ID: 931494725

View in Genome Browser
Species Human (GRCh38)
Location 2:62790970-62790992
Sequence CCAGAAACCCACATCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931494725 Original CRISPR CCAGAAACCCACATCTATAT TGG (reversed) Intronic
902454801 1:16525086-16525108 CCAGCAACCCACAAATTTATGGG - Intergenic
902497647 1:16885267-16885289 CCAGTAACCCAGATATTTATGGG + Intronic
909071229 1:70996187-70996209 CCAGACACTCACATCTTTGTTGG - Intronic
909944435 1:81648005-81648027 CTAGTGACCCACATCTAAATAGG - Intronic
911073423 1:93850140-93850162 CCAGAAACCCATATGCATGTGGG - Intergenic
913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG + Intergenic
913480474 1:119283968-119283990 CCAGAGACACAGATCTTTATTGG - Intergenic
915950955 1:160189754-160189776 CCCCAAACCCACATCTCTACAGG + Intergenic
918788326 1:188793533-188793555 CCAGAAAAGCACCTCTTTATGGG + Intergenic
920956197 1:210622240-210622262 CCAGAAACCCACACATCTCTAGG - Intronic
923830736 1:237553111-237553133 CTAGGAACCCACAACTATAAAGG - Intronic
1073841055 10:107499483-107499505 GGAGAAACCTACATCTATCTGGG - Intergenic
1081192142 11:40116935-40116957 AAAGAAACCCACATTTATATGGG - Intronic
1081504761 11:43704545-43704567 ACAGAATCCCACATTTGTATAGG + Intronic
1087495190 11:98882140-98882162 ACACAAACACACATATATATGGG - Intergenic
1089049881 11:115536873-115536895 CCATAAACCCTCATTTATATTGG + Intergenic
1089823604 11:121251145-121251167 CCACAAACCCACATTCATGTTGG - Intergenic
1093847568 12:23992065-23992087 TCAGAAACCCAGATCAGTATTGG + Intergenic
1096497889 12:52049231-52049253 CCAAAAACCCACATATACAGAGG - Intronic
1096743753 12:53712599-53712621 CCTGAAACCCCCACCTCTATAGG + Intronic
1096898982 12:54854697-54854719 CCATAAGCCCACATCTTTAGAGG - Intronic
1097380563 12:58891003-58891025 ACAGAACCCCAGATTTATATAGG - Intronic
1098305261 12:69096266-69096288 GCAGAAAGTCACATCTATCTTGG - Intergenic
1098850165 12:75586853-75586875 CCAAAAACCCAAATCTAGACTGG - Intergenic
1103370039 12:120412288-120412310 CCAGTAACATACATATATATAGG + Intergenic
1104254923 12:127127659-127127681 TCAGAAGCCCACATTTCTATGGG - Intergenic
1107965140 13:45590961-45590983 CCAGAAGCCTACTTCTGTATTGG + Intronic
1109532754 13:63673095-63673117 ACAGAAACACACATATACATAGG - Intergenic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1115302509 14:31900529-31900551 CCAGAAATCCACATTCTTATAGG - Intergenic
1116466343 14:45237296-45237318 CCAGATTCTCACATCTAAATTGG - Intronic
1116782248 14:49249574-49249596 CCAGAAACACACAGCTAAACAGG + Intergenic
1117234107 14:53753156-53753178 ACAAAAACTCACAGCTATATTGG + Intergenic
1124082384 15:26513469-26513491 CCAGAATCCCACATCGGCATAGG - Intergenic
1125397789 15:39269250-39269272 CCAGAAACCCAGATTTTTACAGG + Intergenic
1127548500 15:60013824-60013846 CCAGGAACCCAGAGCAATATCGG + Intronic
1128117959 15:65124059-65124081 CCACCAACCCACATCTCTCTCGG + Intronic
1130842338 15:87712704-87712726 TCAGAAAACCACATTTTTATTGG - Intergenic
1132720535 16:1313594-1313616 CCAGCACCCCACATCCATCTGGG + Intronic
1133060702 16:3172494-3172516 CTAGAAACCCACATCTCTGCAGG + Intergenic
1135492576 16:22922694-22922716 CCAGAGACGCACAGTTATATTGG + Intergenic
1140375055 16:74438593-74438615 CAGGAAACCCACAGCTCTATGGG - Intergenic
1140524283 16:75609512-75609534 CAAAAAACCAACATCTTTATAGG + Intronic
1148981734 17:51582512-51582534 CCACACACACACATATATATAGG - Intergenic
1149309537 17:55380642-55380664 CCAGCACCCAACATCTATCTGGG - Intergenic
1151544512 17:74784586-74784608 CCAGAAGCCCACCCCTATTTTGG - Intronic
1153303789 18:3614303-3614325 CCAGAACCCCAGTTCAATATTGG - Intronic
1155433250 18:25784176-25784198 ACAGAAACCCACAGCAATAATGG + Intergenic
1160295085 18:77630365-77630387 CCAGAAACCCAGCTCTGTGTTGG - Intergenic
1161126775 19:2562238-2562260 CCAGGAACACACATCTACAGCGG + Intronic
1165453247 19:35897075-35897097 CCAGACACCCAGTTCTATGTAGG - Intronic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
931451792 2:62373675-62373697 CCAGAAATCCAGATTTTTATGGG + Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
931916427 2:66961743-66961765 CCAGAAAACCACACATATTTGGG - Intergenic
933217730 2:79649713-79649735 GAAGAAACCCAAATCTAAATCGG + Intronic
933533970 2:83548471-83548493 CCAGAAACACACATATATGAAGG - Intergenic
933906048 2:86893671-86893693 CCAGAAAAACTCATCTATAAAGG - Intergenic
936019386 2:108983424-108983446 CCATAAAACCACATCTAACTGGG + Intronic
936500284 2:113061285-113061307 GCAGAAACCCACTCCCATATGGG - Intronic
938015583 2:127864493-127864515 ACAGAGACCCACATCAAGATCGG - Exonic
939078731 2:137634211-137634233 CCAGAAACCAACATCTAGAAGGG - Intronic
941461769 2:165780434-165780456 CTAGAAATACAGATCTATATTGG - Intronic
942487071 2:176451206-176451228 CCAGCAGCCCACATTTATAGGGG - Intergenic
942619341 2:177830809-177830831 CAAGAAACCCTCATGTTTATGGG - Intronic
943802055 2:192072860-192072882 CAGGAAAACCACCTCTATATAGG + Intronic
945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG + Intronic
947114630 2:226755889-226755911 CCAAAAACATACATGTATATGGG + Intronic
1170295080 20:14815198-14815220 CCAGGAAACCACATCTTTCTAGG - Intronic
1171079339 20:22162453-22162475 CCAGAAACAAACATCTGAATCGG + Intergenic
1172528467 20:35615513-35615535 CCAGAAAACCCCATCTAAAATGG - Intergenic
1173169377 20:40711367-40711389 CGAGAAGCCCACCTCTTTATGGG + Intergenic
1174963866 20:55188524-55188546 ACAGAAACCCAAATATAAATGGG - Intergenic
1178802666 21:35810703-35810725 CCAGAAACCCACAGTCACATGGG + Intronic
950049155 3:9973122-9973144 CCAGAAATCCTCATCTTTAAGGG + Intronic
950183560 3:10931617-10931639 CCAGAAACGCAGATTTGTATGGG - Intronic
953210009 3:40867438-40867460 CCAGAAACACACATGGATGTTGG - Intergenic
953663984 3:44912414-44912436 CCAGAGACCCAGATATATATGGG - Intronic
956738467 3:72256883-72256905 CCAGAAACCCAAATCTCTCCTGG + Intergenic
957142163 3:76374346-76374368 TCAAAAACCCACATTTATTTAGG + Intronic
962020013 3:131490062-131490084 CTAGAAAGCTACATCCATATTGG - Exonic
964620372 3:158715251-158715273 CCAGAAACCTGCTTCTATCTTGG + Intronic
966137575 3:176716990-176717012 CCAGAAAGACACATTTGTATAGG + Intergenic
966931455 3:184678317-184678339 CCAGAAACCCACTGCTAAACTGG + Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
971050796 4:22860111-22860133 CCAGAAACACAAATCTTTAAGGG + Intergenic
978466507 4:109014654-109014676 CTAAAAACTGACATCTATATAGG + Intronic
979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG + Intergenic
980556806 4:134418165-134418187 TCAGAAAACCTCATTTATATAGG + Intergenic
983261206 4:165459061-165459083 CCAGAAACTCACATCCATGTGGG - Intronic
987126655 5:14819320-14819342 CCAGGCACCCATATCTATGTGGG + Intronic
987632122 5:20487387-20487409 CCTGAAACCTATATATATATAGG - Intronic
992382154 5:76248499-76248521 CCAGTACCTCAGATCTATATTGG - Intronic
999660465 5:153857180-153857202 CCAGAAATTCAATTCTATATAGG + Intergenic
1007453275 6:41956683-41956705 CCAGAATCCAAGATGTATATAGG - Intronic
1010806462 6:80242878-80242900 CCAGAGACCCAAATCTGTTTGGG + Intronic
1011035539 6:82970320-82970342 CCACAAACACAAATCTATAAGGG + Intronic
1011581827 6:88876695-88876717 CCAGTAGCCCAGCTCTATATAGG + Intronic
1015297893 6:131619579-131619601 CAAGAAACCCACTTCTAGAATGG + Intronic
1017338175 6:153286358-153286380 CCAATAACTCACATCTATATTGG + Intergenic
1017708534 6:157146667-157146689 CGAGAAGCTCACATCTACATGGG - Intronic
1018051150 6:160009532-160009554 AGAGATACCCACATCTATTTAGG + Intronic
1026405774 7:70064052-70064074 GCTGAAACCCACATCCATTTGGG - Intronic
1030728924 7:112961199-112961221 ACAGAAAGCCACATTTTTATTGG - Intergenic
1031385833 7:121149879-121149901 CCTGATGCCCACATCTTTATGGG + Intronic
1033214075 7:139481622-139481644 CCAGAAAGCCACATCTTGAAAGG - Intronic
1035310884 7:157968018-157968040 CCAGAAAGCCAAGTCTATAAAGG - Intronic
1039142972 8:34413872-34413894 CCAGATATACACATCTTTATGGG + Intergenic
1042082643 8:65071768-65071790 CCAGCAACCCACATCACCATGGG - Intergenic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1048470637 8:134700995-134701017 CCATAAACACACATTTACATGGG - Intronic
1056025920 9:82495530-82495552 CCAGGAAGCCACATCCCTATGGG - Intergenic
1057680123 9:97172787-97172809 TCAGAAACTCACAACTTTATAGG - Intergenic
1058740602 9:107938811-107938833 CCAGAAACCAAAAGGTATATTGG - Intergenic
1185536600 X:867583-867605 TCAGAAACCCACATTGATACTGG + Intergenic
1187190493 X:17030487-17030509 CTAGCAGCCCACATCTTTATGGG - Intronic
1187929081 X:24277437-24277459 CCTGGAAGCCACATCTAAATTGG + Intergenic
1188121329 X:26311736-26311758 GCAGAAGCCCACATCTCAATGGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190448524 X:50555172-50555194 CCAGCAACCCAAAGCTATAGAGG - Intergenic
1192480537 X:71481375-71481397 ACAGAAAACCACATATCTATAGG + Intronic
1196036687 X:111152761-111152783 CCAGAAAGCCAAATCCATAAAGG - Intronic
1197488916 X:127091267-127091289 CCACAAAACTACATGTATATAGG - Intergenic
1200088293 X:153622246-153622268 ACAAAAACACACATCTATAAAGG + Intergenic