389886 TAAGTCACATCTTACATGGATGG + Intronic
1033167170 7:139050115-139050137 TTAATCCCATATCAGATGTATGG + Intronic
1033385178 7:140866770-140866792 TAAGTACCATCCTAGATGCATGG - Intronic
1034748391 7:153544665-153544687 CAAGTCCCATCTTACATGGATGG + Intergenic
1034832952 7:154325305-154325327 TACATCCCATCTGAGCAGAATGG - Intronic
1038476841 8:27874671-27874693 TGAATCTTATCTTAGATAAAAGG + Intronic
1038808842 8:30819415-30819437 CAAATCACATCTTACATGGATGG + Intergenic
1038928264 8:32164737-32164759 CATATCCCATCTTTGATTAAAGG - Intronic
1038940708 8:32301650-32301672 CAAATCACATCTTAGGTGGATGG + Intronic
1039016992 8:33160814-33160836 TAAATCCCTTATTGGAGGAATGG + Intergenic
1039411225 8:37356918-37356940 TAACTCCTATATCAGATGAATGG + Intergenic
1041326642 8:56673619-56673641 TAAATTTCATGTTAGAAGAAAGG + Intergenic
1042082944 8:65075911-65075933 TAAATCCTATGAAAGATGAAGGG + Intergenic
1044168406 8:89018230-89018252 CAAATCACATCTTAGATGGATGG + Intergenic
1044439070 8:92201636-92201658 CAAGTCACATCTTACATGAATGG + Intergenic
1045716807 8:105056438-105056460 AAAATCACATCTTACATGGATGG - Intronic
1045753854 8:105518151-105518173 TAAATGCCATCTTTGAAGAGAGG + Intronic
1046061491 8:109144953-109144975 CAAGTCCCATCTTACATGAATGG - Intergenic
1048064790 8:130956841-130956863 CACATCCCATCTTACATGAATGG - Intronic
1048112136 8:131479999-131480021 TAAATCCCATCTTTGGTAGAAGG + Intergenic
1048189149 8:132272601-132272623 CAAATCACATCTTACATGGATGG + Intronic
1048264942 8:132977596-132977618 CAAGTCACATCTTACATGAATGG + Intronic
1048586542 8:135779281-135779303 TAAGTCACATCTTACATGGATGG + Intergenic
1048769602 8:137881713-137881735 TAAGTCACATCTTACATGGATGG - Intergenic
1049076454 8:140400053-140400075 TAAGTCCCGTCTTACATGGATGG - Intronic
1050263909 9:3870560-3870582 CAAGTCCCATCTTACATGGATGG + Intronic
1050502433 9:6313243-6313265 CAAGTCCCATCTTACATGGATGG + Intergenic
1050794588 9:9522323-9522345 TAAAGCCCATAGTAGATGGAAGG + Intronic
1050822574 9:9899300-9899322 TTAATCCCTTATTAGATGCACGG - Intronic
1051015731 9:12473988-12474010 CAAGTCACATCTTATATGAATGG - Intergenic
1052655778 9:31358273-31358295 CAAATCACATATTACATGAATGG + Intergenic
1054898105 9:70336960-70336982 CAAGTCACATCTTACATGAATGG + Intronic
1055342035 9:75294022-75294044 CAAGTCACATCTTACATGAATGG + Intergenic
1055922788 9:81479163-81479185 AAATGCCCATCTTTGATGAATGG + Intergenic
1055994918 9:82146922-82146944 TCAATAACATGTTAGATGAAAGG - Intergenic
1056475897 9:86950610-86950632 CAAATCACATCTTACATGGATGG + Intergenic
1056593216 9:87981586-87981608 TTAATCCCCTGTTGGATGAATGG - Intergenic
1059493631 9:114691133-114691155 TAAATGACATCTTAAATGACTGG - Intergenic
1059738766 9:117128831-117128853 CAAGTCCCATCTTACATGGATGG + Intronic
1060449534 9:123723666-123723688 CAAATCACATCTTACATGGATGG - Intronic
1186046240 X:5539365-5539387 CAAGTCACATCTTACATGAATGG - Intergenic
1186223772 X:7375978-7376000 CAAGTCACATCTTACATGAATGG - Intergenic
1187072485 X:15902042-15902064 CAAATCACATCTTATATGGATGG + Intergenic
1187179013 X:16925622-16925644 TAACTCCCATTTTAGTTAAAGGG + Intergenic
1188621979 X:32236641-32236663 CAAGTCACATCTTACATGAATGG - Intronic
1189637335 X:43024604-43024626 TAAGTCACATCTTACATGGATGG + Intergenic
1189862734 X:45290291-45290313 CAAGTCCCGTCTTACATGAATGG + Intergenic
1190376177 X:49790618-49790640 CAAGTCACATCTTACATGAATGG + Intergenic
1191760208 X:64638822-64638844 TAAGTCACATTTTACATGAATGG + Intergenic
1192511860 X:71725338-71725360 CAAATGCAATCTGAGATGAAGGG - Intergenic
1192514837 X:71756167-71756189 CAAATGCAATCTGAGATGAAGGG + Intergenic
1192528107 X:71865107-71865129 CAAATGCAATCTGAGATGAAGGG + Intergenic
1192744474 X:73925331-73925353 TAAATCCCTTATCAGATGTATGG + Intergenic
1193939612 X:87665150-87665172 TATAACCCATCTTATATAAAAGG + Intronic
1194398470 X:93414544-93414566 TAAATGCCTTCTAAGAAGAAAGG - Intergenic
1194941382 X:100015392-100015414 CAAATCACATCTTACATGGATGG - Intergenic
1196169668 X:112573843-112573865 CAAGTCCCATCTTACATGGATGG - Intergenic
1196278690 X:113797684-113797706 CAAGTCCCATCTTACATGGATGG - Intergenic
1196390341 X:115201087-115201109 CAAGTCACATCTTACATGAATGG + Intronic
1196540515 X:116901460-116901482 CAAGTCACATCTTACATGAATGG + Intergenic
1197002961 X:121460759-121460781 CAAATCACATCTTAAGTGAATGG - Intergenic
1198037186 X:132812808-132812830 AAAACCCCATCTCAGAGGAAGGG + Intronic
1198919217 X:141707408-141707430 CAAATCACATCTTATGTGAATGG + Intergenic
1199277973 X:145968966-145968988 CAAGTCACATCTTACATGAATGG - Intergenic
1199282286 X:146016103-146016125 TAAGTCACATCTTACATGGATGG + Intergenic
1199934880 X:152562843-152562865 CAAGTCACATCTTAGGTGAATGG - Intergenic
1202069765 Y:20978784-20978806 TAACTGCCACCTTAAATGAAAGG + Intergenic