ID: 931489296

View in Genome Browser
Species Human (GRCh38)
Location 2:62726324-62726346
Sequence GGAGACTGGGTGAGTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 6, 2: 26, 3: 76, 4: 375}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931489296_931489308 20 Left 931489296 2:62726324-62726346 CCAGTTCAACTCACCCAGTCTCC 0: 1
1: 6
2: 26
3: 76
4: 375
Right 931489308 2:62726367-62726389 AATGATTACTGGTGTGCGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 69
931489296_931489305 9 Left 931489296 2:62726324-62726346 CCAGTTCAACTCACCCAGTCTCC 0: 1
1: 6
2: 26
3: 76
4: 375
Right 931489305 2:62726356-62726378 TGGAGGCCTGGAATGATTACTGG 0: 1
1: 0
2: 1
3: 11
4: 178
931489296_931489307 16 Left 931489296 2:62726324-62726346 CCAGTTCAACTCACCCAGTCTCC 0: 1
1: 6
2: 26
3: 76
4: 375
Right 931489307 2:62726363-62726385 CTGGAATGATTACTGGTGTGCGG 0: 1
1: 0
2: 1
3: 17
4: 153
931489296_931489301 -8 Left 931489296 2:62726324-62726346 CCAGTTCAACTCACCCAGTCTCC 0: 1
1: 6
2: 26
3: 76
4: 375
Right 931489301 2:62726339-62726361 CAGTCTCCTGGAATCCTTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 308
931489296_931489302 -3 Left 931489296 2:62726324-62726346 CCAGTTCAACTCACCCAGTCTCC 0: 1
1: 6
2: 26
3: 76
4: 375
Right 931489302 2:62726344-62726366 TCCTGGAATCCTTGGAGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931489296 Original CRISPR GGAGACTGGGTGAGTTGAAC TGG (reversed) Intronic
900194312 1:1367528-1367550 AGTGAATTGGTGAGTTGAACTGG + Intergenic
900935199 1:5760717-5760739 GGAGACTGGGTAATTTGTAAAGG - Intergenic
901066248 1:6496092-6496114 GAAGAGTGGCTGAGTTCAACAGG + Intronic
901262675 1:7885522-7885544 GGAGGCTGGGTGGGTTGTGCTGG - Intergenic
903056793 1:20641709-20641731 GGAGACGTGGTGAGATGAGCAGG - Intronic
903172110 1:21560802-21560824 GGAGCCAGGCTGAGTTGAAGGGG + Intronic
904446275 1:30575293-30575315 GGAGACTGGGTGATTTATAAAGG - Intergenic
905952602 1:41964593-41964615 GGAGACTGGGTAGTTTGGACCGG + Intronic
907289029 1:53401034-53401056 GGAGCCTGGGTGAGGGGAAGGGG + Intergenic
908667499 1:66509690-66509712 GGGGAACAGGTGAGTTGAACTGG + Intergenic
909049797 1:70753663-70753685 GGGGAATGGGTTAGTTGAACTGG - Intergenic
909615860 1:77607100-77607122 TGAGACTGGGTAATTTGGACAGG + Intronic
910333860 1:86105827-86105849 GGAGAACAGGTGAGTTGAACTGG - Intronic
911310803 1:96289681-96289703 GGGTAATGGGTGAGTTGAGCTGG - Intergenic
912729707 1:112091415-112091437 GGAACCTGGGTGAGGTAAACAGG - Intergenic
914415149 1:147473431-147473453 GGAGAGGGGGAGAGATGAACAGG - Intergenic
915497685 1:156293276-156293298 GGGGACTTGGGGAGTTGAAGTGG - Intronic
915639798 1:157215923-157215945 TGAGACTGGGTGGTTTGAACTGG - Intergenic
915659282 1:157388925-157388947 TGAGACTGGGTGGTTTGGACCGG - Intergenic
916631432 1:166618375-166618397 GGGAAAGGGGTGAGTTGAACAGG - Intergenic
916973466 1:170049198-170049220 GGAGACTGGGAGGTTTGGACTGG + Intronic
918786361 1:188769177-188769199 GGAGACAGGGAGATTTGGACTGG + Intergenic
918927652 1:190809113-190809135 GGGGAATAGGTGAGTTGAACTGG + Intergenic
919207526 1:194436983-194437005 GGGAAATGGGTGAGTTAAACTGG + Intergenic
919417636 1:197331130-197331152 GGAGACTGGCTGTGTTGCCCAGG - Intronic
919836237 1:201575411-201575433 AAATACTGGCTGAGTTGAACTGG - Intergenic
919920486 1:202164008-202164030 GGAGACAGGGTGAGTGGGGCAGG + Intergenic
919935686 1:202249075-202249097 GGAGCCTCGGTGAGTGGTACTGG - Intronic
921404695 1:214765621-214765643 GGGGAACAGGTGAGTTGAACTGG - Intergenic
921462553 1:215445585-215445607 GAGGAATGGGTGAGTTGAACTGG - Intergenic
922132797 1:222795876-222795898 GGAGAGTGGGTAAGATGAAGCGG - Intergenic
923855183 1:237838607-237838629 GGGGAATGGGTCAGTTGAACTGG + Intergenic
924331581 1:242945790-242945812 GGGGAATGAGTGAGTTGAACTGG + Intergenic
924652221 1:245939964-245939986 GGAGACTGGGTGGTTTGGACTGG + Intronic
924952526 1:248897904-248897926 GGAGACTGGGTGGTTTGGACCGG + Intergenic
1063753809 10:8983150-8983172 GGAGGCTGGCTGAGTTGACATGG + Intergenic
1063819513 10:9818986-9819008 GGGTAATGGGTGAGTTGAACTGG + Intergenic
1064757867 10:18588140-18588162 GGAGACTGGGAGGTTTGGACTGG + Intronic
1066466282 10:35653185-35653207 GGAGACTGGATGAGTGGAGGTGG + Intergenic
1068053745 10:51983815-51983837 GGGAAATGGGTGAGTTGAACTGG - Intronic
1068072084 10:52207732-52207754 GGGGAAGAGGTGAGTTGAACAGG - Intronic
1068369602 10:56095801-56095823 GGAGACTGGGAGGTTTGGACTGG - Intergenic
1068405950 10:56588989-56589011 GGAAACTGGGTGATTTATACAGG + Intergenic
1068463052 10:57351675-57351697 GAGGAAAGGGTGAGTTGAACTGG - Intergenic
1068820882 10:61376786-61376808 GGAGAAGGGGTGAGTTAAACAGG - Intergenic
1070311897 10:75279939-75279961 GGAGACTTTGTGAGGTGAATAGG - Intergenic
1071191621 10:83108317-83108339 GGCGAATGGGTGAGTTGAACTGG + Intergenic
1071358205 10:84818926-84818948 GGGGAAGAGGTGAGTTGAACAGG - Intergenic
1071454613 10:85836465-85836487 GGGGAATGGATGAATTGAACTGG + Intronic
1071736122 10:88303083-88303105 GGGGAATGGGTAAGTTAAACTGG + Intronic
1072026695 10:91467143-91467165 GTGGAAAGGGTGAGTTGAACAGG + Intronic
1072854838 10:98936068-98936090 GGAGACTGGGAGGTTTGGACTGG - Intronic
1073477591 10:103764368-103764390 GGAGAGTGAGTGAGCTGAAGAGG + Intronic
1074509129 10:114097237-114097259 GGAGGCTGGGTGAACTCAACAGG - Intergenic
1075835347 10:125448263-125448285 GGACACAGGGTGAGTGGGACAGG + Intergenic
1080898663 11:36467131-36467153 GGAGACTGGGTGACATGGCCTGG + Intergenic
1081026239 11:38018942-38018964 GGGGAACAGGTGAGTTGAACTGG + Intergenic
1081083143 11:38768279-38768301 GTGGAGGGGGTGAGTTGAACAGG + Intergenic
1081166059 11:39810321-39810343 GGAGACTGGGAGGTTTGGACTGG + Intergenic
1081615213 11:44586880-44586902 GGAAACAGGGTGAGTGGCACAGG + Intronic
1083006593 11:59352108-59352130 GGGGAATGGGTGAGTTGAAGTGG - Intergenic
1083384462 11:62297207-62297229 GGAGTGTGGGAGATTTGAACAGG - Intronic
1085815061 11:79728340-79728362 AGGGAATGGGTGAGTTGAACTGG - Intergenic
1085856548 11:80181997-80182019 GGGGAATGGGTGAGTTGAACTGG - Intergenic
1086170302 11:83828365-83828387 GGAGTCTGGCTGTGTTGCACAGG - Intronic
1087131050 11:94669563-94669585 GGAGACTGGGGAGGTTGGACTGG - Intergenic
1087158340 11:94925794-94925816 GGAGGCTCTGTGAGCTGAACAGG + Intergenic
1087309376 11:96521994-96522016 GGGGAATGGGTGAATTAAACTGG - Intergenic
1087597506 11:100272761-100272783 GGGGAATTGGTGAGTTGAACTGG + Intronic
1087619804 11:100528500-100528522 CGGGAATAGGTGAGTTGAACTGG + Intergenic
1087718511 11:101636268-101636290 GGAGGCTGAGTGGTTTGAACTGG + Intronic
1087868961 11:103267148-103267170 GGGGACTAAGTGAGTTGAACCGG - Intronic
1088806645 11:113358826-113358848 GGGGAATGGGTGAGTTGAACTGG - Intronic
1090162624 11:124511007-124511029 GGGGAATGAGTGAGTTGAACTGG - Intergenic
1090354212 11:126128930-126128952 GGAGACATGGTGAGTGGAACAGG - Intergenic
1091367921 11:135037626-135037648 GGGGTGTGGGTGAGTTGGACTGG + Intergenic
1091850618 12:3694008-3694030 GGGGAATGGCTGAGTTGAACTGG - Intronic
1092105004 12:5914998-5915020 TGCGAGTGGGTGAGCTGAACAGG - Intronic
1093415980 12:18921612-18921634 GGGGACAGGGTGGGTTGAAGAGG - Intergenic
1093954806 12:25203388-25203410 AGAAACTGGGTGAGTTAAGCAGG - Intronic
1094734923 12:33223346-33223368 GGGGAATGAATGAGTTGAACTGG - Intergenic
1094804706 12:34078124-34078146 GGAGACTGGGACATTTGAATTGG - Intergenic
1095116727 12:38363059-38363081 GGAGACTGGGACATTTGAATTGG - Intergenic
1095542832 12:43330458-43330480 GGGGAACAGGTGAGTTGAACGGG - Intergenic
1098347885 12:69524885-69524907 GCAGAAGGGGTGAGTTGAACAGG - Intronic
1098414305 12:70215447-70215469 GGAGACTGGGACAGTTGGCCTGG + Intergenic
1099732884 12:86526920-86526942 GGACAATGGGTGAATTGAACTGG - Intronic
1099914291 12:88872854-88872876 GGAGACTGGGTGATTTATAAAGG - Intergenic
1101471357 12:104999786-104999808 GGAAAAGGGGTGAGTTGAGCAGG - Intronic
1102014595 12:109639434-109639456 TGAGACTGGGTGATTTGTAAAGG - Intergenic
1102872007 12:116420983-116421005 TGACACTGGGTGATTTGAATGGG + Intergenic
1103520344 12:121533718-121533740 CCAGACTGGGTGAGTGGAGCAGG + Intronic
1105269958 13:18863576-18863598 GGAGAAAGGGAGAGATGAACAGG + Intergenic
1107661394 13:42643170-42643192 GGAGACTGGGCGGTTTGAACCGG - Intergenic
1108379013 13:49839273-49839295 GGAGACAAGGTGAGAGGAACTGG - Intergenic
1108775524 13:53761141-53761163 GTGGAAGGGGTGAGTTGAACAGG + Intergenic
1109113766 13:58355112-58355134 TGAGACTGGGTAATTTGTACAGG - Intergenic
1110337298 13:74346957-74346979 GGAGACTGGGAGATTCGGACTGG + Intergenic
1110448919 13:75619048-75619070 TGAGACTGGGTGATTTGTAAGGG + Intergenic
1110821846 13:79926047-79926069 GGAGACTGGGTGGTTTGGACTGG - Intergenic
1110926130 13:81154407-81154429 GGAGACTGTGTGACTTGAAGAGG + Intergenic
1111113690 13:83749308-83749330 GGAAAACGGGTGAGTTGAACAGG + Intergenic
1111171316 13:84529447-84529469 AGGGAATTGGTGAGTTGAACTGG - Intergenic
1114134623 14:19834083-19834105 GGGGAATGGGTGAGTTGAACTGG + Intergenic
1115517136 14:34197189-34197211 GGTGACTGGGTGACTGTAACTGG - Intronic
1115883352 14:37945277-37945299 AGGGAATGGATGAGTTGAACTGG + Intronic
1115914906 14:38301539-38301561 GGGGAAGGAGTGAGTTGAACAGG + Intergenic
1117000318 14:51365086-51365108 GGACACTGGGTGGTATGAACTGG + Intergenic
1118416099 14:65538294-65538316 GCGGAGAGGGTGAGTTGAACAGG - Intronic
1118478467 14:66141028-66141050 GGGGAATGGATGAGTTGAACTGG + Intergenic
1118540010 14:66813481-66813503 GGAGCATGGGTGAGTTGAACTGG + Intronic
1118859496 14:69651455-69651477 GGAGGCTGTGTGATTTTAACAGG + Intronic
1120723983 14:87917135-87917157 GGAGAATGGGTGAGTTGAACTGG - Intronic
1120980304 14:90283401-90283423 AAAGACTGGGTAAGTTAAACTGG + Intronic
1121968149 14:98329515-98329537 TGAGACTGGGTGATTTGTAAAGG - Intergenic
1122216876 14:100210538-100210560 GGAGTCTCGGTGTGTTGCACAGG + Intergenic
1122307107 14:100773218-100773240 GGAGGGTGGGTGGTTTGAACAGG - Intergenic
1123126946 14:105953655-105953677 GGGGAAAGGTTGAGTTGAACAGG + Intergenic
1202829413 14_GL000009v2_random:10389-10411 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1123407409 15:20029475-20029497 GGGGAAAGGTTGAGTTGAACAGG + Intergenic
1123516736 15:21036131-21036153 GGGGAAAGGTTGAGTTGAACAGG + Intergenic
1123577673 15:21689655-21689677 GGGGAATGGGTGAGTTGAACTGG + Intergenic
1123614297 15:22132136-22132158 GGGGAATGGGTGAGTTGAACTGG + Intergenic
1123875797 15:24622472-24622494 GAGGAAGGGGTGAGTTGAACAGG - Intergenic
1123893841 15:24809031-24809053 GGGGAAGGGGTGAGTTGAACAGG + Intergenic
1124077662 15:26461464-26461486 GGGGAATGGGTAAGTTGGACTGG + Intergenic
1125549428 15:40534330-40534352 GGAGACTGGGTAATTTGTACAGG + Intronic
1125770477 15:42162187-42162209 AGGGACTGGGTGAGGTGAACAGG + Intronic
1125771084 15:42166505-42166527 GGAGACCAGGTCATTTGAACAGG + Intronic
1125884448 15:43218210-43218232 GCAGACTGGTTGAGTTGGATTGG + Intronic
1125907257 15:43404362-43404384 GGAGAGTTGGTGAGCTGAAGTGG + Exonic
1126506285 15:49407297-49407319 GGAGAATGGGCCAGTTGAACTGG - Intronic
1128968793 15:72087519-72087541 GGGAAACGGGTGAGTTGAACTGG - Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1131869291 15:96745108-96745130 GGAGCCTGGGTGAGATGATCAGG - Intergenic
1202986542 15_KI270727v1_random:423900-423922 GGGGAATGGGTGAGTTGAACTGG + Intergenic
1134868739 16:17632325-17632347 GGAGGCTGGGGGAGGAGAACCGG + Intergenic
1135724782 16:24846004-24846026 GAAGACTGGGTGAGTGAAGCAGG + Exonic
1135800497 16:25489510-25489532 GGGGAAGGGGTGAGTTGAGCAGG - Intergenic
1135842849 16:25892520-25892542 AGAGAATGGATGAGTTGAAACGG + Intronic
1137818207 16:51419723-51419745 GGAGGCTCAGTAAGTTGAACTGG - Intergenic
1139387936 16:66586234-66586256 GGAGTCTGGGTGGGCTGCACTGG - Intronic
1140826345 16:78710189-78710211 CGCCACTGGGTGATTTGAACGGG - Intronic
1143018204 17:3903111-3903133 GGAGACTTGGGAAGATGAACTGG + Intronic
1143935563 17:10480985-10481007 CGAGACTGGGTAAGTTGTAAAGG + Intergenic
1144298790 17:13903748-13903770 GGAGGCTGGTGCAGTTGAACAGG - Intergenic
1144996379 17:19272146-19272168 AGAGACTGGGTGCAGTGAACGGG - Intronic
1147870521 17:43583878-43583900 TGAGCCTGGGTGAGCTGACCCGG - Intergenic
1148704144 17:49613452-49613474 GTAGACTGGGTGAAATGAATTGG + Intronic
1148863082 17:50614689-50614711 AGAAACTGGGTGAGTCCAACAGG + Intronic
1149231873 17:54544401-54544423 GGAGACTAGGTGGTTTGGACTGG + Intergenic
1149363146 17:55914569-55914591 TGGGAAGGGGTGAGTTGAACAGG - Intergenic
1150533883 17:66014673-66014695 GGGGAATGGGTGAGTTGAGCAGG - Intronic
1153410618 18:4788955-4788977 GGGGAAGGGGTGTGTTGAACAGG + Intergenic
1154068352 18:11130171-11130193 GCCGAATGGGAGAGTTGAACTGG - Intronic
1154400736 18:14034496-14034518 GGGGAAGGGGCGAGTTGAACAGG + Intergenic
1154418085 18:14196401-14196423 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1156422283 18:36967793-36967815 GTGGAGTGGGTGAGTTGAACAGG + Intronic
1157310554 18:46549573-46549595 GAAGGCTGGGTGAGATGACCTGG + Intronic
1158157018 18:54437399-54437421 GGAGAAGGGGTGAGTCAAACTGG + Intergenic
1158679386 18:59553181-59553203 GTAGACTGGCTGAGTAGAACAGG - Intronic
1159288753 18:66389883-66389905 TGAGACTGGGTAATTTGTACAGG - Intergenic
1161506365 19:4646000-4646022 AGAGGCTGGGCCAGTTGAACTGG - Intronic
1162189893 19:8936596-8936618 GGAGACAGGGAGAGTTGGAATGG + Exonic
1164636267 19:29793602-29793624 GGAGAGTGGGTGAGGTGAGAGGG - Intergenic
1164823735 19:31268902-31268924 AGAGACTGTGTCTGTTGAACTGG - Intergenic
1166136656 19:40781390-40781412 GGAGACAGGGTGAGTCAGACAGG + Intronic
1166190903 19:41175930-41175952 GGAGACAGGGGGAGTAGAAGAGG - Intergenic
1166376333 19:42329313-42329335 GGAGACTTGATGAGCTGATCTGG + Intronic
1202643280 1_KI270706v1_random:117393-117415 GGAGAAAGGGAGAGATGAACAGG + Intergenic
925611501 2:5706165-5706187 GGAGACTGGGGTAGAGGAACAGG + Intergenic
926049893 2:9737817-9737839 GGGGACTGGGGGAGTGGAAGTGG - Intergenic
926160824 2:10488065-10488087 GAAGCCTCGGTGAGTGGAACTGG - Intergenic
928254612 2:29711335-29711357 GGAGACTGCGGCAGCTGAACTGG - Intronic
928490394 2:31777741-31777763 GGGAAAGGGGTGAGTTGAACAGG + Intergenic
928524369 2:32124879-32124901 GGAGACAGGGAGAGATGAATAGG + Intronic
928811458 2:35233035-35233057 GAGGAATGAGTGAGTTGAACTGG + Intergenic
929100792 2:38311366-38311388 GGAGACTGTGTGAGTTATATTGG - Intronic
930455755 2:51605736-51605758 GGAGACTGGGCAATTTGTACTGG - Intergenic
930609428 2:53524718-53524740 GGAGAATGGGTTATTTGAAAGGG + Intergenic
931489296 2:62726324-62726346 GGAGACTGGGTGAGTTGAACTGG - Intronic
931557127 2:63518390-63518412 AGAGACAGGGTGAGTTGAGCAGG + Intronic
932539590 2:72638590-72638612 GGAGAATGGGTGAGTTGAACTGG + Intronic
933317897 2:80737073-80737095 GGAGACTGGGAGGTTTGGACTGG + Intergenic
933555353 2:83824071-83824093 GGGGAATGGGTGAGTTGAACTGG - Intergenic
933762838 2:85685054-85685076 GAAGACTGGGTGTGCTCAACTGG - Intergenic
934099590 2:88640589-88640611 GGGAAATGAGTGAGTTGAACTGG + Intergenic
935888273 2:107648359-107648381 GGGCAATGGGTAAGTTGAACTGG + Intergenic
936847401 2:116853863-116853885 GGGGAATGGGTGAATTAAACTGG + Intergenic
938224262 2:129602363-129602385 GGAGACTGGGAGGTTTGGACTGG - Intergenic
939022964 2:136980567-136980589 GGAGACTGGGTAGTTTGAACTGG - Intronic
939470680 2:142616063-142616085 GGAGACTGGGTGGTTTGGACTGG + Intergenic
939674313 2:145053083-145053105 GGAGACTGGGTGAGCTCTAAGGG + Intergenic
940464838 2:154014356-154014378 GGGGAAGGGGTGAGTTTAACAGG - Intronic
941820263 2:169837502-169837524 GGAGACTGGGTGATTTATAAAGG + Intronic
943153152 2:184138925-184138947 GGGGAATAGATGAGTTGAACTGG - Intergenic
943388026 2:187226212-187226234 GCAAAATGGGAGAGTTGAACGGG - Intergenic
944145525 2:196503562-196503584 GCCGACTGGGTGAGGGGAACAGG - Intronic
945430210 2:209755113-209755135 GGGGAAGGGGTGAGTTAAACAGG + Intergenic
948557310 2:238822184-238822206 GGAGACTGGAGGAGCTGAGCAGG + Intergenic
1170149913 20:13219107-13219129 GGAGACTGTGTGTGATGAAAGGG + Intergenic
1172480200 20:35267059-35267081 AAAGACTGGGGGAGTTAAACTGG + Intronic
1173225538 20:41160389-41160411 AGAGACTGGATGTGTAGAACTGG + Intronic
1174514354 20:51080058-51080080 GGAGACTGGGTAAGTTATAAAGG - Intergenic
1175286759 20:57841725-57841747 GGAGACTGGCTGAGCTGGGCAGG - Intergenic
1175423670 20:58851396-58851418 GGAGGCTGGATGAGTTACACAGG - Intronic
1175785833 20:61711330-61711352 TGAGACTGGGTGATTTGTAAAGG - Intronic
1176269394 20:64227809-64227831 GGGGAGAGGGTGAGATGAACGGG + Intronic
1176608597 21:8855230-8855252 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1176722335 21:10402658-10402680 GGAGATCAGGTGAGTTAAACTGG - Intergenic
1176855214 21:13962876-13962898 GGAGAAAGGGAGAGATGAACAGG + Intergenic
1177043980 21:16146536-16146558 GGGAAATGGATGAGTTGAACTGG - Intergenic
1179054195 21:37916264-37916286 GGAGACTGGGTGGAATGAAGTGG + Exonic
1180358682 22:11865045-11865067 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1180379584 22:12127286-12127308 GGAGAAAGGGAGAGATGAACAGG + Intergenic
1181420505 22:22794588-22794610 GCCAACTGGGAGAGTTGAACAGG - Intronic
1181596296 22:23917114-23917136 GGAGACTGGGTCTGTTGTCCAGG - Intergenic
1184210876 22:43034948-43034970 GGAGATTAGGTGAGTTAAACTGG + Intergenic
1185285129 22:49996693-49996715 GGAGACTGGGTGGGGGAAACGGG - Exonic
1185404093 22:50635981-50636003 TGAGACTGGGTGATTTGTAAAGG + Intergenic
949743702 3:7264480-7264502 GGGGAAAGGGTGAGTTGAACAGG - Intronic
951495185 3:23317509-23317531 GGAGACCGGGTGATTTATACAGG + Intronic
951519494 3:23598107-23598129 GGGGTCTGGGTGGGATGAACAGG - Intergenic
951596233 3:24321151-24321173 GGAGACTGGGGGTGTAAAACTGG - Intronic
951822342 3:26826999-26827021 GGGGAACAGGTGAGTTGAACTGG + Intergenic
952577353 3:34791195-34791217 AGAGACTAAGTGAGTTAAACTGG - Intergenic
952679431 3:36074111-36074133 GGAGACTGGGAGGTTTGGACCGG - Intergenic
953897500 3:46813424-46813446 GCCGAATGGGAGAGTTGAACAGG + Intergenic
955937167 3:64113037-64113059 GGGGAATGGGTGAGTTGAACTGG + Intronic
956191191 3:66610117-66610139 GGAGCCTGGATGAGATGAACAGG + Intergenic
956371685 3:68570507-68570529 GGGGAAGGGGTGAGTTGAACAGG + Intergenic
956750194 3:72339016-72339038 AGAGACTGACTGAGATGAACAGG + Intergenic
957723167 3:84031289-84031311 GGGGAATGGGTGAGTTGAACTGG + Intergenic
959041033 3:101423793-101423815 GGGCAATGGGTGAGTTGAACTGG + Intronic
959295564 3:104530708-104530730 GGGGAATGGGTGATTTGAACTGG + Intergenic
959440064 3:106363011-106363033 CAAGAAGGGGTGAGTTGAACAGG - Intergenic
960349414 3:116574768-116574790 GGCCAATGGGAGAGTTGAACAGG - Intronic
961096736 3:124163225-124163247 GGAGAGTGAGTATGTTGAACAGG + Intronic
961212058 3:125133074-125133096 AGAGACTGGGAGAGTTGAGTAGG + Intronic
961933213 3:130555274-130555296 GGGGAAGGGGTGAGTTCAACAGG - Intergenic
961987947 3:131157778-131157800 GGGGAATGGGTGAGTTGAACTGG + Intronic
962001815 3:131305750-131305772 TGAGAAAGGGTGAGTTGAATAGG - Intronic
962367284 3:134795000-134795022 GGGGACAGGGTGAGTTGGGCGGG + Intronic
962655835 3:137543055-137543077 GGGGAATAAGTGAGTTGAACAGG - Intergenic
963546033 3:146659153-146659175 GTATACTGGGTGTGTTGAACAGG - Intergenic
963914208 3:150842549-150842571 GGGAAATGGGTGAATTGAACTGG - Intergenic
964296614 3:155240460-155240482 GGGGAAAGGGTGAGTTGAGCAGG - Intergenic
964391515 3:156202299-156202321 GGTGAATGGGTAAGTTGAAGAGG - Intronic
965621927 3:170650924-170650946 GGAGACTGGGAGGTTTGGACTGG - Intronic
965805145 3:172534182-172534204 GGGGAGTGCATGAGTTGAACTGG - Intergenic
966289815 3:178342953-178342975 GGGGAATGGGTGAGTTGAATTGG + Intergenic
966489839 3:180516140-180516162 GGGGAATGAATGAGTTGAACTGG + Intergenic
966508143 3:180730428-180730450 CGAGACTGGGTAATTTGTACAGG + Intronic
966714384 3:183000841-183000863 GGGGAATGGGTGAGTTGAACTGG - Intergenic
966731343 3:183153866-183153888 GGGGCATGGGTGGGTTGAACAGG + Exonic
966932186 3:184682923-184682945 GGAGTCAGGGTGAGTTTAATTGG + Intronic
967208092 3:187142252-187142274 GGAGACTGGGTAATTTGTAAAGG + Intronic
967417890 3:189239279-189239301 CGAGACTTGATGAGTTTAACAGG - Intronic
968359671 3:198138267-198138289 TGAGTCTGGGTGGGTTGAGCTGG - Intergenic
969132497 4:5002130-5002152 GGAGACTGGGAGGTTTGGACTGG - Intergenic
969836963 4:9850168-9850190 GGGGAAGGGATGAGTTGAACAGG + Intronic
969964457 4:10979575-10979597 GAAGATTAGGTGAGTTGATCTGG + Intergenic
970106900 4:12595388-12595410 GGAGGCTGGGTGGTTTGGACTGG + Intergenic
970185345 4:13446135-13446157 GGAGACTCGGAGGTTTGAACTGG - Intronic
971574239 4:28253818-28253840 GGAGACTGGGTGGTTTGGACTGG + Intergenic
971746438 4:30587002-30587024 GAAGACTGGGAGATTTGGACTGG - Intergenic
971825860 4:31621777-31621799 GGGGGTTGGGTGAGATGAACAGG + Intergenic
972083253 4:35181624-35181646 GTGGAAGGGGTGAGTTGAACTGG + Intergenic
972270209 4:37503212-37503234 GGGGAATGAGTGACTTGAACTGG - Intronic
972830665 4:42810272-42810294 GGAGAACAGGCGAGTTGAACTGG - Intergenic
973078973 4:45965950-45965972 GGGGAATGGGTGAGTTAAACTGG - Intergenic
974582019 4:63815136-63815158 GGGGGATGGGTGAGTTGAAGTGG - Intergenic
974603866 4:64123192-64123214 GGGGCATGGGTGGGTTGAACCGG - Intergenic
974723835 4:65774174-65774196 GAGGAATGGGTGAGTTAAACTGG - Intergenic
974805994 4:66881962-66881984 AGAGACTGGGTGATTTGTAAAGG - Intergenic
974814680 4:66989284-66989306 GGAGACTGGGAGGTTTGGACGGG - Intergenic
975361694 4:73477749-73477771 GGGGAATGGGTGAGTTGAACTGG - Intergenic
975403694 4:73965688-73965710 GGAGAATGGGTGAGTTGAACTGG - Intergenic
975510935 4:75193468-75193490 GCAGAGGGGGTGTGTTGAACAGG + Intergenic
976948576 4:90799917-90799939 AGGGAATGGGTCAGTTGAACTGG - Intronic
977039795 4:92001985-92002007 GGAGACTGAGTGGTTTGGACTGG + Intergenic
977482134 4:97592752-97592774 GGGGAATGGGTGAGTTAAATAGG + Intronic
977518757 4:98055488-98055510 AGGGAATGGGTGAGTTAAACTGG + Intronic
977696380 4:99971190-99971212 GGGGAAGGGGTGACTTGAACAGG + Intergenic
979156676 4:117401228-117401250 GGGGAATGGGTGAATTGAACTGG + Intergenic
979158676 4:117430111-117430133 GAGGAATGGGTGAGTTGAAATGG - Intergenic
979437471 4:120710846-120710868 TGAGACTGGGTGATTTATACAGG - Intronic
980576473 4:134688499-134688521 GGGGAAGGGGTGAGCTGAACTGG - Intergenic
981511777 4:145565947-145565969 GGGGAAAGGGTGAGTTGAACAGG + Intergenic
981834882 4:149043014-149043036 GCCGAATGGGAGAGTTGAACAGG - Intergenic
981919213 4:150068396-150068418 GGAGCCTGGGTGAGGTGAGAAGG + Intergenic
982840165 4:160174615-160174637 GGGGAAGGGGTGAGTTTAACAGG + Intergenic
983420280 4:167507534-167507556 GGGGAATGGGTGAACTGAACTGG - Intergenic
983942311 4:173548014-173548036 GAGGACTGTGTGAGTGGAACAGG - Intergenic
985266965 4:188159667-188159689 GGTGAATGGGTGAGTTGATGCGG - Intergenic
985395407 4:189538443-189538465 GGGGAAGGAGTGAGTTGAACAGG + Intergenic
986304690 5:6506592-6506614 AGAGACTGTGTGAGTTGAAGGGG + Intergenic
987160120 5:15133045-15133067 GGGGAAGGGGTGGGTTGAACAGG - Intergenic
988200768 5:28066186-28066208 GGGGAATGGGTGAGTTGAACTGG + Intergenic
988348292 5:30069260-30069282 GGCTAATGGGTGAGTTGAACTGG + Intergenic
988864852 5:35323989-35324011 GAGGAATGGGTGAGTTGAGCTGG + Intergenic
989733808 5:44679093-44679115 GGGGAAGGGGTGAGTTGAATAGG + Intergenic
990840887 5:60077864-60077886 GGGGATGGGGTGAATTGAACAGG - Intronic
994970382 5:106730238-106730260 TGGGAAGGGGTGAGTTGAACAGG + Intergenic
995691306 5:114829402-114829424 GGGGCATGAGTGAGTTGAACTGG + Intergenic
995894605 5:116997856-116997878 GGAGAACGGATGAGTTGATCCGG + Intergenic
996377751 5:122831498-122831520 GAAGACTTGATGAGTTGAACAGG + Intergenic
996663052 5:126026974-126026996 GGGGAATGGGTGAGTTGAACTGG + Intergenic
997021442 5:130007520-130007542 GGAGAAGGGGTGAGTTAAATAGG + Intronic
997187851 5:131900400-131900422 GGGGAAGGGGTGAGTTGAGCAGG + Intronic
997859110 5:137400494-137400516 GCTGACTGGGTGGGGTGAACAGG - Intronic
998112703 5:139514427-139514449 GGAGCCTGGGTGAGTTGGGAGGG - Intergenic
999019912 5:148154018-148154040 GGGGAATGGTTGAGTTAAACTGG + Intergenic
1001766514 5:174252024-174252046 GAAGACTTTTTGAGTTGAACAGG + Intergenic
1001883194 5:175263317-175263339 GGAGACTGGGAAAGGTGAAAGGG + Intergenic
1001985084 5:176067544-176067566 GGAGAAAGGGAGAGATGAACAGG - Intronic
1002082510 5:176745894-176745916 GGGGACTGGGTGTGTGGAAGGGG + Intergenic
1002231781 5:177770591-177770613 GGAGAAAGGGAGAGATGAACAGG + Intronic
1002263560 5:178013162-178013184 GGAGAAAGGGAGAGATGAACAGG - Intronic
1004806209 6:19205989-19206011 GGGAAATGGGTGTGTTGAACCGG - Intergenic
1006253253 6:32808157-32808179 GGAAAATGGGTGAGTTGAACTGG - Intergenic
1006296676 6:33172953-33172975 GGAGTCTGGGTCAGGTGGACCGG + Intronic
1007375626 6:41454798-41454820 GCACACTGGGTGAGTTGGAGTGG + Intergenic
1008207970 6:48686459-48686481 GGGGAACAGGTGAGTTGAACTGG + Intergenic
1009446577 6:63749730-63749752 GGGGAATGGGTGAGTTGAACTGG - Intronic
1009508602 6:64518922-64518944 GGAGACTGGGTGATTTATAAAGG - Intronic
1010299043 6:74237380-74237402 GGAGGCTGGGTGAGTAGAGATGG - Intergenic
1010317420 6:74467133-74467155 GGAGAAGGGGTGAGTTGAACAGG - Intergenic
1010336064 6:74684857-74684879 GCAGAGGGGATGAGTTGAACAGG + Intergenic
1010547216 6:77173164-77173186 AGGCAATGGGTGAGTTGAACTGG - Intergenic
1010722531 6:79300157-79300179 AGAGATTGGGAGAGTTGAAATGG - Intergenic
1010821416 6:80419726-80419748 GGGGAAGAGGTGAGTTGAACTGG - Intergenic
1012320799 6:97842883-97842905 GGAGACTGTGTGAAATGATCAGG + Intergenic
1012490841 6:99780776-99780798 GGGGAATGGGTGACTTGAGCTGG - Intergenic
1013393873 6:109714207-109714229 GGGGAATGGGTGAGTTGAACTGG - Intronic
1013992206 6:116266025-116266047 AGGGAATGGGTGAGTTGAACTGG - Intronic
1015198916 6:130556145-130556167 ATAGACTAAGTGAGTTGAACAGG - Intergenic
1015325410 6:131918455-131918477 GGAGAATGGGTGACTTGAACTGG + Intergenic
1015678735 6:135780883-135780905 GGGGAATGGGCGAGTTGAACTGG + Intergenic
1015875602 6:137818905-137818927 TGGGACTGGGTGAGTAGAGCTGG + Intergenic
1016107095 6:140176169-140176191 GGATACTGGGTGAGCATAACTGG - Intergenic
1016453754 6:144210199-144210221 GGGTAATGGGTGAGCTGAACTGG - Intergenic
1016808714 6:148238816-148238838 GGAGGCTGGGTGAGTAGCAGAGG - Intergenic
1017633896 6:156424736-156424758 GGAGACTGGGTGGCTGGAGCTGG - Intergenic
1021762151 7:23912666-23912688 TGAGACTGGGTAATTTGTACAGG - Intergenic
1021967267 7:25932863-25932885 GGGGAATGAGTGAGTTGAACAGG + Intergenic
1022028013 7:26466708-26466730 TGAGACTGGGTGAGATCAACTGG + Intergenic
1022362973 7:29680874-29680896 GGAGGATTGGTGAGTTGCACAGG - Intergenic
1022428342 7:30289726-30289748 GGAGGATTGGTGAGTTGCACAGG + Intronic
1022698419 7:32732913-32732935 GGAGGATTGGTGAGTTGCACAGG + Intergenic
1023104691 7:36751937-36751959 GGAGACTGGGAGAGGTGGGCTGG + Intergenic
1023706394 7:42946073-42946095 GGGGACTGGGTGAGGTGGACAGG - Intronic
1024430434 7:49282336-49282358 GCAAACTGGCAGAGTTGAACTGG + Intergenic
1024591802 7:50892887-50892909 GGAGACTGGGTAATTTGTAAAGG + Intergenic
1024800363 7:53070576-53070598 AGAGGCTGGGTGAGTGGAATGGG - Intergenic
1026365467 7:69644107-69644129 AAAGACTGGGTGACTTAAACAGG - Intronic
1027991500 7:85368950-85368972 GGGGAAGGGGTGAGTTGAGCAGG - Intergenic
1028463705 7:91125039-91125061 GGAGGCTGTTTGAGTTGAAGTGG + Intronic
1029616692 7:101663701-101663723 CGAGACTGGGTGACTTGTAAAGG - Intergenic
1030264666 7:107607440-107607462 GGAAACTGGGTGAGATAAAGAGG - Intronic
1030454963 7:109761199-109761221 AGGGAAAGGGTGAGTTGAACAGG - Intergenic
1030692196 7:112547249-112547271 GGAGACCGGATGATTTGCACTGG - Intergenic
1030807766 7:113937591-113937613 GCGGAATAGGTGAGTTGAACTGG - Intronic
1031294241 7:119982706-119982728 GGAGAAGGGGTGAGTTGAGCAGG + Intergenic
1032367732 7:131315771-131315793 GGAGACTGGGAGGTTTGGACTGG + Intronic
1032435255 7:131895544-131895566 GAAGCCTGGATGAGTTGAAGAGG - Intergenic
1032542541 7:132715188-132715210 GGGTACTGGGTGAGGAGAACAGG + Intronic
1032878224 7:136060801-136060823 AGAGACTGGGAAAGTTGAGCAGG + Intergenic
1033494222 7:141877425-141877447 GGGGATCTGGTGAGTTGAACTGG - Intergenic
1034048395 7:147954930-147954952 GGAGACTGGATAAGGTGAAAGGG - Intronic
1034248294 7:149666103-149666125 GCAGACTGAGTGACTTGTACAGG + Intergenic
1035190507 7:157163430-157163452 GGAAACTGGGTGATGTGGACAGG - Intronic
1035859249 8:3010233-3010255 GGAGTCTGGGTGTTTTAAACAGG - Intronic
1036770903 8:11577825-11577847 GGAGACTTTCTGAGCTGAACTGG + Intergenic
1037373687 8:18206188-18206210 GGGGAACAGGTGAGTTGAACTGG - Intronic
1037567476 8:20129965-20129987 GGATCCAGGGTGAGTTGAAGTGG + Intergenic
1038564478 8:28608263-28608285 GGAGCGTGGGTGAGTTCAGCAGG - Intronic
1038859964 8:31376078-31376100 GGGGAAGGGATGAGTTGAACAGG - Intergenic
1038918583 8:32055763-32055785 AGAGACTGGAAGACTTGAACGGG + Intronic
1039264329 8:35808549-35808571 GGGGAACAGGTGAGTTGAACTGG + Intergenic
1039638745 8:39195021-39195043 GGGGAAAGGGTGAGTTTAACAGG - Intronic
1040597942 8:48858395-48858417 GGAGAAAAGGTGAGTGGAACTGG + Intergenic
1040601081 8:48884353-48884375 GTTGACTGGGGGAGTGGAACGGG + Intergenic
1040909377 8:52502686-52502708 GGAAACTGGGTGACTTTCACAGG - Intergenic
1040978021 8:53215376-53215398 GGGGAAGGGGTGAGTTGAACAGG - Intergenic
1042773644 8:72405486-72405508 GGAGACTGGGAGGTTTGAATTGG + Intergenic
1042976845 8:74478859-74478881 GGGGAAGAGGTGAGTTGAACTGG - Intronic
1044313669 8:90726033-90726055 GGGTAATGGGTGAGTTGAACTGG + Intronic
1044963736 8:97555907-97555929 GCAAACCGGGTGAGTTGAAGTGG - Intergenic
1045356139 8:101390726-101390748 GGAAACTGGGTAATTTGATCTGG + Intergenic
1046122625 8:109864902-109864924 GGAGACTGGGTAATTTATACAGG + Intergenic
1046597110 8:116273467-116273489 GGGAAAGGGGTGAGTTGAACAGG - Intergenic
1047168441 8:122466359-122466381 AGGGAATGGGTGAATTGAACTGG + Intergenic
1047327628 8:123854780-123854802 GGAGACTGTGGGAGTGAAACTGG + Intronic
1048119583 8:131564187-131564209 GTGGAATGGGTGAATTGAACTGG - Intergenic
1048357635 8:133666696-133666718 GGAGACTGGATTTGTTGGACTGG - Intergenic
1048808206 8:138260682-138260704 GGAAACTGTGTGAGTGGAAAGGG - Intronic
1049128003 8:140810086-140810108 GGGGAATGGGTGAGTGGAACTGG + Intronic
1049507189 8:143009035-143009057 GGAGAATGGGTGAGTTGAACTGG - Intergenic
1050424741 9:5501663-5501685 GCAGAAGGGATGAGTTGAACAGG + Intergenic
1051097035 9:13477778-13477800 GGGGAAGGGGTGAGTTGAACAGG - Intergenic
1051298103 9:15618286-15618308 GGAGACTGGGAGGTTTGGACTGG - Intronic
1051852829 9:21528680-21528702 GGGGAACTGGTGAGTTGAACTGG - Intergenic
1052534093 9:29726208-29726230 GGGGAATGGGTGAGTTGATTTGG + Intergenic
1053543051 9:38994251-38994273 GGAGGAGAGGTGAGTTGAACAGG - Intergenic
1053575424 9:39354491-39354513 GGAGACTGGGTGGTTTGCGCTGG + Intergenic
1053807490 9:41817768-41817790 GGAGGAGAGGTGAGTTGAACAGG - Intergenic
1053839932 9:42182425-42182447 GGAGACTGGGTGGTTTGCACTGG + Intergenic
1053908353 9:42868929-42868951 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1054096985 9:60913174-60913196 GGAGACTGGGTGGTTTGCGCTGG + Intergenic
1054118391 9:61188800-61188822 GGAGACTGGGTGGTTTGCGCTGG + Intergenic
1054589365 9:66993764-66993786 GGAGACTGGGTGGTTTGCGCTGG - Intergenic
1054623102 9:67369659-67369681 GGAGGAGAGGTGAGTTGAACAGG + Intergenic
1054965799 9:71025951-71025973 GCAGAAGGGGTGAGCTGAACAGG + Intronic
1055431172 9:76245769-76245791 GGAGAGTGGGTGTCTTGAAGGGG + Intronic
1056127358 9:83548572-83548594 GGAGAGTGGGTGAGATGAATAGG + Intergenic
1056497050 9:87167973-87167995 AGAGACTTTGAGAGTTGAACAGG + Intergenic
1057607327 9:96508765-96508787 GGAGACTGGCTGCTTTGCACTGG + Intronic
1057979798 9:99649757-99649779 GCAGAAAGGGTGAGTTGAACAGG + Intergenic
1059423036 9:114204830-114204852 GCAGAGTAGGTGAGCTGAACTGG - Intronic
1061951166 9:133936679-133936701 GGAGACTGGATGAGGTCCACAGG - Intronic
1062744376 9:138202088-138202110 TGAGTCTGGGTGGGTTGAGCTGG - Intergenic
1203703996 Un_KI270742v1:20444-20466 GGAGAAAGGGAGAGATGAACAGG - Intergenic
1203560018 Un_KI270744v1:45379-45401 GGAGAAAGGGAGAGATGAACAGG + Intergenic
1185942750 X:4339478-4339500 GGGGAATGGGGGAGGTGAACTGG - Intergenic
1186057439 X:5664992-5665014 GCAGAATGGCAGAGTTGAACTGG - Intergenic
1186418205 X:9401683-9401705 AGGGACTGGGTGAGCTGAGCAGG + Intergenic
1187644079 X:21328052-21328074 GCGGAGGGGGTGAGTTGAACAGG + Intergenic
1188492968 X:30755677-30755699 GAGAAATGGGTGAGTTGAACAGG + Intergenic
1188743895 X:33817823-33817845 GGAGAAAGGGTGAGTTGAACTGG - Intergenic
1188852571 X:35150406-35150428 GGGGAACAGGTGAGTTGAACTGG + Intergenic
1189029477 X:37435945-37435967 GGAAACTGGGTGAGGAGTACAGG + Intronic
1189558253 X:42166758-42166780 GGGAAAAGGGTGAGTTGAACTGG - Intergenic
1189678220 X:43486399-43486421 GGGGAAGGGGTGAGTTGAGCTGG + Intergenic
1189926323 X:45959312-45959334 GGGGAAGGGATGAGTTGAACAGG + Intergenic
1190524177 X:51311461-51311483 GGGAATTGGGTGAGTTGAACTGG - Intergenic
1191034065 X:56006309-56006331 GGGGAAGGGGTGAGTTAAACAGG - Intergenic
1191695377 X:63985038-63985060 GGGGAATGGATGAGTTGGACTGG + Intergenic
1191729201 X:64315254-64315276 GGGGAATGGGTGAGTTGAACTGG - Intronic
1191800519 X:65073789-65073811 GGAGAATGGGTGAGTTGAACTGG - Intergenic
1191823537 X:65339344-65339366 GGGAAATGGGTGAATTGAACTGG + Intergenic
1191888982 X:65921089-65921111 GGGGACAGGGGGAGTTGAACAGG - Intergenic
1192766529 X:74146076-74146098 GCAGAGGGGATGAGTTGAACAGG + Intergenic
1192916036 X:75652241-75652263 GGAGACTGGGAGGTTTGGACTGG - Intergenic
1192935212 X:75851429-75851451 GGGAAAAGGGTGAGTTGAACAGG - Intergenic
1192998019 X:76533185-76533207 GGAGACTGGGAGGTTTGGACTGG - Intergenic
1193092944 X:77513561-77513583 GGGGAATGAGTGAGTTGAAGTGG + Intronic
1193216948 X:78875201-78875223 CGAGACTGGGTGGTTTGAACTGG + Intergenic
1193250688 X:79288227-79288249 GGTGAATGGGTGAGTGGAATGGG + Intergenic
1193478395 X:81996189-81996211 GGAGACTTGGTGGTTTGGACTGG + Intergenic
1193577228 X:83214443-83214465 GGGGAATGGGTGATTTGAACAGG + Intergenic
1193703314 X:84790619-84790641 GAGGAATGGGTGAGTTGAACTGG + Intergenic
1193790345 X:85808844-85808866 TGGGAATGGGTGAGTTGAACTGG - Intergenic
1193960005 X:87914116-87914138 GGGGAATGGGTGAGTTGATCTGG + Intergenic
1194465851 X:94234786-94234808 GGGGAATAGGTAAGTTGAACTGG + Intergenic
1194549075 X:95273908-95273930 GGGAAATGGGTGAGTTGAACTGG + Intergenic
1195270045 X:103220371-103220393 GGGGAAGGGGTGAGATGAACAGG + Intergenic
1195435899 X:104843172-104843194 GGAGACTGGGAGGTTTGGACTGG - Intronic
1195544658 X:106101056-106101078 GCAGAGGGGGTAAGTTGAACAGG - Intergenic
1195567973 X:106363974-106363996 GGGGACTGGATGAGTTGAACTGG - Intergenic
1195568390 X:106371677-106371699 GGGAAATGGATGAGTTGAACTGG + Intergenic
1195695502 X:107663966-107663988 GGAGACTGAGGGAGGAGAACTGG - Intergenic
1196230542 X:113216362-113216384 GAGGAATGGGTGAGTTGAACTGG - Intergenic
1196468070 X:115993211-115993233 GGGGAATGGGTGAGTTGAACTGG + Intergenic
1196574529 X:117302613-117302635 AAAGAAGGGGTGAGTTGAACAGG - Intergenic
1196583981 X:117408728-117408750 GGGGAATGTGCGAGTTGAACTGG + Intergenic
1196586845 X:117439937-117439959 GGGGAAGGGGTAAGTTGAACAGG + Intergenic
1197319123 X:125006240-125006262 GGAGACTGGGAGGTTTGGACTGG + Intergenic
1197370717 X:125622262-125622284 TGGGAATGGGTGAGTTGAGCAGG - Intergenic
1197378773 X:125713403-125713425 GGGGAACGGGTGAGTTGAACTGG + Intergenic
1197404347 X:126030551-126030573 GGAGAATGGGTGAGTTGAACCGG - Intergenic
1197422805 X:126258898-126258920 GGGAAAAGGGTGAGTTGAACGGG - Intergenic
1197426530 X:126304178-126304200 TGAGACTGGGTGACTTAAAAAGG - Intergenic
1197790337 X:130248316-130248338 GGGGAATGGGTGAGTTGAACTGG + Intronic
1198060551 X:133041976-133041998 GGAGACTGGAAGATTTGGACTGG - Intronic
1198343706 X:135739687-135739709 GGGGAGTGGGGGAGTGGAACAGG - Intergenic
1198841711 X:140864746-140864768 GAGGAAGGGGTGAGTTGAACAGG + Intergenic
1199136940 X:144265356-144265378 GCAGAAGAGGTGAGTTGAACAGG + Intergenic
1199400072 X:147389129-147389151 GGTGAAGGGGTGAGTTGAGCAGG + Intergenic
1199560895 X:149161485-149161507 GGGGAATGGGTAAGTTAAACAGG + Intergenic
1199640653 X:149858130-149858152 GGGGAAGGGGTGAGTTAAACAGG + Intergenic
1199801232 X:151253090-151253112 GGAGACTGGGAGGTTTGGACTGG + Intergenic
1199912965 X:152307765-152307787 GGAGAAGGGGTGAGTTAAATAGG + Intronic
1201228918 Y:11844955-11844977 GGGGAATGAGTGAGTTGAACTGG + Intergenic