ID: 931495732

View in Genome Browser
Species Human (GRCh38)
Location 2:62804974-62804996
Sequence TTCATGGAAGACAGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 365}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931495732_931495740 22 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495740 2:62805019-62805041 ATTGGGGACAGCTGTTCTAGAGG 0: 1
1: 0
2: 6
3: 55
4: 335
931495732_931495737 5 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495737 2:62805002-62805024 TCTCTGGTGCCAGAAAGATTGGG 0: 1
1: 18
2: 266
3: 1509
4: 2032
931495732_931495736 4 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495736 2:62805001-62805023 GTCTCTGGTGCCAGAAAGATTGG 0: 1
1: 19
2: 254
3: 1506
4: 2073
931495732_931495741 30 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG 0: 1
1: 0
2: 1
3: 20
4: 204
931495732_931495738 6 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495738 2:62805003-62805025 CTCTGGTGCCAGAAAGATTGGGG 0: 1
1: 15
2: 247
3: 1491
4: 1974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931495732 Original CRISPR TTCATGGAAGACAGTTTTCC AGG (reversed) Intronic
900537621 1:3186705-3186727 CTCATGAAAGACACATTTCCGGG - Intronic
904019485 1:27451751-27451773 TTCAAGGAAGAAAGTGTACCTGG - Intronic
904268721 1:29334180-29334202 TTCATGGAACATAGTTTGCAGGG - Intergenic
904955109 1:34276640-34276662 TTCCTAGAAGACAGATTGCCAGG + Intergenic
905489138 1:38329823-38329845 TGCATGGAAGAAAGTTGCCCTGG - Intergenic
905876315 1:41434003-41434025 ACAATGGAAAACAGTTTTCCAGG - Intergenic
906286446 1:44590899-44590921 GCCCTGGAAGATAGTTTTCCAGG + Intronic
906755352 1:48308685-48308707 TTTTTGAAAGACAGTTTTGCTGG + Intronic
907330044 1:53664844-53664866 TTCTTGGGGGACAGTATTCCAGG + Intronic
907645454 1:56238064-56238086 TTCATTGAAGATAGTTTACATGG - Intergenic
907662990 1:56410678-56410700 TCCATGGAAAACCATTTTCCTGG - Intergenic
908806167 1:67935643-67935665 TTTATGGACCACAGTTATCCTGG - Intergenic
910454660 1:87384608-87384630 TTCAAGGAAAACAATTTTACTGG + Intergenic
910996364 1:93108418-93108440 TTTTTGAAAGACAGTTTTGCTGG + Intronic
911268349 1:95771049-95771071 TTCTTGATAGACAGTTTTTCTGG + Intergenic
911639993 1:100278119-100278141 TTCATGGCAGACAGATCTGCAGG - Intronic
911995752 1:104764019-104764041 TTTCTGAAAGACAGTTTTGCTGG + Intergenic
912273288 1:108231306-108231328 TTCATGGAAGACCATTTTTCAGG + Intronic
912294932 1:108463016-108463038 TTCATGGAAGACCATTTTTCAGG - Intronic
912858473 1:113192402-113192424 CTCATGGGAGACAGGGTTCCTGG - Intergenic
913594782 1:120364679-120364701 TTTTTGGAAGACATTTTTGCTGG + Intergenic
914092485 1:144514307-144514329 TTTTTGGAAGACATTTTTGCTGG - Intergenic
914306045 1:146419568-146419590 TTTTTGGAAGACATTTTTGCTGG + Intergenic
914314072 1:146492721-146492743 TTCATGGAAGACAAAATTACTGG + Intergenic
914500275 1:148240659-148240681 TTCATGGAAGACAAAATTACTGG - Intergenic
914596006 1:149153244-149153266 TTTTTGGAAGACATTTTTGCTGG - Intergenic
915005589 1:152632334-152632356 TTCATGGAATCCATTCTTCCTGG - Intergenic
916140321 1:161691830-161691852 TTCCTGGAAGACAGTGTCCTGGG - Intergenic
916262181 1:162853074-162853096 TTCATGGAAGAAAGTGTTGGAGG + Intronic
916758302 1:167793817-167793839 TTCATAAGAAACAGTTTTCCTGG - Intergenic
917029723 1:170676251-170676273 CTCAGGGAAGAAATTTTTCCTGG + Intronic
917196199 1:172468482-172468504 TCCGTGGAAGACAGCTGTCCTGG - Exonic
917402020 1:174660330-174660352 TTCATGTAAGAAACTATTCCAGG + Intronic
917635106 1:176928417-176928439 ATTATGGAAGACAGTTATGCAGG + Intronic
917654541 1:177113121-177113143 TTCATGAGAGGCAGTTTTCAGGG - Intronic
918988507 1:191665137-191665159 TACAAGGAAAACAATTTTCCTGG + Intergenic
920754756 1:208718360-208718382 TTCATGGTAGAAAATTGTCCTGG + Intergenic
922637402 1:227187982-227188004 TTCCTGAAATATAGTTTTCCTGG - Intronic
922999420 1:229994468-229994490 TGGATGGAAGACAGTGGTCCAGG - Intergenic
923213846 1:231831270-231831292 TTCCTGGAGGATAGATTTCCAGG + Intronic
923337792 1:232985237-232985259 TTCATGGGAAACAGCTCTCCAGG - Intronic
924895840 1:248337302-248337324 TTCCTTGAGGACAGATTTCCAGG + Intergenic
1063093030 10:2884891-2884913 GTCATGGAAGACAAGCTTCCAGG + Intergenic
1063523540 10:6762104-6762126 TTCCTGGAAGACAATTTGCTAGG - Intergenic
1063572122 10:7225330-7225352 TGCATGGAAGACATTTCCCCAGG - Intronic
1064486724 10:15800089-15800111 TTCTTGGAAGAAATTTTTCTTGG + Intronic
1066015952 10:31243663-31243685 TTCAAGGAAGAGAATTTCCCAGG - Intergenic
1066534691 10:36378763-36378785 TTTATGGAGGACAGCTTTACTGG + Intergenic
1066642424 10:37569271-37569293 TTTATGGAGGACAGCTTTGCTGG + Intergenic
1068297399 10:55090961-55090983 TTCATGGAGCACAGTTCTGCAGG - Intronic
1069624236 10:69857629-69857651 TTCCTAGAAGACAATTTTTCGGG - Intronic
1069871790 10:71537457-71537479 TTCATATAAGACATTTTTCTTGG + Intronic
1071981993 10:91012787-91012809 TTCATGAAAGACAATTTTCACGG + Intergenic
1072048022 10:91676421-91676443 TTCTTGGAAGACAGTTATGATGG + Intergenic
1072509671 10:96107341-96107363 TTCATGCAAGAAAGAATTCCGGG + Intergenic
1072783642 10:98266562-98266584 TTCATGGAAGGGAGCTTCCCTGG - Intronic
1073205908 10:101769201-101769223 TTCCTGGAAGACAGTTCCCCAGG + Intergenic
1073489112 10:103840877-103840899 ACAATGGAAGACAGTTTCCCTGG + Intronic
1073938097 10:108659155-108659177 TTCATTCAAGCCATTTTTCCTGG - Intergenic
1074192244 10:111148223-111148245 GTCATGGAAAAGAGATTTCCAGG - Intergenic
1074315804 10:112360632-112360654 CAAATGGAAGACAGTATTCCTGG + Intergenic
1074475692 10:113771973-113771995 TTAATGGAACAAAGTTCTCCAGG + Exonic
1076016460 10:127031385-127031407 CTCATAGAAGAGATTTTTCCTGG - Intronic
1076286709 10:129306445-129306467 TCCATGGAAGAAACATTTCCCGG - Intergenic
1077700623 11:4438754-4438776 TGTATGGAAGACAGTGCTCCAGG + Intergenic
1078052268 11:7976521-7976543 TTTTTGAAAAACAGTTTTCCTGG - Intronic
1078172309 11:8937662-8937684 ATCATGGAGGAAACTTTTCCAGG + Exonic
1078327686 11:10393827-10393849 TTTCTGGAAGACAGTTTTCGAGG + Intronic
1078406903 11:11078241-11078263 TTTAAGGAAGACTGTTTTGCAGG - Intergenic
1078719305 11:13869991-13870013 TTCAAACAAGACATTTTTCCTGG - Intergenic
1080246400 11:30183802-30183824 TCAATGGAAGACAGTTATGCAGG + Intergenic
1083377604 11:62238471-62238493 TTCATGGATACAAGTTTTCCTGG - Intergenic
1084761225 11:71272447-71272469 TTCATGGAGGACAGTTGCTCTGG - Intergenic
1085125422 11:73998819-73998841 TTCATGGAAGATATAGTTCCTGG + Intergenic
1085181055 11:74536678-74536700 TTTCTGAAAGACAGTTTTGCTGG + Intronic
1085934554 11:81125870-81125892 TTCCTTGAGGACAGATTTCCAGG - Intergenic
1085988382 11:81811061-81811083 TTCCTTGAGGACAGATTTCCAGG - Intergenic
1089696728 11:120220473-120220495 TTCAAGCAAGCCACTTTTCCTGG + Intronic
1090189190 11:124757450-124757472 TTCCTTGAACACAGTTTTCAGGG + Intronic
1090774040 11:129947499-129947521 TAGATGGAAGTCATTTTTCCAGG - Intronic
1091106744 11:132927470-132927492 TTTTTGAAAGACAGTTTTGCTGG - Intronic
1091271661 11:134317240-134317262 TTTTTGAAAGACAGTTTTGCTGG + Intronic
1091936089 12:4435474-4435496 TTCATGGAAGACTATTTCCATGG - Intronic
1093065915 12:14657762-14657784 TTCATGGAAAACAATTTTTGGGG - Intronic
1095273625 12:40252955-40252977 TTCATCAAAGGAAGTTTTCCAGG + Exonic
1095278602 12:40322360-40322382 CTCATGGAAGAATGGTTTCCTGG + Exonic
1095882591 12:47154045-47154067 TTGATGGGAGACAGTTCTCCAGG + Intronic
1097307632 12:58086962-58086984 TTAATGGAATATAGTATTCCTGG - Intergenic
1097730452 12:63123009-63123031 CGAATGGCAGACAGTTTTCCTGG + Intergenic
1098903227 12:76134269-76134291 CTCATGAAAGACAGGTTTTCAGG + Intergenic
1099255835 12:80310152-80310174 GTCATGGATGACATTTTTCAGGG + Intronic
1100025276 12:90121209-90121231 TTCATGGGAAATATTTTTCCTGG + Intergenic
1100446280 12:94663108-94663130 TTAATGAAAGACAATTCTCCTGG - Intergenic
1100883857 12:99047714-99047736 TTCATGAAACATAGTTTTGCTGG - Intronic
1101345279 12:103880511-103880533 TTCATGGAAGTAAATTTTACAGG + Intergenic
1101556586 12:105815522-105815544 TTCATGGATGTCAATTTTCTTGG - Intergenic
1102142714 12:110628992-110629014 CTCAAGGAACCCAGTTTTCCTGG - Intronic
1103017104 12:117503563-117503585 TGCATGGAAGACAGCTGCCCTGG + Intronic
1103473266 12:121199021-121199043 TCCTTGAAAGACAGTTTTACAGG - Intergenic
1105408861 13:20153022-20153044 CTAATGGAAGACAGTCTTGCCGG - Intronic
1105653644 13:22408827-22408849 TTTATGAAACATAGTTTTCCTGG - Intergenic
1109111681 13:58328169-58328191 TTCTTGGAATACAATTTTTCCGG - Intergenic
1110788809 13:79564578-79564600 TTCAAGGATGTCAGTTTTCAAGG - Intergenic
1110845688 13:80188324-80188346 TTCATTGAGGATAGATTTCCAGG - Intergenic
1110905578 13:80884190-80884212 TTCCTGAAAGAGATTTTTCCTGG - Intergenic
1111236875 13:85420483-85420505 TTCATAGAAGAAAGTTGGCCTGG + Intergenic
1111426013 13:88083266-88083288 TACAAGGAAGGCAGTTTTCATGG + Intergenic
1111924406 13:94447234-94447256 TTCGAGGAAGACAATTTTCACGG + Intronic
1112106569 13:96246947-96246969 TTAATGCAACACAGTCTTCCAGG - Intronic
1112437139 13:99398615-99398637 TTGATGGCGGACAGTTTTGCAGG - Intergenic
1112777059 13:102855688-102855710 TTCATGGAGAAGAGTGTTCCAGG - Intronic
1114590133 14:23856625-23856647 TTCATGGAAGAAAGTTGGACTGG - Intergenic
1115914845 14:38300719-38300741 TTCTTGCAAGACAGCTTTACTGG - Intergenic
1116090400 14:40296626-40296648 TTCATGGGAGAAGGTCTTCCAGG + Intergenic
1116099621 14:40416966-40416988 TTCATGAATGTCAGTTTTCCAGG + Intergenic
1117289721 14:54320777-54320799 TTCATGCAGGACAGCCTTCCTGG - Intergenic
1117895134 14:60476381-60476403 TTCATGAAAAACAGTATTGCTGG - Intronic
1121078414 14:91088383-91088405 ATCATGGAAGACTTCTTTCCAGG - Intronic
1202829899 14_GL000009v2_random:16627-16649 TACATGGAAGACTGTATTCTAGG - Intergenic
1202838454 14_GL000009v2_random:97178-97200 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1202907820 14_GL000194v1_random:87243-87265 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1202885398 14_KI270722v1_random:101896-101918 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1124196817 15:27638980-27639002 TCCGTGGAAAAAAGTTTTCCGGG - Intergenic
1124507949 15:30294941-30294963 ATCACGAAAGACAGTTTTCAAGG + Intergenic
1124735606 15:32243716-32243738 ATCACGAAAGACAGTTTTCAAGG - Intergenic
1125183193 15:36900999-36901021 TTCAGGGATGGCAGCTTTCCAGG - Intronic
1127410345 15:58699189-58699211 TTTCTGAAAGAAAGTTTTCCTGG - Intronic
1127615405 15:60680004-60680026 TTCATGTGAGACAGTCTTCAAGG - Intronic
1127657917 15:61072952-61072974 TTCCTGGAATTCACTTTTCCTGG - Intronic
1127788512 15:62377578-62377600 TTAATGGCCGACTGTTTTCCAGG + Intergenic
1128502686 15:68238611-68238633 TTTTTGAAAGACAGTTTTGCTGG - Intronic
1130792210 15:87167559-87167581 TTCATGGAAGAAAGTTTTGCTGG - Intergenic
1134027719 16:10967164-10967186 TCCTTGGAAGTCAGTTCTCCGGG - Intronic
1136042348 16:27590237-27590259 TTCATGGATGTTGGTTTTCCTGG + Intronic
1137022275 16:35440568-35440590 TTCATGATAGTCAGTTTTCTTGG - Intergenic
1137258292 16:46797074-46797096 TTCATGAAAGATATTTTTGCTGG - Intronic
1138119029 16:54383428-54383450 TTCATGGAAGACATTTTGGAAGG - Intergenic
1138228060 16:55315894-55315916 TTCATTGAATACAGATTTCTGGG + Intergenic
1140384520 16:74522978-74523000 TTCATTAAAGACAGTATTGCTGG - Intronic
1146043751 17:29484422-29484444 TTCACTGCAGAAAGTTTTCCTGG - Intronic
1146176645 17:30669397-30669419 TTCTTGGAAGGCAGATTTCCAGG - Intergenic
1146350106 17:32085512-32085534 TTCTTGGAAGGCAGATTTCCAGG - Intergenic
1147790379 17:43010756-43010778 TTCATTCAACACAGTTTTACCGG + Intronic
1149378305 17:56067851-56067873 TTTCTGGAATACAGTTTTCCTGG + Intergenic
1149884930 17:60330362-60330384 TTCATGGAAGTGAATTATCCTGG + Intronic
1150199915 17:63344268-63344290 TTCATGGAAGAGAATTTTTCTGG - Intronic
1153373634 18:4350757-4350779 TTCATACAATAAAGTTTTCCAGG + Intronic
1154418612 18:14202609-14202631 TACATGGAAGACTGTATTCTAGG - Intergenic
1155874657 18:31070954-31070976 TTAAAAGAAGACAGCTTTCCTGG + Intronic
1156020150 18:32590314-32590336 TTCTTGAAAGATAGTTTTACTGG - Intergenic
1156643456 18:39130382-39130404 TTCTCTGAAGACTGTTTTCCAGG - Intergenic
1157270873 18:46275118-46275140 TTTGTGGAAGAAAGTTTTTCTGG + Intergenic
1157412108 18:47471781-47471803 TTCCTGGATGACAGTGTTGCTGG + Intergenic
1157623848 18:49032024-49032046 CTCATGGCAGGCAGTGTTCCTGG + Intergenic
1157741122 18:50094132-50094154 CCCATGGAAGACTGTTTTACTGG - Intronic
1158049083 18:53193674-53193696 TTCACGGAAGTCAGAGTTCCGGG - Intronic
1158111704 18:53947336-53947358 TTCATGGTATACTGTGTTCCTGG + Intergenic
1158289956 18:55929345-55929367 TTTATGAAAGACAATTTTTCTGG + Intergenic
1160098353 18:75897089-75897111 TTCCTGGAAGAGAATTATCCGGG + Intergenic
1162799683 19:13103605-13103627 TTCATGGGGGGCAGTTATCCTGG + Intergenic
1162982175 19:14247490-14247512 TTCTTGGAAGGCAGATTTCCAGG + Intergenic
1165660688 19:37578169-37578191 TTCATGGAACACAGTATTTCTGG - Intronic
1166247980 19:41544551-41544573 TTCATGGACCACAGTCTTCAAGG - Intergenic
1166278915 19:41777114-41777136 CTCATGAAAGACAGCTTTGCAGG + Intergenic
1202634570 1_KI270706v1_random:33402-33424 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1202642787 1_KI270706v1_random:111158-111180 TACATGGAAGACTGTATTCTAGG + Intergenic
1202651308 1_KI270707v1_random:6640-6662 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1202660801 1_KI270708v1_random:68924-68946 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
925603479 2:5634024-5634046 TTTTTGGAAGACATTTTTGCTGG + Intergenic
928477453 2:31644431-31644453 TTCATGGAAGACAATTTTTTGGG + Intergenic
928959058 2:36904529-36904551 TTTATGGAAGAAAGTTGACCGGG + Intronic
929327688 2:40637101-40637123 TTCATTCAAGACAGTCTTCTGGG + Intergenic
929751080 2:44714379-44714401 TTTATGGAAGACATGTTTTCAGG - Intronic
930786541 2:55276960-55276982 TGTATGGAAGTCAGTTTTCTTGG + Intergenic
931495732 2:62804974-62804996 TTCATGGAAGACAGTTTTCCAGG - Intronic
933930106 2:87141548-87141570 TTGATGAAAGACAGTATTTCGGG - Intergenic
934001439 2:87717333-87717355 TTGATGAAAGACAGTATTTCGGG - Intergenic
934096778 2:88614164-88614186 ATCAGGGAAGACAGTGTTTCAGG - Intronic
934515640 2:94984882-94984904 TTCATGGAGCCCAGTTCTCCTGG + Intergenic
934952754 2:98589769-98589791 TGCAGGGAAGGCAGTTTTACAGG + Exonic
936093816 2:109517043-109517065 TTCCTGGAAGGCAGTTTGCAGGG - Intergenic
936362835 2:111821855-111821877 TTGATGAAAGACAGTATTTCGGG + Intronic
936686099 2:114828561-114828583 TTCATGGAAGGCGCTATTCCAGG - Intronic
937608573 2:123832323-123832345 TTTTTGCAGGACAGTTTTCCTGG + Intergenic
939306547 2:140418849-140418871 TTCATGGAAGACAATTTTCATGG - Intronic
939384592 2:141479249-141479271 TTGTTGGCTGACAGTTTTCCAGG - Intronic
940130312 2:150373838-150373860 GTCATGGAAGACCGGTTTCCTGG - Intergenic
942577907 2:177384436-177384458 TATAAGGAAGACAGTCTTCCTGG - Intronic
943313912 2:186361789-186361811 TTCTTGGAGGCCACTTTTCCTGG - Intergenic
944658468 2:201900077-201900099 TACATGCAAGACAGTGTTCAAGG - Intergenic
945672870 2:212822961-212822983 TGCATGGAAGACAGCTTCCAGGG + Intergenic
948219903 2:236261334-236261356 TTCATTGAAGGCAGTTGCCCAGG - Intronic
1170163091 20:13335917-13335939 CTCATGCAAGAAAATTTTCCCGG + Intergenic
1170687435 20:18582078-18582100 TGCAGGGGAGACAGTTCTCCAGG - Intronic
1171889908 20:30701338-30701360 TACATGGAAGACTGTATTCTAGG + Intergenic
1173164306 20:40675823-40675845 TTCCAGGAGGACATTTTTCCTGG + Intergenic
1174054901 20:47791732-47791754 TCCATGCAAGACAGTGTTCTGGG - Intergenic
1174403660 20:50290079-50290101 AATATGGAAGACTGTTTTCCAGG + Intergenic
1175792411 20:61748435-61748457 TTCCTGAAAGACAGTTTTACTGG - Intronic
1176600829 21:8792996-8793018 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1176609087 21:8861467-8861489 TACATGGAAGACTGTATTCTAGG - Intergenic
1176627178 21:9101928-9101950 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1176646791 21:9359174-9359196 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1176854686 21:13956681-13956703 TACATGGAAGACTGTATTCTAGG + Intergenic
1177185193 21:17785913-17785935 TTCATGGAGTACAGTTTTAATGG - Intergenic
1177440217 21:21113109-21113131 TTCATGGAATATAGCTTTCGGGG + Intronic
1180328288 22:11452518-11452540 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1180343116 22:11684533-11684555 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1180359180 22:11871298-11871320 TACATGGAAGACTGTATTCTAGG - Intergenic
1180366137 22:11939827-11939849 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1180417526 22:12781540-12781562 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1180670129 22:17546713-17546735 TTCTAGGAGGACAGTTGTCCAGG - Intronic
1181678287 22:24472267-24472289 TTCAGGGAAGTCAGTGTTCTGGG + Intergenic
1181901270 22:26158148-26158170 TGCAGGGAAGACGGTTGTCCTGG + Intergenic
1182307404 22:29380168-29380190 TTGAGGGAAGACAGGTTTTCAGG - Intronic
949468995 3:4374712-4374734 TCCATGGAAGTCTGGTTTCCTGG + Intronic
949571832 3:5301062-5301084 TCCATGGTAGACAATCTTCCTGG - Intergenic
949756472 3:7416903-7416925 ATGATTGAAGACAGTTTTCCTGG + Intronic
949938786 3:9137525-9137547 TACATAGAAGAAAATTTTCCTGG - Intronic
950724101 3:14905135-14905157 TTTGTGGAAGATATTTTTCCTGG + Intronic
951499863 3:23373125-23373147 TTCAGGGGAGACAGTTTCCATGG - Intronic
952557344 3:34547826-34547848 TTCATGAAGGACAGTTTTGTTGG - Intergenic
952656964 3:35798170-35798192 TCCATGGAAGACTGTTTCCTTGG + Intergenic
952792967 3:37214911-37214933 TTGATGGAAGACACTTGGCCTGG - Intergenic
953127390 3:40104650-40104672 GTCATGTAACACAGTTTTCCTGG + Intronic
953243507 3:41170103-41170125 TTAATAGATGACTGTTTTCCTGG - Intergenic
955401949 3:58598446-58598468 TTCCAGGAAGGCAGTTTTCTGGG - Intronic
956366294 3:68506706-68506728 TTCATAGAAGACATTTTTCCTGG + Intronic
957093496 3:75755166-75755188 TTCTTGCAAGACAGGTCTCCTGG - Intronic
958602158 3:96309552-96309574 TTCTTTGAAGACATTTTTTCAGG - Intergenic
959423524 3:106156791-106156813 CTCATAGAAGGCTGTTTTCCAGG + Intergenic
960598245 3:119427882-119427904 TTTATGAAAGACAGCTTTGCTGG + Intergenic
960823940 3:121762679-121762701 TTAATGGAAAAGAATTTTCCAGG - Intergenic
961181618 3:124882466-124882488 ATCTTGGAGGACAGTATTCCAGG + Intronic
961460917 3:127049855-127049877 TTCTTGAAAGATAGTTTTGCTGG + Intergenic
962244236 3:133778267-133778289 GTCAGGGAGGACAGTCTTCCTGG + Intronic
962293005 3:134153273-134153295 TTAGTGGAAGATTGTTTTCCAGG - Intronic
963660496 3:148121219-148121241 TTCTTTGAATACAGATTTCCTGG - Intergenic
964272719 3:154975612-154975634 TTCATAGAAACCAGTTTTCATGG - Intergenic
964503678 3:157375596-157375618 TCCAAGGAAGACAGATTTCCTGG + Intronic
964691656 3:159456452-159456474 TTCATGGAGGAAAATTTTCTGGG - Intronic
965145746 3:164900266-164900288 TACTTGAAAGGCAGTTTTCCTGG - Intergenic
965510094 3:169558633-169558655 TTCATGTAAGTCAGTTTTCTGGG - Intronic
966636374 3:182138658-182138680 TTCAAGGAAAACAAGTTTCCTGG + Intergenic
967433178 3:189412543-189412565 CTTGTGGGAGACAGTTTTCCTGG - Intergenic
967513251 3:190337140-190337162 GTCCTGGAAGACAGTATTCATGG + Intronic
1202740096 3_GL000221v1_random:45866-45888 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
968673672 4:1865547-1865569 TTCCTGGAAGAAAGTTATCTGGG - Intergenic
968972754 4:3804422-3804444 TTCCTGGCTGACAGTTCTCCTGG + Intergenic
970296085 4:14632036-14632058 TTCCTGGAACTCAGTTTTCCTGG + Intergenic
970462841 4:16292742-16292764 TTCTTGGAAGTCACTTTTACTGG - Intergenic
971723855 4:30282947-30282969 TTTAGGGAATACAGTGTTCCTGG + Intergenic
973364268 4:49195746-49195768 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
973396813 4:49600992-49601014 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
973708523 4:53603100-53603122 ATCAGGGAAAGCAGTTTTCCAGG + Intronic
973724174 4:53755900-53755922 TTTCTGAAAGACAGTTTTGCTGG - Intronic
974713798 4:65639335-65639357 TTTTTGAAAGGCAGTTTTCCTGG + Intronic
974724532 4:65781772-65781794 TTCTTGTAAGACAGGTTTACTGG - Intergenic
975643576 4:76524672-76524694 TTCATGGAAACCTGTTTTCTGGG - Intronic
975884751 4:78951656-78951678 TTTATGTAACAAAGTTTTCCTGG + Intergenic
975885158 4:78956600-78956622 TACATGCAGGACAGTTTTCCAGG + Intergenic
975932139 4:79537898-79537920 TTTGTGAAAAACAGTTTTCCAGG - Intergenic
976060633 4:81124166-81124188 TTTCTGAAAGACAGTTTCCCTGG + Intronic
976821324 4:89210319-89210341 TTAATCTAAAACAGTTTTCCAGG + Intergenic
977668618 4:99670231-99670253 TTCAGAAAAGACAGGTTTCCAGG + Intergenic
978258753 4:106724831-106724853 TTCATGTAAGACAGGTTTAATGG - Intergenic
978758526 4:112330102-112330124 TTCATTCAACACAGGTTTCCAGG - Intronic
979528134 4:121739156-121739178 TTCATGTAAGACAGGCATCCTGG + Intergenic
979601778 4:122593317-122593339 TTAATTCAAGACAGTTCTCCTGG + Intergenic
979852488 4:125591149-125591171 TTTGTGGAAGACAATTTTTCAGG + Intergenic
980402365 4:132308025-132308047 ATCATAGAAGACAGATATCCTGG + Intergenic
980820045 4:138003288-138003310 ATCTTGGAAAAGAGTTTTCCAGG + Intergenic
981784529 4:148462380-148462402 TTCATTGAAGACAATTTTTCCGG - Intergenic
983298353 4:165894470-165894492 TTCATGAAAGATATTTTTGCTGG - Intronic
984873969 4:184350940-184350962 CTCATGGAAGACACTTCTGCTGG - Intergenic
1202761577 4_GL000008v2_random:116778-116800 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1202770158 4_GL000008v2_random:197057-197079 TACATGGAAGACTGTATTCTAGG + Intergenic
986004263 5:3654862-3654884 TTCAGGCAATATAGTTTTCCAGG + Intergenic
986911230 5:12559931-12559953 TTTATAGAAGTCAGCTTTCCAGG - Intergenic
987357712 5:17079817-17079839 TCCATGGAAGCCAGTTGACCTGG - Intronic
988908037 5:35810185-35810207 CTTATGGATGACAGGTTTCCTGG - Intronic
989408989 5:41095733-41095755 CTCATGTAGGACAGTTCTCCAGG + Intergenic
989640946 5:43582564-43582586 TTCATGCCAGACACTGTTCCAGG + Intergenic
990314519 5:54571529-54571551 TTCGTGGAGCACAGTTTTCTTGG - Intergenic
991109851 5:62887326-62887348 TTTGTGGAAGAAAGTTTTCATGG - Intergenic
993174903 5:84471239-84471261 TTCTTAGAAGACAGTTTCCTTGG + Intergenic
993177644 5:84508887-84508909 TGTCTGGAAGACAGCTTTCCTGG + Intergenic
993980470 5:94538520-94538542 TTCATGGCATACAGCTTTCCTGG - Intronic
995331538 5:110952853-110952875 TTCATGGAAGCCATTTTCCCTGG - Intergenic
997190409 5:131929047-131929069 TTTTTGAAAGACAGTTTTCCTGG + Intronic
998432778 5:142080857-142080879 TTCATGGAAGACAATTTCCGTGG - Intergenic
999382720 5:151132661-151132683 TTCATGGTGGACAGTCGTCCTGG - Intronic
1000866351 5:166519274-166519296 TTCATGGATGACTTTTTTTCAGG + Intergenic
1002799400 6:506967-506989 TACATGCAGGACACTTTTCCAGG + Intronic
1004180067 6:13373243-13373265 GGCATGGAAGAAAGTTTTGCTGG + Intronic
1004344637 6:14837276-14837298 CTGGTGGAAAACAGTTTTCCTGG + Intergenic
1004537476 6:16516551-16516573 TGCATGGAGGACAGTTGTCCTGG + Intronic
1004590305 6:17044636-17044658 TGCTTGGAAGTCAGTTTTGCTGG + Intergenic
1007278436 6:40692631-40692653 TTCATAGAGGACATGTTTCCTGG - Intergenic
1007292713 6:40799385-40799407 TTCCTGAAAGACAGAATTCCTGG + Intergenic
1007517875 6:42427915-42427937 TTCATGGAAGAAACTGTTCAAGG - Intronic
1007661173 6:43487452-43487474 TTCCTGGAAAAGAGCTTTCCAGG + Intronic
1008970616 6:57363497-57363519 TTATTGGAAGACATTTTTGCTGG + Intronic
1009159580 6:60265306-60265328 TTATTGGAAGACATTTTTGCTGG + Intergenic
1009384977 6:63077016-63077038 TTCTTGGAAGACCATTTTTCAGG - Intergenic
1010859860 6:80897461-80897483 TTAATGAAAAACCGTTTTCCTGG + Intergenic
1010931026 6:81803456-81803478 TTAATGAAAGACGCTTTTCCAGG - Intergenic
1011157835 6:84353444-84353466 CTCATGGAGGTCAGTTGTCCTGG - Intergenic
1011605132 6:89096056-89096078 TTCCCAGAAGACAATTTTCCAGG + Exonic
1011830515 6:91365695-91365717 TTCATGCAATTCAGGTTTCCAGG + Intergenic
1013750083 6:113395456-113395478 TTCCAGGAAGCCACTTTTCCAGG - Intergenic
1014187542 6:118453096-118453118 TGTATGGAAGACTGTTCTCCTGG - Intergenic
1014604464 6:123454864-123454886 TTCCTGGAAGACAATTTTCCCGG - Intronic
1014986168 6:128013136-128013158 TTCTTGGAACACCCTTTTCCTGG + Intronic
1015572409 6:134635049-134635071 TTCATAGAAAACAAATTTCCTGG + Intergenic
1015840787 6:137474780-137474802 TTGATGGAAGGCATTTTGCCAGG - Intergenic
1016769475 6:147832754-147832776 GTGATAGAAGACAGTATTCCTGG - Intergenic
1020969418 7:14915806-14915828 TTCCTGCAAGACAGTATTACAGG - Intronic
1021213123 7:17881015-17881037 TTCATGGCAGAATATTTTCCTGG + Intronic
1021746180 7:23743389-23743411 TTCATGAAAGACAACTTTGCTGG + Intronic
1023051952 7:36260295-36260317 TTTTTGAAAGATAGTTTTCCTGG + Intronic
1024291355 7:47806911-47806933 TTCAGGGCAGGCAGCTTTCCAGG + Intronic
1024764101 7:52636016-52636038 TTCATGGAGGACATTTTTTATGG + Intergenic
1026121067 7:67538242-67538264 TTAATAGAAGACAATTTTCCTGG - Intergenic
1026153576 7:67808709-67808731 TTCGTGGAAACCAGTTTCCCAGG - Intergenic
1026235607 7:68524329-68524351 TTCATGGAGTCCAGATTTCCTGG - Intergenic
1026530040 7:71189380-71189402 TTCTTGGAAGACAGCTTTTCCGG + Intronic
1027967592 7:85032842-85032864 TTGATGAAAGAGAGTTTTCTTGG + Intronic
1029990330 7:104957460-104957482 CTCACGGAAGACATTTTCCCAGG - Intergenic
1030003794 7:105095358-105095380 TTCATGGAATGTATTTTTCCAGG + Intronic
1030189420 7:106795564-106795586 TTCATGGAAGAGAGTTTGAACGG - Intergenic
1030914536 7:115296274-115296296 GTAATGGAAGACATTTGTCCTGG - Intergenic
1031354856 7:120778205-120778227 TTCTTTGAGGACAGATTTCCAGG + Intergenic
1033034937 7:137865963-137865985 TTCATAAAAGATAGTTTTGCTGG - Intergenic
1033286427 7:140044750-140044772 TTCTTGAAAGATAGTTTTACTGG - Intronic
1033405575 7:141069579-141069601 TTCCTGGAACACAGTTCACCTGG - Intergenic
1033886814 7:145959637-145959659 TTCCAGGAAAACAGTTTTTCTGG - Intergenic
1036239226 8:7068458-7068480 TCCAAGGAAGACAGAGTTCCTGG - Intergenic
1036574094 8:10009063-10009085 TTCTTGAAAGATAGTTTTGCTGG + Intergenic
1037089455 8:14896216-14896238 TTCTTGAAAGTCAGCTTTCCCGG - Intronic
1038554511 8:28497882-28497904 ATCTTGGAAGACTGTCTTCCCGG - Intronic
1038623091 8:29163466-29163488 TTCATTGAATTCAGTTTGCCCGG + Intronic
1039219138 8:35309044-35309066 TTTATGGAAAACAGTTTTTCTGG - Intronic
1040382151 8:46883371-46883393 TTAATGGAACACAGTCTTCAAGG - Intergenic
1040676162 8:49753098-49753120 TTCAAGGATAAGAGTTTTCCTGG - Intergenic
1041465777 8:58156235-58156257 CTCCTGGCAGACAGTTTTCCAGG + Intronic
1042994193 8:74676111-74676133 TTGTTGGAACACATTTTTCCAGG - Intronic
1043593596 8:81858582-81858604 TTCTTGTGAGGCAGTTTTCCTGG - Intergenic
1043670977 8:82883688-82883710 TTCTTGAAAGATAGTTTTGCTGG - Intergenic
1044453218 8:92362480-92362502 TTAATAAAAGACAATTTTCCAGG - Intergenic
1046726797 8:117684456-117684478 TTCATAGAAGAAAGTTTTGGAGG + Intergenic
1047575377 8:126148659-126148681 TTTTTGAAAGATAGTTTTCCTGG + Intergenic
1047807999 8:128379255-128379277 GACCTGGAGGACAGTTTTCCAGG + Intergenic
1048391826 8:133974181-133974203 TTCCAGGAAGACAATTTTCGAGG - Intergenic
1050057117 9:1667313-1667335 TGCGTGAAAGACAATTTTCCAGG - Intergenic
1050871135 9:10571691-10571713 TTCATGGAAGACAGTTTTTCCGG + Intronic
1050948427 9:11556960-11556982 TTCTTGTAAGACAGTTATCATGG + Intergenic
1051310040 9:15760217-15760239 TACATGCACCACAGTTTTCCTGG - Intronic
1053399361 9:37804054-37804076 CTCATGGAGGACAGTTTGACAGG - Intronic
1053549896 9:39066600-39066622 TTCTTGAAAGACGGTTTTGCTGG + Intergenic
1053658517 9:40245927-40245949 TACATGGAAGACTGTATTCTAGG - Intronic
1053814008 9:41886693-41886715 TTCTTGAAAGACGGTTTTGCTGG + Intergenic
1053908889 9:42875195-42875217 TACATGGAAGACTGTATTCTAGG - Intergenic
1054359192 9:64096874-64096896 TACATGGAAGACTGTATTCTAGG - Intergenic
1054370636 9:64392201-64392223 TACATGGAAGACTGTATTCTAGG - Intronic
1054526081 9:66130295-66130317 TACATGGAAGACTGTATTCTAGG + Intronic
1054616588 9:67300747-67300769 TTCTTGAAAGACGGTTTTGCTGG - Intergenic
1054678267 9:67881950-67881972 TACATGGAAGACTGTATTCTAGG - Intronic
1054749817 9:68893952-68893974 ATTTTGGAAGACAGTTTTGCAGG + Intronic
1055217121 9:73878219-73878241 GTTATGGAAGACAGTATACCTGG - Intergenic
1055710214 9:79052330-79052352 TTCATGGGAGACATTATCCCAGG - Intergenic
1055747386 9:79464654-79464676 TTCTTGGAAACCAGGTTTCCAGG + Intergenic
1055919626 9:81445412-81445434 TTTTTGAAAGACAGTTTTTCTGG + Intergenic
1056372485 9:85971161-85971183 ATCATTAAAGACATTTTTCCTGG - Intronic
1057818740 9:98315260-98315282 TTCATGGAAGTCAGTGGTCCTGG + Intronic
1060287665 9:122268357-122268379 TCCATTTAAGACAGGTTTCCTGG - Intronic
1060674198 9:125497432-125497454 TGAATAAAAGACAGTTTTCCAGG + Intronic
1203695059 Un_GL000214v1:90734-90756 TACATGGAAGACTGTCTTCTAGG + Intergenic
1203750021 Un_GL000218v1:69615-69637 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1203483951 Un_GL000224v1:34646-34668 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1203704487 Un_KI270742v1:26699-26721 TACATGGAAGACTGTATTCTAGG - Intergenic
1203708736 Un_KI270742v1:75823-75845 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1203542347 Un_KI270743v1:101659-101681 TTCTTGCAAGACAGGTCTCCTGG + Intergenic
1203559514 Un_KI270744v1:39113-39135 TACATGGAAGACTGTATTCTAGG + Intergenic
1203641214 Un_KI270751v1:13329-13351 TACATGGAAGACTGTCTTCTAGG - Intergenic
1203652157 Un_KI270751v1:135797-135819 TTCATGCAAGTCAGTTCTGCTGG + Intergenic
1187316432 X:18199720-18199742 TTCAAGGAACATAGTTTTGCTGG - Intronic
1188893428 X:35637239-35637261 TTCATTGCAGACAGGTTTCCGGG - Intergenic
1189709100 X:43790948-43790970 TTCAGAGAAGACTGTATTCCTGG + Intronic
1189828435 X:44945057-44945079 TTTATGGAAGATATTTTTGCTGG + Intronic
1190001460 X:46692116-46692138 TGCAAGGAAGACAGGTTTCATGG + Intronic
1190493218 X:51003247-51003269 TTCCTGGAATTCAGTCTTCCAGG - Intergenic
1190874523 X:54450148-54450170 TTGCTGAAAGACAGTTGTCCAGG + Intronic
1191750580 X:64538024-64538046 TTCTTTAAAGACAGTTTACCAGG - Intergenic
1192194364 X:69018616-69018638 TTCATGGAACAGAGCTTTCTTGG - Intergenic
1192198124 X:69045975-69045997 GTCATGGGATACAGCTTTCCTGG + Intergenic
1192550041 X:72046245-72046267 TTCTGGGAAGACAGGTTGCCTGG - Intergenic
1193171897 X:78346832-78346854 GACCTGGAGGACAGTTTTCCGGG + Intergenic
1194288458 X:92039295-92039317 TTCAGGGCAGCAAGTTTTCCAGG + Intronic
1194785510 X:98079101-98079123 TGTATGGAAGACACTTTTACTGG + Intergenic
1196618312 X:117793017-117793039 TTCAGGGAAAACCGTATTCCAGG + Intergenic
1197907994 X:131447081-131447103 TTCATCGGAAACAGTTTTCCTGG + Intergenic
1198123319 X:133617160-133617182 TTCCCAGAAGACAATTTTCCAGG + Intronic
1200605979 Y:5263860-5263882 TTCAGGGCAGCAAGTTTTCCAGG + Intronic
1201163672 Y:11187255-11187277 TTCTTGCAAGACAGGTCTCCTGG - Intergenic
1201652629 Y:16307221-16307243 TCCAGGGAAGACAGTTCTGCAGG - Intergenic