ID: 931489225

View in Genome Browser
Species Human (GRCh38)
Location 2:62725962-62725984
Sequence CTGTGCAAGCAGAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931489222_931489225 -3 Left 931489222 2:62725942-62725964 CCCTAGGGCGCTCAAGGCTTCTG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 253
931489221_931489225 -2 Left 931489221 2:62725941-62725963 CCCCTAGGGCGCTCAAGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 44
Right 931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 253
931489223_931489225 -4 Left 931489223 2:62725943-62725965 CCTAGGGCGCTCAAGGCTTCTGT 0: 1
1: 0
2: 1
3: 30
4: 375
Right 931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931489225 Original CRISPR CTGTGCAAGCAGAAGTGGCC AGG Intronic
900143175 1:1147001-1147023 CTCTGCAAGTGCAAGTGGCCAGG - Intergenic
900237859 1:1601003-1601025 CTGTGTATGCAGACGTGGCCGGG + Intergenic
901036163 1:6337511-6337533 ATGGGCCAGCAGAAGCGGCCAGG + Intronic
902148667 1:14424840-14424862 CTCAGCAAGCAGATGGGGCCTGG - Intergenic
903210274 1:21814412-21814434 CTGTGCGGGCAGACGTGGCAGGG + Exonic
903691733 1:25178904-25178926 CTATGCAGGCAGAAGTGGGAGGG - Intergenic
904162489 1:28531969-28531991 GTGTCTAAGCAAAAGTGGCCAGG + Exonic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
905500845 1:38435065-38435087 CTGTGCATTGAGAAGTGGGCTGG - Intergenic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
906907525 1:49911916-49911938 CTGTGCAAGCAGTTGTGAGCTGG - Intronic
907525461 1:55051354-55051376 CTGCGCCAGCGGAAATGGCCTGG - Intronic
908581128 1:65518559-65518581 CGGTGAAACCAAAAGTGGCCAGG - Intronic
911369446 1:96979093-96979115 CTTTGCAAGCACAAGTGAGCAGG + Intergenic
911702456 1:100969488-100969510 ATGTGCAAGCAGCTGTGTCCGGG + Intronic
912789130 1:112634148-112634170 CTGTGCAAGCAGAACTTACCAGG + Intronic
913201240 1:116496546-116496568 CTGTGAAAGCAGAGCTGGCCTGG - Intergenic
914349318 1:146826749-146826771 CTTTGCTAGCAGAGGTGGCGTGG - Intergenic
914846862 1:151288283-151288305 ATGTGTAAGCAGAGGTGGCCGGG - Exonic
915527163 1:156483025-156483047 CTGTGGCAGCAGAAGAGTCCTGG + Intronic
915680260 1:157575010-157575032 CTGTGCAGGCAGAAGTGAAGGGG + Exonic
916728393 1:167544158-167544180 CTGTGCATGCAGGAGAGGCACGG - Intronic
918239366 1:182608357-182608379 ATCTGCAAGCAGAGTTGGCCAGG + Intergenic
918240896 1:182619253-182619275 TTATTAAAGCAGAAGTGGCCTGG - Intergenic
918805313 1:189033364-189033386 CTGTGTAAGCAAAATTAGCCAGG + Intergenic
920521900 1:206634106-206634128 CTGTGAAAGCAGAATTGCTCTGG + Intergenic
921069774 1:211649387-211649409 GTGTGCAAGCTGATGTGTCCAGG - Intergenic
922679454 1:227579715-227579737 CCCTGCAAGCAGACATGGCCAGG + Intronic
1067334922 10:45353280-45353302 CTGTGCCATCAGAAGTAGGCAGG - Intergenic
1067547572 10:47205416-47205438 CAGTCTAAGCATAAGTGGCCAGG + Intergenic
1068208276 10:53886297-53886319 CTGTGTAACCAGGAGTGGACAGG - Intronic
1069334144 10:67328312-67328334 CTCTGCAAGCAGGTGTAGCCAGG + Intronic
1069546984 10:69335615-69335637 CTGGGCAAGAATGAGTGGCCAGG - Intronic
1071494245 10:86156855-86156877 CTGGGCCAACAGAAGTGGTCTGG + Intronic
1072443920 10:95481270-95481292 CTGTGTCAGCAGGTGTGGCCTGG - Intronic
1072785360 10:98275765-98275787 CTGGGCAGGCAGAAGAGACCCGG + Intergenic
1075180383 10:120205793-120205815 CTCAGCATGCAGAAGTGTCCAGG - Intergenic
1076152667 10:128175345-128175367 CTATGCCAGCACATGTGGCCTGG + Intergenic
1076634454 10:131873289-131873311 CTGTGCAGGGGAAAGTGGCCAGG - Intergenic
1079556033 11:21759876-21759898 TGCTGCAAGCAGATGTGGCCAGG + Intergenic
1083696383 11:64445583-64445605 CTATGGAAGCAGAAGACGCCAGG + Intergenic
1088454817 11:110022542-110022564 CTGTGAAAGCAAAAATGGCAAGG - Intergenic
1088625425 11:111727143-111727165 CAGTGCAGGCAGAGGTGGCGAGG - Exonic
1088806575 11:113358464-113358486 CTCAGCAAGCAGGTGTGGCCTGG + Intronic
1089325701 11:117655249-117655271 ATGTGCAGGCAGAAGAGGGCTGG + Intronic
1089678081 11:120103884-120103906 CTCTGCGAGCTGATGTGGCCTGG + Intergenic
1091218898 11:133919302-133919324 CTTAGCAAGCAGCAGGGGCCGGG + Intronic
1091564769 12:1640034-1640056 CTGTGCCACCAGCCGTGGCCTGG + Intronic
1092395368 12:8121475-8121497 CTGGGAGAGCAGCAGTGGCCTGG + Intergenic
1095484149 12:42666865-42666887 CTTTACATGCAGAAGTGGGCGGG + Intergenic
1098704035 12:73664925-73664947 CTGTGCAAGCAGGCATGACCAGG - Intergenic
1100455618 12:94748839-94748861 CTTTGCAACCAGCTGTGGCCAGG + Intergenic
1100459553 12:94785874-94785896 CTTTGCAACCAGAGGAGGCCAGG - Intergenic
1100693870 12:97068843-97068865 CAGTCCAAGCAAAAGTGGACTGG - Intergenic
1101480513 12:105092272-105092294 CTGTTAAAGAAGAAGTGGCTTGG - Intergenic
1102286856 12:111664712-111664734 CTGTCCACCCACAAGTGGCCTGG - Intronic
1102454076 12:113060802-113060824 CTGTGAGAGCAGAAGTGGGTAGG + Intronic
1103942356 12:124508054-124508076 CTGTGCCAGCAGCAGCGTCCAGG + Intronic
1104920439 12:132287791-132287813 CTGGGCAAGCAGACGCGGCTTGG + Intronic
1105020098 12:132810326-132810348 ACGTGCAAGCAGATGTGGGCAGG - Intronic
1107825559 13:44325987-44326009 ATGTGGAAAGAGAAGTGGCCAGG - Intergenic
1108672815 13:52709040-52709062 CTTTGCAATTAGAAGTGGCCAGG + Intronic
1111674322 13:91368314-91368336 CTTTGCAAGCAGAAGTGAAAGGG + Intergenic
1112929151 13:104713594-104713616 CTGAGCAGGCAGGAGTGACCTGG + Intergenic
1113117047 13:106885182-106885204 CTGTCCAGGCAGGAGTGGCAGGG + Intergenic
1115653341 14:35419695-35419717 CTGTGCAGGAAGGAGGGGCCAGG + Intergenic
1116154671 14:41187859-41187881 CTGTGCAACCAGAACAGGGCCGG + Intergenic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118901131 14:69986888-69986910 CTGTAGGAGCAGAAGTGGTCGGG - Intronic
1119711690 14:76827233-76827255 CAGTGCAGGTAGCAGTGGCCTGG - Intronic
1120436896 14:84493803-84493825 CTGAGCAACCAGAAGTGCTCGGG - Intergenic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1123496538 15:20832754-20832776 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1123553775 15:21406344-21406366 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1123590017 15:21843709-21843731 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1125719862 15:41840150-41840172 CTCTGCAGGCAGAGGTGTCCAGG + Exonic
1125782634 15:42283794-42283816 CTGTGTCTGCAGAAATGGCCAGG + Intronic
1126506224 15:49406946-49406968 CCCTGCAAGCAGATGTGGCAAGG + Intronic
1127880334 15:63151686-63151708 CTGTGCAAGCTGAAGTGCCTTGG + Exonic
1128214073 15:65922412-65922434 CTGTGCACGCAGAGGGGGCATGG + Exonic
1131168231 15:90158259-90158281 CTGTGCAAGCAGCTTTGCCCAGG + Intergenic
1131416796 15:92266949-92266971 CTGTGCAAGTCTCAGTGGCCTGG - Intergenic
1202962121 15_KI270727v1_random:133540-133562 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1133032134 16:3016272-3016294 CTGTGCAAGCAGCCCTGCCCTGG + Intronic
1134292013 16:12909369-12909391 TTGTGCAAGAAGAAGTGCTCAGG + Intronic
1134688545 16:16175546-16175568 CTGTCAAAGCATAAGTGGCCAGG + Intronic
1135204108 16:20467910-20467932 GTGTGCAAGCAGAGGTGGAAAGG - Intronic
1138350029 16:56341609-56341631 CTTTGCAAGCAGCAGAGCCCTGG + Intronic
1139198824 16:64951404-64951426 CTATGCAGGCAGAAGTGCGCTGG - Intronic
1139391919 16:66610607-66610629 GTGTGCAGGCAGAAGAGACCAGG + Intronic
1139984718 16:70888805-70888827 CTTTGCTAGCAGAGGTGGCGTGG + Intronic
1140211160 16:72971672-72971694 CAGTGCAAGCAGGAGTGGAAAGG - Intronic
1141136625 16:81469831-81469853 ATGTTCAAACAGAACTGGCCTGG - Intronic
1142012469 16:87722868-87722890 CTGAGCAAGTAGAGGTGGCTTGG - Intronic
1142239681 16:88939601-88939623 CTGTGCAAGCCGGAGCTGCCGGG - Intronic
1142242421 16:88953600-88953622 CAGTGCCAGCAGGAGTGGCCGGG + Intronic
1142396096 16:89832505-89832527 CATTCCAAGCAGAAGTGTCCTGG - Intronic
1142642957 17:1295315-1295337 CTGTCCCCGGAGAAGTGGCCAGG - Intronic
1144458007 17:15434705-15434727 CTGTCCAAGCTGGAGAGGCCCGG - Intergenic
1144712053 17:17407724-17407746 ATGTGTGAGCAGAAGAGGCCAGG - Intergenic
1144959536 17:19037329-19037351 CTGGGTATGCAGAAGTTGCCTGG + Intronic
1144975623 17:19137195-19137217 CTGGGTATGCAGAAGTTGCCTGG - Intronic
1145081386 17:19897372-19897394 CTGTGGAAGCAGCACTGGCTGGG + Intergenic
1146708128 17:35017050-35017072 GTGGGCAAGCAGAAGTCTCCAGG - Intronic
1147039677 17:37708845-37708867 CTCTGAAACCAGAATTGGCCGGG + Intronic
1147475133 17:40703588-40703610 CAGTGGAAGCAGATGTGGTCTGG - Exonic
1147845884 17:43403642-43403664 CTGTGCAAGAAGGGGTGGCTGGG - Intergenic
1148054293 17:44784691-44784713 CTGTGCAAAAAAAATTGGCCAGG - Intergenic
1149363084 17:55914214-55914236 CGGTGCAAGCAGGCATGGCCAGG + Intergenic
1150978107 17:70111494-70111516 CTATCCAAGCAGTAATGGCCAGG - Intronic
1152144006 17:78556683-78556705 CTGTACAATCAGGAGGGGCCCGG - Intronic
1153065506 18:1040110-1040132 CTGTTCCAGCAGACGTGGCAGGG - Intergenic
1153490665 18:5644656-5644678 CTGTGCAGAGAGAACTGGCCAGG + Intergenic
1153646209 18:7198295-7198317 CTGAGCAAGCAGCTGTGGCCAGG - Intergenic
1154060722 18:11057088-11057110 CTGTGCAACCAGATCTTGCCTGG - Intronic
1155710748 18:28875661-28875683 ATTTGCAAGCAGAAGTTGGCTGG + Intergenic
1156406564 18:36788333-36788355 GTGTGGTAGCAGATGTGGCCTGG + Intronic
1156432612 18:37092145-37092167 GTGTGCCAGCAGCAGTGGGCTGG - Intronic
1157584568 18:48792843-48792865 TTGTGCAATAGGAAGTGGCCAGG + Intronic
1157622951 18:49026668-49026690 CTGCCCCAGCAGTAGTGGCCAGG + Intergenic
1158481505 18:57825358-57825380 CTTTTCAAACAGAACTGGCCAGG - Intergenic
1161331556 19:3690867-3690889 CTGTGCAAGGAAAATGGGCCGGG + Intronic
1162379540 19:10323346-10323368 CTGTGCGGGCAGAGGTGGCGGGG - Intronic
1163716263 19:18874160-18874182 CCAAGAAAGCAGAAGTGGCCGGG - Intronic
1165778469 19:38418421-38418443 CTGTGCACGCTGTAGGGGCCCGG + Exonic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
1166749108 19:45156318-45156340 CAGAGCAGGCAGGAGTGGCCTGG - Intronic
925158437 2:1664284-1664306 TGGTGCAAGCTGGAGTGGCCAGG + Intronic
931465828 2:62486129-62486151 CTGTGGAAGCTGAATTGACCAGG + Intergenic
931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG + Intronic
936090375 2:109498291-109498313 CTGGGGAAGCAGAACAGGCCAGG - Intronic
936264936 2:110996842-110996864 CTTTGGAAACAGAAGTGCCCTGG + Intronic
936399973 2:112157458-112157480 CTGTGCAGGCAGCAGAGTCCAGG + Intronic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
938523154 2:132094484-132094506 CTGTGCAACCACACATGGCCAGG + Intergenic
939582590 2:143968132-143968154 CTGTGCAAGATGAAGTGCCATGG + Intronic
939958368 2:148545547-148545569 CTGTGGAAGCAGACAAGGCCAGG - Intergenic
942401425 2:175607925-175607947 TCCTGCAAGCAGAAGTGGCTTGG + Intergenic
943738903 2:191389630-191389652 CTTTGCAAGTAGATGTGGCCAGG - Intronic
944368518 2:198953917-198953939 CTGTCAAAGCAGAAGTGACTTGG - Intergenic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
946492994 2:220168036-220168058 CTGGGCAAGCAGAATAGCCCTGG - Intergenic
947407038 2:229789167-229789189 CTGAGCCAGCAGCAGTGGCTGGG - Intronic
949031618 2:241799836-241799858 CAGGGCCAGCAGAAGTGACCAGG - Intronic
1170439167 20:16360505-16360527 CTCTGCAAGCAGAACTGGTGTGG + Intronic
1172659311 20:36556752-36556774 CTGGGAAAGCAGACGGGGCCAGG - Intergenic
1173292510 20:41727104-41727126 TGCTGCAAGCAGATGTGGCCAGG + Intergenic
1177503561 21:21991098-21991120 CTTTGCAAGCACAGTTGGCCCGG - Intergenic
1177567363 21:22843014-22843036 ACATGCAAGCAGAAGAGGCCAGG + Intergenic
1178696723 21:34799093-34799115 ATGTGAAGGCAGAAGTGGCTTGG - Intronic
1178982481 21:37276591-37276613 ATGTAAAAGCAGAAGTTGCCAGG - Intergenic
1179494265 21:41761836-41761858 CTCTGCAATCAGAAGTCACCGGG - Intronic
1182342730 22:29637064-29637086 CTGGGCAAGCAGAAGTTACCAGG + Intronic
1182489654 22:30662929-30662951 AGGTGGAAGCAGAGGTGGCCTGG + Exonic
1182943437 22:34300128-34300150 ATATGCAAGCTGAAGAGGCCTGG - Intergenic
1184170627 22:42757494-42757516 CTGTGAGTGCAGAAGAGGCCAGG - Intergenic
1184550859 22:45203470-45203492 CTAAGCAAGCAGATGTGGGCAGG - Intronic
1185212201 22:49576642-49576664 CTGTGTAGACAGACGTGGCCGGG - Intronic
951822402 3:26827346-26827368 CCCTGCAAGCAGGTGTGGCCAGG - Intergenic
953908693 3:46881531-46881553 CTGGGCAAGCTGGAGAGGCCCGG + Intronic
953926830 3:46986885-46986907 CTGAGACAGCAGAGGTGGCCAGG - Intronic
953981240 3:47414239-47414261 CTGTGTCATCAGCAGTGGCCTGG - Exonic
954251742 3:49373046-49373068 GTGGACAAGTAGAAGTGGCCAGG + Intronic
955303033 3:57801497-57801519 TAATGCAAGCAGCAGTGGCCAGG + Intronic
957588106 3:82158645-82158667 CTGTGAAACCAGAAGAGACCAGG - Intergenic
958490443 3:94766030-94766052 CTGTTCCAGCAGAGGTGGCAAGG + Intergenic
960628310 3:119702919-119702941 AAGTGAAAGCAGGAGTGGCCAGG - Intergenic
961575971 3:127836776-127836798 GTGTGCCAGGAGAGGTGGCCAGG + Intergenic
962345694 3:134617796-134617818 GTGTGCATGCAGAGGTGGTCAGG + Intronic
963401235 3:144802292-144802314 CACTGCAAGCAGATGTAGCCAGG + Intergenic
963624283 3:147651199-147651221 GTGTTCCAGCAGCAGTGGCCTGG + Intergenic
967139061 3:186538205-186538227 CTTTGGGAGCAGAAGTAGCCTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967814546 3:193787979-193788001 ATGTGCAAGCATCAGTGGCAGGG + Intergenic
968647371 4:1747478-1747500 CTGGGCACGCAGCCGTGGCCTGG + Intergenic
968938057 4:3623970-3623992 CTGTGGGAGCAGATGTGGGCGGG + Intergenic
969651753 4:8472166-8472188 ATGTGCAGGGAGAACTGGCCTGG + Intronic
969871683 4:10108628-10108650 CTGTGCAAATATAACTGGCCAGG + Intronic
970703512 4:18771327-18771349 TGCTGCAAGCAGATGTGGCCAGG - Intergenic
972647891 4:40987046-40987068 CTGTGCAAAAAGAAATGTCCTGG - Intronic
973122968 4:46545619-46545641 CTGTGACAGTAGAAGAGGCCAGG - Intergenic
974581957 4:63814779-63814801 CCCTGTAAGCAGGAGTGGCCAGG + Intergenic
976351411 4:84064138-84064160 CTATGCAACTAGAACTGGCCAGG + Intergenic
980294135 4:130888405-130888427 CTGTGTAAGGACAAGTGTCCTGG - Intergenic
980873053 4:138632175-138632197 TTGAGCAGGCAGAAATGGCCGGG + Intergenic
981276248 4:142901039-142901061 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
982187213 4:152814773-152814795 CTGTGCATCCAGCAGTGGCCAGG - Intronic
982629918 4:157819398-157819420 CCCTGCAAGCAGGCGTGGCCAGG - Intergenic
985170437 4:187143311-187143333 CTGTGCAATAAGGAGAGGCCAGG - Intergenic
986044462 5:4023779-4023801 CTTTGCAAGAAAAAGGGGCCAGG - Intergenic
986059375 5:4173635-4173657 CTGTGCAGGCAGAAGGGACAGGG + Intergenic
986160211 5:5220776-5220798 TTTTGCAAGCAGATGTGGGCAGG - Intronic
988870543 5:35384835-35384857 CCCTGCAAGAAGATGTGGCCAGG - Intergenic
990943720 5:61229217-61229239 CTTGGCAAGCAGAAGTGTCTAGG - Intergenic
995106264 5:108381084-108381106 GTGTGCAAGCGGAAGGGGGCCGG - Exonic
995682174 5:114732043-114732065 CTCTGCAAGCAGGAGCAGCCAGG + Intergenic
995938716 5:117551453-117551475 CTGTGCAGTCAGCTGTGGCCGGG + Intergenic
1001682123 5:173565838-173565860 ATTTGCAGGCATAAGTGGCCTGG + Intergenic
1002069752 5:176672220-176672242 CTGGGCAAACAGAGGTGACCTGG + Intergenic
1002102492 5:176864301-176864323 CGGGGCAGGCAGCAGTGGCCAGG + Intronic
1003149616 6:3537670-3537692 CTGGACAAGCACAGGTGGCCTGG + Intergenic
1005637709 6:27767251-27767273 CAGTTCAAGCAGAAGTGTGCGGG + Intergenic
1005677718 6:28172871-28172893 CTGTGCATGCTGAGGTGTCCTGG + Intergenic
1006253187 6:32807800-32807822 CTTTGCAAGCAGATGTGGCCAGG + Intergenic
1006519842 6:34564874-34564896 CTGTGAAGGGAGAAGTGGCCTGG + Intergenic
1007314900 6:40979382-40979404 CACTGCAAGCAGTTGTGGCCAGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008726307 6:54425161-54425183 CTGTACCAGCAGACTTGGCCAGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1012490774 6:99780419-99780441 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1012582300 6:100883533-100883555 TTGCGCAAGCAGAAGTGCACTGG + Intergenic
1013992142 6:116265668-116265690 CCCTGCAAGCAGGAATGGCCAGG + Intronic
1015863549 6:137705165-137705187 GCTTGAAAGCAGAAGTGGCCAGG - Intergenic
1016949650 6:149566943-149566965 CCGAGCAGGCACAAGTGGCCTGG - Intronic
1019058924 6:169242089-169242111 CTGGGCCAGCAGCAGAGGCCAGG + Intronic
1021531689 7:21653601-21653623 CTCTCCCAGCTGAAGTGGCCAGG - Intronic
1022286920 7:28962218-28962240 CTGCTCCAGCAGAAGTGGGCTGG - Intergenic
1023058166 7:36306133-36306155 CTATGCAGGCAGAGGTGGGCTGG + Intergenic
1023181231 7:37485789-37485811 CTGAGCAAGAAGAACTCGCCAGG - Intergenic
1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG + Intergenic
1028008863 7:85614806-85614828 CCCTGCAAGCAGGTGTGGCCAGG - Intergenic
1029601256 7:101564806-101564828 CTGGGCACGCAGACGTGACCTGG - Intergenic
1030421294 7:109309827-109309849 CATTGCAAGCAGGTGTGGCCAGG - Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032068963 7:128792087-128792109 CTGTGCAAGCAAGAGGGTCCTGG + Exonic
1032838286 7:135693794-135693816 CTGAGCAATGAGAGGTGGCCTGG + Intronic
1034688682 7:152996655-152996677 CTGTGAAGTCAGAAGTGCCCTGG + Intergenic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1035739000 8:1912077-1912099 CTCTGCAAGCAGAGGTTGCTGGG - Intronic
1037373619 8:18205831-18205853 CGCTGCAAGCAGGTGTGGCCAGG + Intronic
1037477794 8:19274464-19274486 GTGTGCAGGCAGATGAGGCCTGG + Intergenic
1038046284 8:23768159-23768181 CTGTGCCAGCATAAACGGCCCGG + Intergenic
1038781174 8:30569356-30569378 CTGTCAAAGCTAAAGTGGCCTGG + Intronic
1040540272 8:48347600-48347622 CTCTGCAAGCAGGTGTGGCCAGG - Intergenic
1040880515 8:52199861-52199883 CTGTGACAGCAGAAGTTCCCTGG + Intronic
1040982829 8:53262917-53262939 CAGTGCAAGCAAAAGGGACCTGG + Intergenic
1042368424 8:67963143-67963165 GGGTGTGAGCAGAAGTGGCCTGG + Intronic
1045717557 8:105066625-105066647 CTGTGGCAGCAGCAGTGTCCAGG + Intronic
1046395394 8:113633344-113633366 GTCTGCAAGGAGACGTGGCCAGG - Intergenic
1048255089 8:132899704-132899726 CTGTGTAAGCATCAGTGCCCAGG - Intronic
1048544162 8:135370613-135370635 CTGTGGATGCAGGAGTGGTCTGG - Intergenic
1049464690 8:142745494-142745516 TTGTGAAAGCTGAAGTGACCTGG + Intergenic
1049507112 8:143008697-143008719 CCCTGCAAGCAGGCGTGGCCAGG + Intergenic
1049534340 8:143171279-143171301 CTGTGCAAACTGAAAGGGCCAGG - Intergenic
1053542986 9:38993894-38993916 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1053807429 9:41817411-41817433 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1054623163 9:67370016-67370038 CACTGCAAGCAGGTGTGGCCAGG - Intergenic
1055214769 9:73845812-73845834 CTGTGCAAGTAAAACTGGACTGG - Intergenic
1057025449 9:91731488-91731510 CTGTGCAAGCAAGAAGGGCCTGG + Intronic
1057474065 9:95384082-95384104 TTCAGCAATCAGAAGTGGCCAGG - Intergenic
1058643169 9:107106631-107106653 AGGTGCAGGCAGAAGTGGCCTGG + Intergenic
1059095590 9:111410163-111410185 CTGTGCAGGCAGCAATTGCCAGG + Exonic
1060734382 9:126057169-126057191 CTGTGCAGGTTCAAGTGGCCGGG + Intergenic
1061073299 9:128325344-128325366 CTGTGCAACCATATGTAGCCAGG - Intronic
1062255242 9:135617737-135617759 CGGTGCAATCAGAGCTGGCCGGG + Intergenic
1062591057 9:137274873-137274895 CTGAGGAAGCAGGAGAGGCCTGG + Intergenic
1185836171 X:3347095-3347117 GTGTGCAAGCAGGAGCGGGCTGG + Intergenic
1187607785 X:20905486-20905508 TTGTGCCAGCAGCAGTGGCATGG + Intergenic
1187607845 X:20905775-20905797 CGTTGCAAGCAGATGTGGCCAGG + Intergenic
1188000528 X:24976338-24976360 CTGTGCATACAGAGGTGGGCAGG - Intronic
1189558186 X:42166397-42166419 CATTGCAAGCAGGTGTGGCCAGG + Intergenic
1189678280 X:43486753-43486775 TACTGCAAGCAGATGTGGCCGGG - Intergenic
1191676026 X:63793327-63793349 GTGATCAAGCTGAAGTGGCCTGG - Intergenic
1192872233 X:75195290-75195312 CATTGCAAGCACATGTGGCCAGG + Intergenic
1192935155 X:75851072-75851094 CACTGCAAGCAGGAATGGCCAGG + Intergenic
1193515024 X:82452227-82452249 CACTGCAAGCAGAAATGGCCAGG - Intergenic
1193944479 X:87717142-87717164 CTGTGGAAACTGAAATGGCCAGG - Intergenic
1194346733 X:92774093-92774115 ATGTGCCAGCAGTAGTGGCAGGG - Intergenic
1194549130 X:95274266-95274288 CCCTGCAAGCAGGAATGGCCAGG - Intergenic
1195541534 X:106068261-106068283 CACTGCAAGCAGATGTGGTCAGG + Intergenic
1198605417 X:138332051-138332073 TTGTGGAAGGAGAAGAGGCCAGG - Intergenic
1199560953 X:149161842-149161864 CTGTGCAAGCAAGCATGGCCAGG - Intergenic
1200655066 Y:5890737-5890759 ATGTGCCAGCAGTAGTGGCAGGG - Intergenic