ID: 931494288

View in Genome Browser
Species Human (GRCh38)
Location 2:62785236-62785258
Sequence TGTGGGTTATGATCCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 6, 3: 16, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931494288_931494291 30 Left 931494288 2:62785236-62785258 CCACTAATGGATCATAACCCACA 0: 1
1: 1
2: 6
3: 16
4: 132
Right 931494291 2:62785289-62785311 ATTGAAATGTGCAAAACTGAAGG 0: 1
1: 0
2: 1
3: 25
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931494288 Original CRISPR TGTGGGTTATGATCCATTAG TGG (reversed) Intronic
902031301 1:13424497-13424519 TGTGGGTGTTGATCCCGTAGGGG - Intergenic
903767060 1:25741752-25741774 TGTGGGCAATGAGCCATTAGAGG + Intronic
905310793 1:37047510-37047532 TGTGGCTTCTGGTCCATTATGGG - Intergenic
905963483 1:42066333-42066355 TGTGGGTCACAATCCATTATTGG - Intergenic
907657910 1:56363405-56363427 TGGGGGTTATGACCCATTAGTGG - Intergenic
910441607 1:87258535-87258557 TGTGGGTAAATATCCAGTAGTGG + Intergenic
911222454 1:95263315-95263337 TGTGGGTTAAGAGCCTTTAGAGG - Intergenic
912543680 1:110435649-110435671 TGTGGATTGAGATCCATTAGTGG + Intergenic
914242960 1:145864520-145864542 CGTGGGTCTTGACCCATTAGTGG + Intergenic
915084352 1:153374975-153374997 GGTGGGTTATGGACCATTTGTGG - Intronic
921443608 1:215218376-215218398 TGTGGGTTATGTTAAATTTGAGG - Intronic
924379804 1:243451979-243452001 TGTGGGTCATGACCCTTTAGTGG - Intronic
1063451307 10:6152157-6152179 TGTGGGTCACCACCCATTAGTGG - Intronic
1069757884 10:70785019-70785041 TGTGGGTTATGACCCCCTGGTGG - Intronic
1072899789 10:99396828-99396850 TGTGGGTCACAACCCATTAGTGG + Intergenic
1073043422 10:100622316-100622338 TCTGGGTTAGGATACATTGGAGG + Intergenic
1074073636 10:110099459-110099481 TGTGGGTCACAACCCATTAGTGG + Intronic
1075283630 10:121163401-121163423 TGTGGGTCAACATCTATTAGTGG + Intergenic
1077925475 11:6678350-6678372 AGTAGATTATAATCCATTAGTGG + Intergenic
1078211511 11:9273733-9273755 TGTGGGTTATGATAGATGAAGGG - Intergenic
1080455321 11:32413590-32413612 TGTGGGTCATGACACATCAGTGG + Intronic
1082828708 11:57599425-57599447 TGTGGGTTGCAACCCATTAGTGG - Intronic
1087110169 11:94457477-94457499 TGTTTGTTATGATTCAGTAGAGG + Intronic
1087174997 11:95088515-95088537 TGCAGGTCATGAGCCATTAGTGG + Intergenic
1089783177 11:120888859-120888881 TGTGGGTTGCAACCCATTAGTGG - Intronic
1089919050 11:122189946-122189968 TGTGAGTTAGGATCCATAATAGG - Intergenic
1089986410 11:122818277-122818299 TGTGGGTTTACATCCATTTGTGG - Intergenic
1090179381 11:124682370-124682392 TTCTGGTTATGATCTATTAGTGG - Intronic
1090193117 11:124790993-124791015 TGTAGGTTATGGCCCATTAGTGG + Intronic
1090646887 11:128773513-128773535 GGTGTGTTAGGATCCATTGGAGG + Intronic
1091695702 12:2626747-2626769 TATGGGTTAAGCTCCATTTGGGG - Intronic
1098109903 12:67111252-67111274 CTTGGGTTATGTTCCATTACAGG - Intergenic
1099064829 12:77962706-77962728 TGTGGATTACCATCCATTAATGG + Intronic
1100194210 12:92225592-92225614 AGTGGGTCATGACCCATTAGTGG + Intergenic
1100716544 12:97312245-97312267 TGTGGGTTATAATAGTTTAGGGG + Intergenic
1101012424 12:100464807-100464829 TGTGTGATATGACCCATTAGTGG - Intergenic
1103315966 12:120055917-120055939 TGTGGGTAATTTTCCATAAGTGG - Intronic
1103629099 12:122245087-122245109 TGTAGATCATGTTCCATTAGTGG + Intronic
1117369491 14:55063219-55063241 TGTGGGATACGATCCTGTAGGGG - Exonic
1119732609 14:76960479-76960501 TGTAGGTTGAGATCCATTCGTGG + Intergenic
1121274941 14:92661109-92661131 TATGGCTTCTGAACCATTAGCGG - Intronic
1128009207 15:64275668-64275690 TGTAGAACATGATCCATTAGTGG + Intronic
1135482311 16:22831238-22831260 TGTGGGATATGTACCACTAGTGG - Intronic
1139714454 16:68801768-68801790 TGTGGGTTATGAAACCGTAGAGG - Exonic
1140584529 16:76274172-76274194 TGTGGGATATGACCCACTGGTGG - Intergenic
1141364878 16:83433419-83433441 TGTGGGCTATCATTCATTACTGG + Intronic
1146447640 17:32945124-32945146 TGTGGGTTGTAACCAATTAGTGG - Intergenic
1147992819 17:44345460-44345482 TGGGGGTTCTGATACACTAGGGG + Intronic
1148766918 17:50044933-50044955 TGTGGCTCATGCTCCATCAGAGG + Intergenic
1149730592 17:58942057-58942079 TGCAGTTTATGATCCATTAGTGG - Intronic
1151286105 17:73112459-73112481 TGTGGGTTATTATCTGTTACAGG - Intergenic
1154101424 18:11478493-11478515 TGTGAGTTGTGATCCTTTGGAGG + Intergenic
1158236855 18:55325217-55325239 TTTGGGTTAAGCTCCATTTGGGG + Intronic
1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG + Intergenic
1164001047 19:21099545-21099567 AGTGGTTTCTGTTCCATTAGGGG + Intronic
1164182654 19:22832845-22832867 TGTAGTTTGTGGTCCATTAGAGG + Intergenic
1166620903 19:44299265-44299287 TGTGGGTCATGATCCATTGGTGG - Intronic
926386678 2:12342249-12342271 TGTGGGTAATGAATCATAAGAGG - Intergenic
927578598 2:24221417-24221439 TGCAGGTCATGAGCCATTAGTGG + Intronic
929837729 2:45422426-45422448 TGAGGGTTATGATCAATTAGTGG + Intronic
931494288 2:62785236-62785258 TGTGGGTTATGATCCATTAGTGG - Intronic
931870354 2:66451008-66451030 TGTGGGTTATTACCCATATGTGG + Intronic
933140186 2:78782920-78782942 TGTGGGTTATGCTACAAAAGGGG + Intergenic
933220703 2:79684380-79684402 TATAGGTCATGATCTATTAGTGG - Intronic
938132986 2:128733117-128733139 TGTGGGATATGCTGCACTAGGGG + Intergenic
938657803 2:133452415-133452437 TGTGGATTATCCTCCATCAGTGG - Intronic
940250909 2:151675155-151675177 TATGGGATATGTTCCAGTAGGGG + Intronic
940483188 2:154262430-154262452 TGTGTATTATCTTCCATTAGAGG - Intronic
940637728 2:156319310-156319332 TGAGGGTCCTGACCCATTAGTGG - Intergenic
943990125 2:194678181-194678203 TGTAGGTTATGTTCCATTTCTGG - Intergenic
945293691 2:208149723-208149745 TGTAGGTTCTGTTCCAATAGAGG - Intergenic
946015916 2:216603750-216603772 TGTGGTTTATGAATCACTAGTGG - Intergenic
1178447938 21:32662475-32662497 TGTGTGTTATGATCCCTCTGTGG + Intronic
1178988787 21:37333894-37333916 TCTGGGTTAACATCCAGTAGGGG - Intergenic
1182390978 22:29995881-29995903 AATAGGTTATGATCCAGTAGTGG + Intronic
1183760045 22:39807716-39807738 TGTGGGTTGTGACCAATTAGTGG + Intronic
951068220 3:18293285-18293307 TGTGGGTCAGAATCCAGTAGAGG - Intronic
957024830 3:75169389-75169411 TGTGACTTATGACCAATTAGTGG + Intergenic
959157870 3:102688447-102688469 TGTGGGATTTTATCCCTTAGGGG - Intergenic
962558869 3:136584955-136584977 TGTGAGTTATGATTCATTCCAGG - Intronic
962738022 3:138343090-138343112 TGTAGGTTACAATCCATTAATGG + Intergenic
963381006 3:144530354-144530376 CTTGGGTTATGATCCCTAAGAGG + Intergenic
963612385 3:147486435-147486457 TGTGGGTTATGTGCCATTTTTGG + Intronic
963962294 3:151322980-151323002 TTTGGGGTATGTTCCATTTGAGG - Intronic
964425166 3:156545179-156545201 GGTAGGTTGTGACCCATTAGTGG + Intronic
964648384 3:158983952-158983974 TGTGGGTGCTTATTCATTAGTGG + Intronic
966532047 3:180992103-180992125 TTTAGGTGATGATCAATTAGTGG - Intergenic
966715796 3:183011924-183011946 TGTTGGATAAGACCCATTAGAGG - Intergenic
967121086 3:186383517-186383539 TGTGGGTCATGAACCAATCGAGG + Intergenic
970039000 4:11774606-11774628 TGTGGATTGAGATCAATTAGTGG - Intergenic
970389788 4:15596542-15596564 TGCAGGGTATGATCCACTAGGGG + Intronic
972558625 4:40205537-40205559 TGTTGGTCATCTTCCATTAGTGG + Intronic
976785124 4:88810943-88810965 TGTGGGTCATGACCTATTAGTGG - Intronic
978460706 4:108948940-108948962 TGTTGTATATGATCTATTAGGGG + Intronic
979324590 4:119363899-119363921 TGTGGGTGGTGATCAACTAGTGG + Intergenic
984564672 4:181313829-181313851 TGTGGGTTGTGACCCAGTAGTGG + Intergenic
984579803 4:181499095-181499117 TGTGGGTCATTATCTATTATTGG - Intergenic
986580166 5:9257702-9257724 TGGGGGTTCTGAACCACTAGTGG - Intronic
986802032 5:11271247-11271269 TACAGGTTGTGATCCATTAGTGG - Intronic
991158935 5:63472303-63472325 TGTGGATTATGACCCATTAGTGG - Intergenic
991448581 5:66727370-66727392 CGTGGGTCTTGACCCATTAGTGG - Intronic
994846300 5:104992828-104992850 TGTGGGATATTATCCATTTTCGG - Intergenic
995118683 5:108512099-108512121 TGTGGGCTATGGCCCTTTAGAGG - Intergenic
996060943 5:119032641-119032663 TGTGGATCATGATCTATGAGTGG - Intergenic
996391057 5:122962612-122962634 TATGGGTAATGATCCTTCAGAGG + Intronic
996456602 5:123691187-123691209 TGTGGTTTTATATCCATTAGTGG + Intergenic
997963743 5:138341535-138341557 GCTGGGTTTTGAGCCATTAGTGG - Intronic
998929567 5:147165936-147165958 TGTGGTTTGTAACCCATTAGTGG + Intergenic
999663081 5:153885829-153885851 TGTGGGTCATGGCCCATTAGTGG - Intergenic
1000423931 5:161068680-161068702 TTTGGGTTATAATCCAATAATGG + Intergenic
1003190227 6:3867993-3868015 TGTGGCTTGGGATGCATTAGTGG - Intergenic
1005297038 6:24436800-24436822 GTTGGGTTAGGATCCAGTAGCGG - Intronic
1008015207 6:46510926-46510948 TGTGGCTTATGTTCCAGCAGAGG - Intergenic
1008934025 6:56969940-56969962 TATGGATTATAATCCATTAATGG + Intronic
1009317566 6:62240163-62240185 TTTGGGTTATAATCCAATATTGG + Intronic
1011420374 6:87165576-87165598 TGTGGGTTATGACCTATTGGTGG - Intronic
1012582929 6:100890222-100890244 TGTGGGATACGATCCTGTAGGGG - Intergenic
1013646870 6:112152289-112152311 TGTGGGTAGGGATCGATTAGTGG + Intronic
1013703671 6:112806269-112806291 TGTGGGTTCTGATTCATTAAAGG - Intergenic
1014856653 6:126411011-126411033 AGTGAGTTATGTTCCTTTAGTGG + Intergenic
1016546059 6:145225626-145225648 TGTGGGTTATGCTGTGTTAGGGG + Intergenic
1018166769 6:161105077-161105099 TATGGGTTGTGAACCATTAGTGG + Intronic
1020954249 7:14720234-14720256 TGTGATTTTTGATCCATTGGTGG - Intronic
1022944764 7:35271436-35271458 TGTGTGCTATGATTCATCAGGGG - Intergenic
1023000636 7:35803908-35803930 TGCAGGTTGTGACCCATTAGTGG + Intronic
1023974956 7:45021863-45021885 TGTGGGTTATGATTCATTAGTGG + Intronic
1024925888 7:54615182-54615204 TGTGCATTATGAACTATTAGAGG + Intergenic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1037655670 8:20882102-20882124 TGTGTGTTATGGCCCATGAGAGG + Intergenic
1038018135 8:23531868-23531890 GGTGGGCCATGACCCATTAGTGG + Intronic
1038985741 8:32808024-32808046 TGTGGGTTATCTTCCATTTTTGG - Intergenic
1039674316 8:39643474-39643496 TTTGGGTTTTGATATATTAGGGG + Intronic
1041866883 8:62584047-62584069 TGTGGCATATGTCCCATTAGAGG + Intronic
1042456745 8:69014120-69014142 TTTGTGTTATGATCCATTAGTGG - Intergenic
1044067834 8:87720428-87720450 TGTGGGTTCTCATTCATAAGTGG - Intergenic
1044551853 8:93521138-93521160 GGTGGACCATGATCCATTAGTGG + Intergenic
1045084643 8:98669387-98669409 TTGGTGTTATGATCAATTAGAGG - Intronic
1047032470 8:120897047-120897069 TCTGGGTTTGGATCCATTGGTGG - Intergenic
1048611363 8:136026807-136026829 TTTGGTTTATGATCCTTCAGTGG + Intergenic
1048612821 8:136042241-136042263 TATGTGTTGTGATCCTTTAGGGG + Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1050076421 9:1870320-1870342 TGTGGTTTATGGTCTATTTGGGG - Intergenic
1051166582 9:14268440-14268462 TGGGGGTCATGAACCATCAGGGG - Intronic
1054861079 9:69954168-69954190 TGTGGGTTGTACTCCATTTGTGG - Intergenic
1056852215 9:90094305-90094327 TGTGGGTTGCCACCCATTAGTGG - Intergenic
1056989369 9:91396025-91396047 TGTGGGTTATGACTCATTTCAGG + Intergenic
1056993717 9:91435198-91435220 TCTGGGTTCTGATCATTTAGAGG - Intergenic
1186370398 X:8940666-8940688 TGTGGCTTGTGATCCACTGGAGG - Intergenic
1186717237 X:12265397-12265419 TATGGGTTCTGATTCCTTAGAGG + Intronic
1188289651 X:28371788-28371810 TTTGGGACATGATCCAGTAGGGG + Intergenic
1189089402 X:38063983-38064005 TGTGGATCATGACCCATTGGTGG + Intronic
1192323928 X:70116186-70116208 TGTGGGTTGTGCCCCATTTGAGG - Intergenic
1194796654 X:98219495-98219517 TGTAGGTTGTAATCCATTGGTGG - Intergenic
1195444472 X:104936250-104936272 TGTGGATTATGACCCATTCCTGG + Intronic
1195799888 X:108696116-108696138 TATGGTTTAAGAGCCATTAGTGG - Intronic
1197886534 X:131223842-131223864 AGTGGGTTATGATCCATTTGTGG + Intergenic