ID: 931495739

View in Genome Browser
Species Human (GRCh38)
Location 2:62805011-62805033
Sequence ACAGCTGTCCCCAATCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1574
Summary {0: 1, 1: 3, 2: 31, 3: 299, 4: 1240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931495739_931495741 -7 Left 931495739 2:62805011-62805033 CCAGAAAGATTGGGGACAGCTGT 0: 1
1: 3
2: 31
3: 299
4: 1240
Right 931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931495739 Original CRISPR ACAGCTGTCCCCAATCTTTC TGG (reversed) Intronic
900789090 1:4667401-4667423 ACAGCAGTCCCCAACCTTTTTGG + Intronic
900915777 1:5637416-5637438 GCAGCAGTCCTCAATCTTTTGGG + Intergenic
901467643 1:9432936-9432958 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
901714219 1:11140245-11140267 GCAGCAGTCCCCAACCTTTTTGG + Intronic
901719741 1:11187254-11187276 TCAGTGGTCCCCAATCTTTTTGG + Intronic
901833529 1:11908775-11908797 CCAGCGGTCCCCAACCTTTCTGG - Intergenic
901895273 1:12306698-12306720 GCAGCAGTCCCCAACCTTTTTGG + Intronic
902183348 1:14706382-14706404 ACAGCGGTCCCCAACGTTTTTGG - Intronic
902221364 1:14967921-14967943 CCAGCAGTCCCCAACCTTTTAGG + Intronic
902536891 1:17124395-17124417 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
902938199 1:19779994-19780016 GCAGCAGTCCCCAACCTTTTTGG + Intronic
903060844 1:20667581-20667603 GCAACTGTCCCCAGTCTTTTTGG - Intronic
904148235 1:28413111-28413133 CCAGCGGTCCCCAACCTTTTTGG - Intronic
904721935 1:32516731-32516753 GCAGCGGTCCCCAACCTTTTTGG - Intronic
904737765 1:32647954-32647976 CCAGCGGTCCCCAACCTTTTTGG - Intronic
905030328 1:34878724-34878746 ACAGCCGTCCCCAACCTTTTTGG + Intronic
905378168 1:37539275-37539297 ACAGTGGTCCCCAACCTTTTTGG - Intronic
905638133 1:39569563-39569585 AAAGCTTTTCCCAATCTTTGTGG + Intronic
905753726 1:40489126-40489148 CCAGCTGCCCCCACTCTTCCTGG - Exonic
905765439 1:40596284-40596306 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
905954737 1:41982912-41982934 GCAGCGGTCCCCAATCTTTTTGG + Intronic
906090773 1:43177590-43177612 GCAGTGGTCCCCAACCTTTCTGG + Intronic
906435704 1:45794589-45794611 ACAGCAGTCCCCAAACTTTTTGG - Intronic
906440228 1:45836827-45836849 ACAGCATTCCCCAACCTTTTTGG + Intronic
906453134 1:45969863-45969885 ACAGCATTCCCCAACCTTTTTGG - Intronic
906466168 1:46081633-46081655 GCAGCAGTCCCCAACCTTTCTGG - Intronic
906664754 1:47612581-47612603 ACAGTGGTCCCCAATCTTTTTGG - Intergenic
906784417 1:48602105-48602127 ATAGGTGTCCCCAAGCATTCAGG - Intronic
906819452 1:48913837-48913859 CCAGCAGTCCCCAACCTCTCTGG - Intronic
906883089 1:49613881-49613903 ACAGCAATCCCCAAGCTTTTTGG - Intronic
907127362 1:52062764-52062786 GCAGCAGTCCGCAATCTTTTTGG + Intronic
907481156 1:54746377-54746399 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
907495792 1:54843390-54843412 ACAGCAGTCCCCAGCCTTTTTGG - Intergenic
907614223 1:55907381-55907403 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
907819056 1:57949104-57949126 CCAGCGGTCCCCAACCTTTTTGG + Intronic
907926112 1:58956592-58956614 ACAGAGGTCCCCAACCTTTTTGG - Intergenic
907945171 1:59129306-59129328 ACACCTTTCCCCACTCTTCCTGG + Intergenic
908102410 1:60805229-60805251 TCAGCAGTCCCCAACCTTTATGG + Intergenic
908287813 1:62628008-62628030 GCAGCGGTCCCCAACCTTTCTGG + Intronic
908309090 1:62857625-62857647 CCAGCAGTCCCCAACCTTTCAGG - Intronic
908588733 1:65604930-65604952 ACAGCAGTCCCCAACCTTTTTGG - Intronic
909005413 1:70270442-70270464 ACAGCAGCCCCCAACCTTTTTGG + Intronic
909019969 1:70419955-70419977 ACAGCAGTTCCCAACCTTTTTGG + Intronic
909278407 1:73718456-73718478 GCAGCGATCCCCAATCTTTTTGG - Intergenic
909617353 1:77626201-77626223 GCAGCAGTCCCCAACCTTTTTGG + Intronic
909701560 1:78530026-78530048 CCAGCAGTCCCCAACCTTTTTGG - Intronic
909941605 1:81617395-81617417 CTAGCAGTCCCCAATCTTTTTGG - Intronic
910315246 1:85875101-85875123 ACAGCAGTCCCCAACCTATTTGG - Intronic
910324523 1:85990286-85990308 ACAGCAGTCTCCAACCTTTTTGG + Intronic
910868903 1:91813754-91813776 GCAGCAGTCCCCAACCTTTTTGG + Intronic
911005117 1:93212719-93212741 ACAGTGGTCCCCAACCTTTTTGG + Intronic
911147021 1:94562311-94562333 ACAGCAGTTCCCAACCTTTTTGG + Intergenic
911423584 1:97678027-97678049 ACAGTGGTCCCCAACCTTTTTGG + Intronic
911588983 1:99724968-99724990 CCAGCAGTCCCCAACCTTTTTGG + Intronic
911695129 1:100882150-100882172 GCAGTGGTCCCCAAGCTTTCTGG - Intronic
911702230 1:100967207-100967229 ACAGCAGTCCCCAACCATTTTGG + Intronic
911792377 1:102033906-102033928 ACAGTGGTCCCCAAACTTTTTGG - Intergenic
912339342 1:108895853-108895875 ACAACGGTCTCCAATCTTTTTGG - Intronic
912904476 1:113689539-113689561 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
912909780 1:113745993-113746015 CCAGCAGTCCCCAACCTTTTTGG - Intronic
912913216 1:113784430-113784452 CCAGTGGTCCCCAATCTTTTTGG + Intronic
913175973 1:116273581-116273603 GCAGCTGTCACTAATCCTTCAGG - Intergenic
913239993 1:116821596-116821618 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
913302721 1:117389247-117389269 GCAGCAGTCCCCAATCTTTTTGG + Intronic
913570985 1:120119657-120119679 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
914291793 1:146280633-146280655 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
914319914 1:146549163-146549185 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
914335845 1:146714439-146714461 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
914552837 1:148731416-148731438 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
914767402 1:150650744-150650766 GCAGCTGTCCCCAACTTTTCTGG - Intronic
915598919 1:156910297-156910319 ACAGGTGCCCCCATTCTTGCAGG - Exonic
915708245 1:157868146-157868168 ACAGCAGTCCCCAACCTTTTTGG + Intronic
916653394 1:166850864-166850886 CCAGCAGTCCCCAACTTTTCTGG - Exonic
917058760 1:171013524-171013546 GCAGCAGTCCCCAAACTTTTTGG - Intronic
917098701 1:171425162-171425184 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
917348213 1:174050481-174050503 GCTGCAGTCCCCAACCTTTCTGG - Intergenic
917363971 1:174208940-174208962 ACAGCAGTCCCCAACCTTTTTGG + Intronic
917562632 1:176175340-176175362 TCAGCAGTCCCCAACCTTTTTGG + Intronic
917748817 1:178036507-178036529 ACAGCGGTCCGCAACCTTTTTGG - Intergenic
917995932 1:180438278-180438300 ACAGCAGTCCCCACCCTTTTTGG - Intronic
918225223 1:182474998-182475020 ACAGCGGTCCCCAACCTTTTTGG - Intronic
918287606 1:183073068-183073090 CCAGCAGTCCCCAACCTTTTTGG - Intronic
918445653 1:184614505-184614527 CCAGCAGTCCCCAACCTTTCTGG + Intronic
918573299 1:186024828-186024850 ACAGCAGCCCCCAACCTTTTTGG + Intronic
918645886 1:186903922-186903944 ACAGCAGTCCCCAACATTTTTGG - Intronic
918833337 1:189427969-189427991 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
918979112 1:191532441-191532463 GCAGTGGTCCCCAACCTTTCTGG + Intergenic
919105812 1:193149201-193149223 ACAGCAGTCCCCAACCTTTTTGG + Intronic
919148904 1:193669752-193669774 ACAGCAGTCCCTAACCTTTTTGG - Intergenic
919356336 1:196527162-196527184 ACAGTGGTCCCCAACCTTTTTGG - Intronic
919615289 1:199799551-199799573 ACAGCAGTACCCAATGTTTTTGG - Intergenic
919801484 1:201357235-201357257 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
920318754 1:205100785-205100807 TCAGCTGTCCCCAACATTTTTGG + Intronic
921402283 1:214738658-214738680 ACAGCAGTCCTCAAACTTTTTGG + Intergenic
922084964 1:222337869-222337891 GCAGCTGTCCCCAACCTTTTTGG + Intergenic
922329860 1:224564939-224564961 ACAGCTGCCCACCATCTGTCTGG - Intronic
922607840 1:226902046-226902068 GCAGTGGTCCCCAATCTTTAGGG + Intronic
922671763 1:227513866-227513888 GCAGCAGTCCCCAGTCTTTTTGG + Intergenic
923027698 1:230219108-230219130 CCAGCGGTCCCCAACCTTTTTGG - Intronic
923377319 1:233377607-233377629 TCAGCAGTCCCCAACCTTTATGG + Intronic
923504656 1:234594997-234595019 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
923618362 1:235556616-235556638 ACAGCCGTCCCCAACGTTTTCGG + Intronic
923826076 1:237502415-237502437 GCAGCAGTCCCCAACCTTTTTGG + Intronic
923890753 1:238212685-238212707 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
924072765 1:240298794-240298816 GCAGCGGTCCCCAACCTTTTTGG - Intronic
924244470 1:242070355-242070377 GCAGCAGTCCCCAATCTTCTTGG + Intergenic
924406996 1:243758538-243758560 GCAGCAGTCCCCAACCTTTCTGG + Intronic
924408429 1:243777080-243777102 ACAGCAGTCCTCAACCTTTTTGG + Intronic
924505676 1:244681423-244681445 ATAGCAGTCCCCAACCTTTTTGG + Intronic
924666686 1:246080525-246080547 ACAGTGGTTCCCAACCTTTCTGG - Intronic
924698003 1:246419870-246419892 ACAGTGGTCCCCAACCTTTTTGG - Intronic
924821737 1:247498688-247498710 GCAGCAGTCCCCAGTCTTTTTGG + Intergenic
924893402 1:248308865-248308887 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
924895377 1:248332893-248332915 CCAGCAGTCCCCAACCTTTTAGG - Intergenic
1062827269 10:581872-581894 CCAGCTGTCCCCAGCCTTTTTGG + Intronic
1063460891 10:6214416-6214438 ACAGCAGTCCCCATCCTTTTTGG - Intronic
1063536284 10:6886726-6886748 ACAGCAATCCCCAACCTTTCTGG - Intergenic
1063588861 10:7377303-7377325 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1063604657 10:7512157-7512179 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1063842368 10:10087477-10087499 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1063927483 10:10994755-10994777 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1063956661 10:11273520-11273542 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1064310380 10:14207238-14207260 TCAGTGGTCCCCAATCTTTTTGG + Intronic
1064368143 10:14726759-14726781 CCAGAGGTCCCCAATCTTTTTGG + Intronic
1064449912 10:15432363-15432385 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1064750388 10:18522398-18522420 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1064774433 10:18760128-18760150 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1064942141 10:20746817-20746839 CCAGCTGTCCCCAGCCTTTTTGG - Intergenic
1064988225 10:21232296-21232318 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1065073228 10:22049222-22049244 ACAGCAGTCCCAAACCTTTTTGG - Intergenic
1065138026 10:22691924-22691946 CTAGCAGTCCCCAACCTTTCAGG + Intronic
1065453037 10:25878607-25878629 ACAGCAGTCCTCAACCTTTTTGG - Intergenic
1065666182 10:28063822-28063844 GCAGCGGTCCCCAAACTTTTTGG - Intronic
1065755574 10:28927549-28927571 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1065795025 10:29298786-29298808 TCAGCCGTCCCCAACCTTTTTGG + Intronic
1065849121 10:29772222-29772244 ACAGCAGTTCCCAATCTTTTTGG + Intergenic
1065866940 10:29922427-29922449 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1065960227 10:30727953-30727975 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1066092155 10:32033572-32033594 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1066199454 10:33131229-33131251 TCAGCAGTCCCCAAACTTTTGGG + Intergenic
1066242067 10:33547720-33547742 GCAGCTGTCCCCAATGTTTTTGG + Intergenic
1066255699 10:33676623-33676645 GCAGCTGTCCCCAACATTTTTGG - Intergenic
1066541613 10:36452633-36452655 GCAGCAGTCCCCAAACTTTTTGG - Intergenic
1066542579 10:36463998-36464020 ACATCAGTCCCCAACCTTTTTGG - Intergenic
1066589991 10:36984344-36984366 TCAGCGGTCCCCAAACTTTTTGG + Intergenic
1066640419 10:37549730-37549752 ATAGCAGTCCCCAACCTTTTTGG + Intergenic
1067160864 10:43824135-43824157 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1067374461 10:45714564-45714586 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1067882276 10:50056206-50056228 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1068017868 10:51541055-51541077 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1068070594 10:52189681-52189703 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1068209097 10:53897071-53897093 CCAGCGGTCCCCAACCTTTTTGG - Intronic
1068264087 10:54625070-54625092 ACAGTGGTCCCCAGTCTTTTTGG - Intronic
1068334894 10:55621752-55621774 ACAGCAGTCCTCAAACTTTTTGG - Intronic
1068383999 10:56299353-56299375 TCAGTGGTCCCCAATCTTTTTGG - Intergenic
1068544241 10:58328050-58328072 ACAGCAGTCTCCAACCTTTTCGG + Intergenic
1068585447 10:58792905-58792927 TCAGGGGTCCCCAACCTTTCTGG - Intronic
1068603297 10:58978399-58978421 GCAGCAGTCCCCAACCTTTCTGG + Intergenic
1068660299 10:59616339-59616361 GCAGCAGTCCCCAACCTTTCTGG - Intergenic
1068819700 10:61360060-61360082 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1069357257 10:67601213-67601235 ACAGTTGTCCCCAACCATTTTGG + Intronic
1069575263 10:69522809-69522831 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1069620409 10:69834056-69834078 GCAGCAGTCCCCAGTCTTTTTGG + Intronic
1070018538 10:72560056-72560078 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1070048390 10:72862388-72862410 ACAGCAGTTCCCAACCTTTTTGG + Intronic
1070079908 10:73175883-73175905 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1070097886 10:73355913-73355935 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1070187494 10:74079245-74079267 ACAGCTGGCCTGAATCTATCTGG - Intronic
1070308002 10:75251285-75251307 AGAGCTTTCCCCAATCCCTCGGG + Intergenic
1070691658 10:78531646-78531668 GCAGCAGTCCCCAATCTTTTTGG + Intergenic
1071981213 10:91005809-91005831 ACAGCTGGGCCCAAACTTTCTGG - Intergenic
1072584319 10:96767924-96767946 GCAGCAGTCCTCAATCTTTTTGG + Intergenic
1072672343 10:97439754-97439776 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1072892798 10:99339698-99339720 CCAGAGGTCCCCAACCTTTCTGG - Intronic
1072998950 10:100271243-100271265 GCAGCAGTCCCTAATCTTTTTGG - Intergenic
1073219523 10:101858607-101858629 TCATCTGTCCCCACCCTTTCTGG + Intronic
1073232369 10:101983001-101983023 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1073303678 10:102486363-102486385 GCAGTGGTCCCCAACCTTTCTGG - Intronic
1073438187 10:103535171-103535193 ACAGCTGTGCCCCACCTTTCTGG - Intronic
1073610341 10:104936969-104936991 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1073635251 10:105191590-105191612 GCAGCAGTCCCCAACCTTTTGGG + Intronic
1073642951 10:105271427-105271449 CCAGCAGTCCCCAACCTTTCTGG + Intergenic
1073699259 10:105907106-105907128 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1073839248 10:107479675-107479697 ACAGTGGTCCCCAAGCTTTCTGG + Intergenic
1074139669 10:110660903-110660925 ACAGCGGTCCCCAACCTTTTCGG - Intronic
1074306031 10:112279395-112279417 GCAGCTTTCCCAAATCATTCAGG + Intergenic
1074584649 10:114755357-114755379 ACATCAGTCCCCAACCTTTTTGG - Intergenic
1074637512 10:115337796-115337818 ACAGCAGTCCCCAACATTTTTGG + Intronic
1074663420 10:115690216-115690238 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1074716707 10:116226555-116226577 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1074735303 10:116425030-116425052 ACAGCAGTCCCCAACCATTTTGG - Intergenic
1074743989 10:116513247-116513269 GCAGTGGTCCCCAACCTTTCTGG + Intergenic
1075013160 10:118892010-118892032 ACAGCAGTTCCCAACCTTTTTGG + Intergenic
1075304651 10:121356795-121356817 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1075348726 10:121704662-121704684 GCAGCTGTCCCCAAACTTTTTGG - Intergenic
1075363757 10:121864158-121864180 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1075606262 10:123812884-123812906 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1075610027 10:123846075-123846097 GCAGCAGTCCCCAAACTTTCTGG + Intronic
1075655755 10:124160085-124160107 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
1075848210 10:125564399-125564421 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1075985444 10:126781042-126781064 ACAGGAGACCCCAAGCTTTCAGG - Intergenic
1076041069 10:127249066-127249088 ACAGCGGTCCCCATCCTTTTTGG - Intronic
1076057390 10:127386819-127386841 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1076063741 10:127432152-127432174 GCAGTTGTCCCCAACCTTTTTGG - Intronic
1076284887 10:129285258-129285280 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1076415084 10:130280273-130280295 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
1076433545 10:130424229-130424251 ACAGCTGTCCCCATGCTATGAGG - Intergenic
1077400894 11:2356586-2356608 ACAGCAGTCCTCAACCTTTTTGG - Intergenic
1077643413 11:3902367-3902389 GCAGCGATCCCCAATCTTTTTGG + Intronic
1077659495 11:4054710-4054732 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1077901613 11:6494527-6494549 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1077946293 11:6903836-6903858 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1078352127 11:10603306-10603328 TCAGCAGTCCCCAACCTTTTCGG + Intronic
1078396639 11:10987449-10987471 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1079149891 11:17888186-17888208 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1079433481 11:20420703-20420725 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1079773552 11:24495678-24495700 ACAGCTGTCCATTATCTTTCGGG + Intergenic
1080202091 11:29684160-29684182 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1080350471 11:31379451-31379473 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1080364424 11:31554291-31554313 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1080466507 11:32502421-32502443 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1080654209 11:34245842-34245864 AAAGCTGTCCCCAAAGTATCAGG + Intronic
1080722798 11:34866311-34866333 CCAGTGGTCCCCAATCTTTTTGG - Intronic
1080878517 11:36298200-36298222 CCAGCAGTCCCCAATTTTTTTGG + Intronic
1081033436 11:38113912-38113934 CCAGGTGTCTCCAAACTTTCAGG - Intergenic
1081281168 11:41210790-41210812 TCAGCAGTCCCCAATCTTTTTGG + Intronic
1081924772 11:46816144-46816166 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1082263759 11:50097899-50097921 GCAGCGGTCCCCAATTTTTTTGG + Intergenic
1082740787 11:56908770-56908792 GCAGTGGTCCTCAATCTTTCTGG + Intergenic
1082989725 11:59197002-59197024 ACAGCTGTCCCCAACCATTTTGG - Intronic
1083019963 11:59496700-59496722 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1084101600 11:66953255-66953277 AGAGCTGTCTCTAATCCTTCAGG + Intronic
1084955967 11:72691786-72691808 GCAGCAGTCCCCAGTCTTTTTGG + Intronic
1084968008 11:72754424-72754446 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1084984851 11:72859913-72859935 ACAGCTGTCCCCAATCTTTTAGG + Intronic
1085103660 11:73823224-73823246 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1085131865 11:74046841-74046863 ACAGCAGTTTCCAAACTTTCTGG - Intronic
1085190912 11:74621472-74621494 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1085219542 11:74861716-74861738 GCAGCAGTCCCCAACCTTTTCGG - Intronic
1085362391 11:75902206-75902228 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1085498341 11:76993641-76993663 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1085503865 11:77044646-77044668 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1085566337 11:77517532-77517554 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1085598518 11:77832819-77832841 ACAGCAGTCCCTAACCTTTTTGG + Intronic
1085840645 11:80008165-80008187 ACAGCTGTTCCCAATATTCTTGG - Intergenic
1085885622 11:80518337-80518359 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1085898089 11:80663702-80663724 TCAGCGGTCCCCAAACTTTTTGG - Intergenic
1086489898 11:87348664-87348686 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1086532913 11:87807221-87807243 TCAGCAGTCCCCAACCTTTTCGG - Intergenic
1086602985 11:88658238-88658260 ACAGCGGTCCCCAACGTTTTTGG - Intronic
1086762143 11:90644684-90644706 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1086793303 11:91068219-91068241 GCAGCAGTCCCTAATCTTTTTGG - Intergenic
1086993072 11:93327606-93327628 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1087060587 11:93973199-93973221 ACAGCAGTTCCCAACCTTTTTGG - Intergenic
1087656452 11:100929058-100929080 CCAGCGGTCCCCAACCTTTTTGG + Intronic
1088075777 11:105846967-105846989 GCAACGGTCCCCAATCTTTTTGG + Intronic
1088205480 11:107387548-107387570 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1088484980 11:110332074-110332096 TCAGCAGTCCCCAACCTTTATGG + Intergenic
1088650514 11:111953983-111954005 CCAGAGGTCCCCAACCTTTCTGG + Intronic
1088736306 11:112730432-112730454 ACAGTGGTCCCCAACCTTTCTGG - Intergenic
1089052672 11:115559216-115559238 CCAGCGGTCACCAACCTTTCTGG - Intergenic
1089181404 11:116585437-116585459 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1089281383 11:117377131-117377153 CCAGCGGTCCCCAACCTTTTTGG + Intronic
1089570701 11:119407086-119407108 GCAGCTGTCCCCAACCTTTTTGG + Intergenic
1089979330 11:122759332-122759354 GCAGTGGTCCCCAATCTTTTTGG + Intronic
1090658989 11:128867670-128867692 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1090671216 11:128946861-128946883 ACAGCGGTCCTCAACCTTTTTGG + Intergenic
1091115546 11:133009563-133009585 GCAGCATTCCCCAATCTTTCTGG + Intronic
1091338594 11:134793334-134793356 GCAGCTGTAGCCAAACTTTCTGG + Intergenic
1091425492 12:384496-384518 ACAGCTGTCCCAAACCTTTTTGG - Intronic
1091479676 12:814672-814694 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1091536354 12:1413870-1413892 CCAGCAGTCCCCAACCTTTCTGG + Intronic
1091643741 12:2257335-2257357 ACAGCGGTCTCCAACCTTTTTGG + Intronic
1091658869 12:2366659-2366681 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1091755340 12:3047662-3047684 GCAGCAGTCCCCAACCTTTGTGG - Intergenic
1091936099 12:4435511-4435533 ACAGCAGTCCCCAGCCTTTTTGG - Intronic
1092067994 12:5608031-5608053 ACAGTGGTCCCCAGTCTTTTTGG - Intronic
1092195021 12:6544093-6544115 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1092781074 12:11988053-11988075 GCAGCAGTCCCCAACGTTTCTGG + Intergenic
1092833970 12:12470627-12470649 ACAGCAGTCCCCAACCTTTCTGG - Intergenic
1092871692 12:12811302-12811324 ACAGCGGTCCCCAACCTTTTTGG - Intronic
1092938944 12:13389783-13389805 GCAGCCATCCCCAACCTTTCTGG - Intergenic
1093269644 12:17044472-17044494 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1093340667 12:17968948-17968970 ACAGCTGTTCCAAACCTTTTTGG - Intergenic
1093593260 12:20931847-20931869 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1093651709 12:21653471-21653493 GCAGCAGTCCCCAACCTTTCTGG - Intronic
1093810841 12:23490621-23490643 GCAGTGGTCCCCAATCTTTTTGG - Intergenic
1093879137 12:24383694-24383716 GCAGCAGTCCCCAAACTTTTTGG + Intergenic
1093923294 12:24883673-24883695 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1093944167 12:25087968-25087990 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1093957290 12:25235772-25235794 ACAGCGGTCCCCAACTTTTCCGG + Intronic
1094066249 12:26363515-26363537 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1094075098 12:26464101-26464123 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1094251918 12:28371465-28371487 ACAGCAGTCCCTAACCTTTTTGG - Intronic
1094416011 12:30215833-30215855 CCAGTCGTCCCCAACCTTTCTGG + Intergenic
1094488129 12:30941056-30941078 ACAGCGGTCCCCAACCTTTTTGG - Intronic
1094719080 12:33044187-33044209 ACAGCAGGCCCCAACCTTTTTGG + Intergenic
1094720164 12:33055069-33055091 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1095232203 12:39752477-39752499 ACAGCGGTCCTCAAACTTTTTGG - Intronic
1095472582 12:42552789-42552811 ATGGCCGTCCCCAATCTTTTTGG + Intronic
1095589591 12:43888955-43888977 TCAGCGGTCCCCAACCTTTTTGG + Intronic
1095734141 12:45537944-45537966 ACAGCAGTCCCCAATGTTTTTGG + Intergenic
1095915412 12:47473061-47473083 TCAGCAGTCCCCAATCTTTTTGG - Intergenic
1095942223 12:47734875-47734897 CCAGCTGTCCCCTCTCTCTCAGG - Intronic
1096019226 12:48308281-48308303 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1097325104 12:58267318-58267340 ACAGTGGTCCCCAACCTTTCTGG - Intergenic
1097580863 12:61454748-61454770 ACAGCAGTCCCCAACCTTTCTGG + Intergenic
1097625976 12:62001235-62001257 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1097906669 12:64926803-64926825 TCAGCAGTCCCCAACCTTTTCGG - Intergenic
1098172763 12:67763160-67763182 ACAGCAGTCACCAAACTTTTTGG - Intergenic
1098370091 12:69749409-69749431 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1098381582 12:69875829-69875851 ACAGCAATCCCCAACCTTTTTGG - Intronic
1098658066 12:73057862-73057884 ACAGGGGTCCCCAATATTTTTGG - Intergenic
1098915600 12:76253970-76253992 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1099012142 12:77303815-77303837 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1099155264 12:79167753-79167775 ACAGCGGTCCCCAACATTTTTGG + Intronic
1099198455 12:79647839-79647861 ACAGCGGTCCCCAATCTTTTTGG + Intronic
1099306760 12:80966443-80966465 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1099317829 12:81106584-81106606 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1099446674 12:82761082-82761104 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1099814332 12:87625616-87625638 TCAGCTGTCTCCAACCTTTTTGG - Intergenic
1100162172 12:91872993-91873015 ACAGCAATCCCCAACCTTTCTGG - Intergenic
1100324803 12:93530900-93530922 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
1100424332 12:94469351-94469373 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1100625628 12:96328445-96328467 TCAGTGGTCCCCAACCTTTCTGG - Intronic
1100899622 12:99223233-99223255 TCAGCAGTCCCCAGTCTTTTTGG + Intronic
1100993669 12:100279099-100279121 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1101026417 12:100611502-100611524 GCAGCAGTCCCCAGTCTTTTTGG + Intronic
1101210843 12:102534025-102534047 ACTGCTGTCTCAAATCTTGCTGG - Intergenic
1101364971 12:104063158-104063180 TCAGCTGTCCCCAACCTTTTTGG - Intronic
1101373437 12:104150993-104151015 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1101539584 12:105652926-105652948 ACAGCGGTTCCCAACCTTTTTGG + Intergenic
1101676920 12:106925736-106925758 TCAGCAGTCCCCAAACTTTTTGG + Intergenic
1101749071 12:107567894-107567916 CCAACCGTCCCCAATCTTTTTGG - Intronic
1101761499 12:107662470-107662492 ACAGCAGTCCCAGATTTTTCTGG - Intergenic
1101819091 12:108169385-108169407 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1101917188 12:108904677-108904699 CCAGGTGTCCCCAACCTTTTTGG - Intergenic
1102114952 12:110395878-110395900 TCAGCGGTCCCCAACCTTTTTGG + Intronic
1102329209 12:112014466-112014488 ACAGCTATCCCCAACCTTTTTGG - Intronic
1102431359 12:112886282-112886304 GCAGCAGTTCCCAATCTTTCTGG + Intronic
1102532700 12:113558474-113558496 ATGGCTGTCTCCAATCATTCTGG - Intergenic
1102601800 12:114037094-114037116 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1102667231 12:114585547-114585569 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1103338225 12:120206162-120206184 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1103860072 12:124005091-124005113 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1103900511 12:124301416-124301438 AAAGCTGCCCCCAGTCTGTCTGG - Intronic
1104297935 12:127535191-127535213 ACAGCAGTCCCTAATCTTTTTGG - Intergenic
1104361430 12:128136852-128136874 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1104377266 12:128275663-128275685 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1104466065 12:128991938-128991960 TCAGCGGTCCCCAAACTTTTTGG + Intergenic
1104501810 12:129293396-129293418 GCAGCAGTCCCCAGCCTTTCTGG + Intronic
1104518759 12:129453230-129453252 ACAGCGGTCCCCAATCTTTTTGG - Intronic
1104577531 12:129981482-129981504 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1104624532 12:130340312-130340334 TCAGCAGTCCCCAGTCTTTTTGG + Intronic
1105435864 13:20377981-20378003 TCAGCTCTCACCAATCTCTCTGG + Intergenic
1105786661 13:23756912-23756934 ATAGCTGTCCCCAATCTTTCTGG + Intronic
1105983990 13:25547719-25547741 AAAGCTGTCCCCAACCTTTTTGG - Intronic
1106066317 13:26354788-26354810 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1106142234 13:27020932-27020954 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1106144617 13:27040014-27040036 ACAGGTGTCAGCAATCTATCTGG - Intergenic
1106428293 13:29654945-29654967 GCAGCGGTCCCAAATCTTTTTGG - Intergenic
1106998725 13:35519972-35519994 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1106999114 13:35522901-35522923 GCAGCAGTCCTCAACCTTTCTGG - Intronic
1107048944 13:36027117-36027139 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1107106351 13:36647540-36647562 GCAGGAGTCCCCAATCTTTTTGG + Intergenic
1107446231 13:40472365-40472387 TCAGCGGTCCCCAGTCTTTCTGG - Intergenic
1107603164 13:42033614-42033636 GCAGCGGTCCCCAATCTTTTTGG - Intergenic
1107804398 13:44140758-44140780 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1107895336 13:44956341-44956363 ACAACGGTCCCCAGCCTTTCTGG + Intronic
1108233235 13:48372099-48372121 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1108320320 13:49282931-49282953 AAAGCAGTCCCCAACCTTTGTGG - Intronic
1108344460 13:49531296-49531318 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1108345853 13:49546384-49546406 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1108369522 13:49753891-49753913 ACAGTGGTCCCCAACCTTTATGG - Intronic
1108369944 13:49759341-49759363 TCAGCTGTTCCCAAACTTTTTGG + Intronic
1108435009 13:50393413-50393435 CCAGCAGTCCCCAATGTTTTTGG + Intronic
1108537521 13:51400233-51400255 GCAGCTGTCCCCAACCTTTTTGG - Intronic
1108583497 13:51847476-51847498 CCAGTGGTCCCCAATCTTTTTGG - Intergenic
1108608167 13:52061064-52061086 GCAGTGGTCCCCAACCTTTCTGG + Intronic
1108747557 13:53410261-53410283 ACAGCGGTCCCCAACCTTTTTGG + Intergenic
1108845191 13:54669653-54669675 ACAGCAATCCCCAACCTTTTTGG - Intergenic
1109170845 13:59095694-59095716 ACAGCAGTCCCTAACCTTTTTGG + Intergenic
1109200357 13:59423631-59423653 GCAGCGGTCCCCAAGCTTTTTGG - Intergenic
1109258360 13:60111714-60111736 TCAGCGGTCCCCAACCTTTTTGG - Intronic
1109346750 13:61124340-61124362 GCAGTGGTCCCCAATCTTTTTGG - Intergenic
1109830517 13:67781164-67781186 GCAGTGGTCCCCAATCTTTTTGG + Intergenic
1110105476 13:71669620-71669642 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1110274431 13:73627880-73627902 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1110407030 13:75162246-75162268 ACAGCAGTCCCCAACCTTTTGGG - Intergenic
1110433052 13:75448098-75448120 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1110552411 13:76824401-76824423 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1110717369 13:78721443-78721465 GCAGCGGTGTCCAATCTTTCTGG - Intergenic
1110762993 13:79251392-79251414 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1111080571 13:83301750-83301772 GCAGTTGTCCCCAACCTTTTTGG + Intergenic
1111201295 13:84940605-84940627 TCAGTGGTCCCCAAACTTTCTGG - Intergenic
1111756570 13:92403644-92403666 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1111823109 13:93236733-93236755 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1112032933 13:95473939-95473961 ACAGCGGTCCCCAACCTTTTTGG + Intronic
1112057805 13:95706976-95706998 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1112265241 13:97917866-97917888 GCAGCGGTCCCTAATCTTTTTGG + Intergenic
1112298756 13:98211488-98211510 GCAGCGGTCCCCAACCTTTGTGG - Intronic
1112353901 13:98658954-98658976 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1112410263 13:99156861-99156883 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1112939294 13:104841550-104841572 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1112940015 13:104850012-104850034 ACAGATGTCTCCAAGCTTCCAGG + Intergenic
1113215399 13:108034846-108034868 ACAGGTGTCCCCCAACTTTTTGG - Intergenic
1113224238 13:108141577-108141599 ATAGCTGTTCCCAACCTTTTTGG - Intergenic
1113247167 13:108410653-108410675 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1113347072 13:109489468-109489490 GCAGCAGTCCCCAAACTTTTTGG - Intergenic
1113658335 13:112085516-112085538 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1113720378 13:112551809-112551831 ACAGCAGTCCCCGACCTTTTTGG + Intronic
1113783544 13:112989812-112989834 CCAGCAGTCCCCAATCTTTCTGG + Intronic
1114161032 14:20167836-20167858 ATAGCGGTCCCCAACCTTTTAGG + Intergenic
1114278179 14:21167018-21167040 ACAGTAGTCCCCAATGTTTTTGG + Intergenic
1114656795 14:24320934-24320956 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1114897150 14:27005070-27005092 TCAGCAGTCCCCAAACTTTTTGG - Intergenic
1115202607 14:30870745-30870767 GCAGCTGTCCCCAACCTTTTTGG - Intergenic
1115292274 14:31785573-31785595 ACAGCAGTCCACAACCTTTTTGG - Intronic
1115457274 14:33618141-33618163 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1116200307 14:41785520-41785542 GCAGCGGTCCCCAAACTTTTTGG + Intronic
1116275984 14:42832337-42832359 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1116388236 14:44359351-44359373 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1116419153 14:44713179-44713201 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1116443800 14:44985387-44985409 TCAGCAGTCCCCAATCCTTTTGG + Intronic
1116643513 14:47496815-47496837 ACAATGGTCCCCAACCTTTCTGG + Intronic
1116823942 14:49652897-49652919 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1117088796 14:52228735-52228757 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1117161530 14:52994792-52994814 CCAGCAGTCCCCACTCTTTTTGG + Intergenic
1117224622 14:53642449-53642471 ACAGCAGTACCCAACCTTTTTGG + Intergenic
1117630903 14:57690467-57690489 CCAGCAGTCCCCAATCTTTTTGG + Intronic
1118187963 14:63554727-63554749 CCAGCAGTCCACAACCTTTCTGG + Intergenic
1118551704 14:66958030-66958052 ACAGCGGTCCTCAATGTTTTGGG - Intronic
1118841454 14:69516329-69516351 ACAACTGTCACCAAACTTTTTGG + Intronic
1118943033 14:70356138-70356160 ACAGTGGTCCCCAAACTTTCTGG + Intronic
1119012178 14:71004625-71004647 GCAACGGTCCCCAACCTTTCTGG - Intronic
1119062138 14:71485781-71485803 CCAGCGGTCCCCAATCTTTTTGG - Intronic
1120224333 14:81773713-81773735 AAATCTGTCCACAATCTTCCTGG + Intergenic
1120236348 14:81896024-81896046 ACAGCGATCCCCAATCATTTTGG + Intergenic
1120428420 14:84381311-84381333 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1120578814 14:86220888-86220910 ACAAATGTCCCCAACCTTTTTGG + Intergenic
1120618797 14:86737611-86737633 GCAGTGGTCCCCAATCTTTTTGG - Intergenic
1120633630 14:86923822-86923844 ACAGTGGTCCCCAACCTTTGTGG - Intergenic
1120680617 14:87476906-87476928 TCAGCGGTCTCCAACCTTTCTGG + Intergenic
1120685714 14:87534124-87534146 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1120810982 14:88803188-88803210 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1120868687 14:89318028-89318050 ATAGCAGTCCCCAACCTTTTTGG - Intronic
1121078185 14:91086375-91086397 GCAGCAGTCCCCAATTTTTTTGG - Intronic
1121270812 14:92637005-92637027 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1121290619 14:92771929-92771951 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
1121497040 14:94399947-94399969 TCAGCCGTTCCCAATCTTTTTGG + Intergenic
1121596727 14:95169278-95169300 ACAGCAATCCCCAACCTTTTTGG + Intergenic
1121648695 14:95539245-95539267 ACAGAGGTCCCCAACCTTTTTGG - Intronic
1122601669 14:102924617-102924639 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1122660064 14:103289182-103289204 ACAGTAGTCCCCAACCTTTTTGG - Intergenic
1123996932 15:25725309-25725331 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1124137957 15:27051622-27051644 ACAGTAGTCCCCAACCTTTTTGG + Intronic
1124393060 15:29277435-29277457 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1124484991 15:30105748-30105770 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
1124518587 15:30391521-30391543 CCAGCAGTCCCCAAACTTTTTGG + Intronic
1124540066 15:30574727-30574749 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
1124758584 15:32432850-32432872 CCAGCAGTCCCCAAACTTTTTGG + Intergenic
1124951308 15:34323629-34323651 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1125135234 15:36333464-36333486 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1125499703 15:40231978-40232000 TGAGTGGTCCCCAATCTTTCTGG + Intergenic
1125560765 15:40631254-40631276 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1125801445 15:42451747-42451769 ACAGCTTTCCACATTCTTTGAGG - Exonic
1125809403 15:42524668-42524690 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1125979467 15:43987425-43987447 ACAGCGGTCCTCAACCTTTTTGG + Intronic
1126027528 15:44462332-44462354 ACAGCAGTCCCCAACCGTTTTGG + Intronic
1126136193 15:45394391-45394413 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1126201739 15:45994561-45994583 ACAGCTGTCAGCCATCTTTAGGG + Intergenic
1126547008 15:49884979-49885001 TCAGTGGTCCCCAATCTTTTTGG - Intronic
1126821706 15:52510790-52510812 TCAGCGGTCCCCAACCTTTTTGG - Intronic
1127008533 15:54597018-54597040 AGAGCTGTTCCCAATCTTTTTGG + Intronic
1127148896 15:56053707-56053729 GCTGCAGTCCCCAATCTTTTTGG - Intergenic
1127149048 15:56054993-56055015 CCAGCTATCCCCAACCTTTTTGG + Intergenic
1127160758 15:56182268-56182290 ACAGCAGTCCCCAACCATTTTGG - Intronic
1127281392 15:57496568-57496590 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1127477383 15:59347391-59347413 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1127681570 15:61303148-61303170 ACAGTGGTCCCCAATCTTTTAGG - Intergenic
1128383485 15:67130613-67130635 GCAGTGGTCCCCAATCTTTTTGG - Intronic
1129703106 15:77779273-77779295 ACAGCAGTCCCCAACCTTTCTGG + Intronic
1129850963 15:78793763-78793785 ACATCTGTTCCCCATCCTTCTGG + Intronic
1129885981 15:79037301-79037323 GCAGCCATCCCCAATCTTTTTGG + Intronic
1130189224 15:81716011-81716033 ACAGCTGTCCTCAACATTTTTGG - Intergenic
1130251422 15:82302300-82302322 ACATCTGTTCCCCATCCTTCTGG - Intergenic
1130443417 15:83977313-83977335 CCAGCAGTCCCCAACCTTTCTGG - Intronic
1130760502 15:86814377-86814399 AGAGCAGTCCCCAACCTTTTTGG - Intronic
1130918848 15:88327284-88327306 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1131407303 15:92175858-92175880 CCAGCGGTCCCTAACCTTTCTGG - Intergenic
1131714558 15:95094520-95094542 GCAGCAGTCCCCAAACTTTTTGG + Intergenic
1131933662 15:97476002-97476024 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1132730779 16:1360742-1360764 CCAGTGGTCCCCAATCTTTTTGG - Intronic
1133660295 16:7909907-7909929 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1133685071 16:8158888-8158910 ACAGCGGTCCCCAACCCTCCAGG + Intergenic
1133685166 16:8159513-8159535 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1134080422 16:11321001-11321023 ACCGCAGTCCCCAACCTTTTTGG - Intronic
1134248766 16:12559587-12559609 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1134583486 16:15391375-15391397 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1134586425 16:15415192-15415214 ACAGCAGTCCCCAACATTTTTGG - Intronic
1134690301 16:16186844-16186866 ACAGTGGTCCCCAAGCTTTTTGG - Intronic
1135127592 16:19823977-19823999 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1135132437 16:19863977-19863999 GCAGCTGTCCCCAAACTTTTTGG - Intronic
1135191388 16:20357678-20357700 GCAGCAGTCCCCAATCTTTTTGG + Intergenic
1135314977 16:21436810-21436832 ACAGCAGTCCCCAACATTTTTGG - Intronic
1135367903 16:21869078-21869100 ACAGCAGTCCCCAACATTTTTGG - Intronic
1135443914 16:22502071-22502093 ACAGCAGTCCCCAACATTTTTGG + Intronic
1135449429 16:22544671-22544693 ACAGCAGTCCCCAACATTTTTGG + Intergenic
1135597998 16:23757749-23757771 TCAGCAGTCCCCAACCTTTTTGG + Exonic
1135852778 16:25979771-25979793 ACAGCAGTTCCCAAACTTTTTGG - Intronic
1135853310 16:25984206-25984228 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1136060987 16:27726297-27726319 CCAGCGGTCCCCAACCTTTTGGG - Intronic
1136192792 16:28627987-28628009 ACAGCAGTCCCCAACATTTTTGG + Intergenic
1136311647 16:29415471-29415493 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1136325090 16:29517266-29517288 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1136390153 16:29959069-29959091 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1136439775 16:30257250-30257272 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1137295129 16:47085017-47085039 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1137310604 16:47253525-47253547 GCAGTGGTCCCCAACCTTTCTGG + Intronic
1137325547 16:47431528-47431550 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1137408615 16:48209320-48209342 GCAGCTGCCCCCAATCTTTTTGG + Intronic
1137419980 16:48325008-48325030 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1137459968 16:48651441-48651463 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1137481653 16:48856781-48856803 GCAGCTGTCCCCAACCTTTTTGG - Intergenic
1138334640 16:56243329-56243351 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1138437572 16:57012740-57012762 ACAGCAGTCCCCAGACTTTTTGG - Intronic
1138612507 16:58137392-58137414 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1138643347 16:58404068-58404090 ACATCTGTTCCCAACCTTTATGG + Intronic
1138694259 16:58796914-58796936 CCAGCAGTCCCCACTCTTTTTGG - Intergenic
1138760104 16:59533307-59533329 ACAGCGGTCCCCAATCTTTTTGG - Intergenic
1139375033 16:66491578-66491600 CCAGCGGTCCCCAACCTTTTTGG + Intronic
1139886277 16:70209547-70209569 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1139997779 16:70996787-70996809 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1140013612 16:71160914-71160936 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1140239268 16:73186295-73186317 GCAGCAGTCCCAAATCTTTTTGG - Intergenic
1140418625 16:74797266-74797288 GCAGCAGTCCCCAGTCTTTTTGG + Intergenic
1140522892 16:75597460-75597482 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1140902883 16:79386084-79386106 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1140919701 16:79526162-79526184 CCAGCAGTCCCCAATCTTTTTGG + Intergenic
1141043597 16:80694028-80694050 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1141120057 16:81346670-81346692 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1141873944 16:86808763-86808785 ACAGCGGTCCCCAACATTTCAGG + Intergenic
1141876974 16:86831815-86831837 TCAGCAGTCCCCAAACTTTTTGG - Intergenic
1142435091 16:90051556-90051578 CCAGGTGTCCCCAAACTTTTTGG - Intergenic
1142534845 17:606924-606946 CCAGCTGTCCCCAACCTTTTTGG - Intronic
1143066077 17:4248470-4248492 ACAGTGGTCCCCAATCTTTTTGG - Intronic
1143212483 17:5198867-5198889 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1143812333 17:9481964-9481986 ACAGCGGTCCCCAACCTTTTTGG - Intronic
1144310950 17:14013920-14013942 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1144523929 17:15973726-15973748 TCAGTGGTCCCCAACCTTTCTGG - Intronic
1144557912 17:16298113-16298135 GCAGTGGTCCCCAACCTTTCTGG - Intronic
1144584544 17:16480327-16480349 GCAGCGGTCTCCAATCTTTTTGG - Intronic
1144614085 17:16752369-16752391 ACAGCAGTCCCCAACCTTTCTGG - Intronic
1144898625 17:18563298-18563320 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1145000731 17:19302784-19302806 TCAGCTGTCCCCAACCTTTCTGG - Intronic
1145133751 17:20382421-20382443 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1145191725 17:20846772-20846794 ACAGCATTCCCCAAACTTTTTGG - Intronic
1145401935 17:22546771-22546793 ACAGCATTCCCCAAACTTTTTGG - Intergenic
1145779792 17:27554799-27554821 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1146220557 17:31015591-31015613 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1146845699 17:36180773-36180795 CCAGCGGTCCCCAAACTTTTTGG + Intronic
1147451347 17:40506667-40506689 ACATCTCTCTCCAATCTTTTGGG - Intergenic
1147574711 17:41592543-41592565 ACAGCAGTCCGCAACCTTTTTGG + Intergenic
1147634796 17:41957212-41957234 TCAGCAGTCCCCAAGCTTTTTGG + Intronic
1147916962 17:43893812-43893834 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1148294459 17:46488797-46488819 TCAGCAGTCCCCAACCTTTGTGG - Intergenic
1148316642 17:46706510-46706532 TCAGCAGTCCCCAACCTTTGTGG - Intronic
1148845116 17:50525350-50525372 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1148979751 17:51562312-51562334 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1149136544 17:53372216-53372238 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1149270972 17:54976867-54976889 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1149290634 17:55214841-55214863 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1149314728 17:55428230-55428252 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1149927679 17:60717715-60717737 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1150134074 17:62685970-62685992 GCAGCTGTCCCCAACCTTTTTGG + Intronic
1150169003 17:62971946-62971968 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1150181427 17:63124962-63124984 TCAGTGGTCCCCAATCTTTTGGG - Intronic
1150368498 17:64613608-64613630 ACCGCAGTCCCCAACCTTTTTGG + Intronic
1150467908 17:65410512-65410534 ACAGCAGTCACCAACCTTTATGG + Intergenic
1150826554 17:68481197-68481219 ACCGCAGTCCCCAACCTTTTTGG + Intergenic
1150882189 17:69042835-69042857 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1150905112 17:69328235-69328257 ACAGCGGTCCCCAACCTTTTGGG + Intergenic
1150924250 17:69516006-69516028 TCAGCGGTCCCCAACCTTTTTGG + Intronic
1151032123 17:70753376-70753398 ACAGCAATCCCCAACCTTTTTGG - Intergenic
1151175184 17:72282167-72282189 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1151199196 17:72455342-72455364 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
1151263608 17:72936677-72936699 ACAGCAGTTCCCAACCTTTTTGG + Intronic
1151275333 17:73029929-73029951 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1151275751 17:73032958-73032980 CCAGCGGTCCCCAATCCTTTGGG + Intronic
1151468807 17:74305049-74305071 AGAGCAGTCCCCACTCTTCCCGG - Intronic
1152014568 17:77741944-77741966 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1152155949 17:78632825-78632847 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1152381827 17:79946148-79946170 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1152422316 17:80200566-80200588 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1153078918 18:1197731-1197753 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1153205618 18:2696561-2696583 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1153377169 18:4393707-4393729 ACAGCAGTCCCCAACCCTTTCGG + Intronic
1153495755 18:5697003-5697025 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1153529066 18:6025603-6025625 ACAGTGGTTCCCAATCTTTTTGG + Intronic
1153912199 18:9714189-9714211 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1154226697 18:12511518-12511540 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1154236226 18:12608906-12608928 GCAGCAGTCCCCAATCTTTTTGG + Intronic
1154306318 18:13233387-13233409 ACAGCTGTCCCGCCTCTTACTGG - Intronic
1154379241 18:13834989-13835011 GCAGCAGTCCCCAGTCTTTTGGG + Intergenic
1154523346 18:15253944-15253966 ACAAGTGACACCAATCTTTCTGG - Intergenic
1154935611 18:21052854-21052876 GCAGCAGTCCCCAAACTTTTTGG - Intronic
1154965307 18:21349943-21349965 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1155528184 18:26738766-26738788 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1155690667 18:28618551-28618573 GCAGCTGTCCCCAACCTTTCTGG + Intergenic
1155702227 18:28760743-28760765 ACAGCTGTCCCCAAACTTTTTGG - Intergenic
1155908288 18:31478745-31478767 ACAGCAGTCCCCAACCCTTCTGG + Intergenic
1156101554 18:33602273-33602295 ATAGCTGTCCCCTACCTTTTTGG - Intronic
1156350111 18:36296380-36296402 TTAGCCGTCCCCAATCTTTTTGG - Intergenic
1156419118 18:36931540-36931562 TCAGCAGTCCCCAAGCTTTTTGG - Intronic
1156781688 18:40857946-40857968 ACTGGTGTCCCCAATATTTTTGG - Intergenic
1157270862 18:46275081-46275103 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1157375610 18:47161638-47161660 CCAGCAGTCCCCAACCTTTGTGG + Intronic
1157468572 18:47969571-47969593 ACAGCAGTCCCCAGTCTTTTTGG - Intergenic
1157808595 18:50677234-50677256 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1157841805 18:50966152-50966174 ACAACAGTCCCCAACCTTTTTGG - Intergenic
1157870188 18:51222876-51222898 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1158133913 18:54184478-54184500 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1158197622 18:54906191-54906213 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1158480916 18:57821109-57821131 CCAGCAGTCCCCAGTCTTTTTGG - Intergenic
1158499761 18:57989860-57989882 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1158584412 18:58718630-58718652 GCAGCGGTCCCCAACCTTTCTGG - Intronic
1158595951 18:58816279-58816301 GCAGCAGACCCCAACCTTTCTGG + Intergenic
1158862881 18:61610328-61610350 ACAGCAGTCCCCAACATTTTTGG + Intergenic
1158896888 18:61922447-61922469 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1159031121 18:63233418-63233440 ACAGTGGTCCCCAACCTTTCTGG + Intronic
1159285335 18:66342576-66342598 GCAGTGGTCCCCAACCTTTCTGG + Intergenic
1159324595 18:66897913-66897935 ACAGCAGTCCTCAAACTTTTTGG - Intergenic
1159647578 18:70936992-70937014 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1159899998 18:74036895-74036917 ACAGTGGTCCCCAAGCTTTTTGG + Intergenic
1159937260 18:74379191-74379213 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1160271345 18:77387083-77387105 GCAGCAGTCCCCACTCTTTTTGG - Intergenic
1160281401 18:77494097-77494119 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1160398901 18:78594561-78594583 ACAGTAGTCCCCAATCTTTTTGG + Intergenic
1160430768 18:78811143-78811165 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1160606843 18:80057991-80058013 ACAGCAGTACCCAACCTTTTGGG - Intronic
1160887319 19:1355865-1355887 GCAGCTGTCCCCGTTCTTTCAGG + Intronic
1161511662 19:4675578-4675600 CCTCCTGTCCCCAAGCTTTCAGG - Exonic
1162175355 19:8826175-8826197 GCAGTGGTCCCCAACCTTTCTGG + Intronic
1162655542 19:12126370-12126392 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1162676764 19:12304946-12304968 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1162688528 19:12409059-12409081 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1163010604 19:14423254-14423276 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1163348053 19:16757213-16757235 GCAGCAGTCCCCAGTCTTTTTGG - Intronic
1163388869 19:17017452-17017474 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1163391086 19:17030281-17030303 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1163616883 19:18334487-18334509 CCAGCAGTCCCCAATCTTTTTGG - Intergenic
1164291607 19:23874378-23874400 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1164323687 19:24173722-24173744 GCAGTTGTCCCCAACCTTTTTGG + Intergenic
1164648344 19:29874636-29874658 ACAGCTGCCCCCAAACCTTGAGG + Intergenic
1165054373 19:33164747-33164769 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1165088201 19:33366087-33366109 GCAGCAGTCCCCAATCTTTTTGG - Intergenic
1165116150 19:33530069-33530091 ACTCCTTTCCCCATTCTTTCTGG + Intergenic
1165195490 19:34099294-34099316 ACAGAAGTCCCCAACCTTTTTGG - Intergenic
1165242491 19:34479953-34479975 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1165286022 19:34842218-34842240 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1165358089 19:35316431-35316453 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1165365841 19:35364094-35364116 ACAGCAGTCCCCAAACTTTTTGG + Intergenic
1165506960 19:36239106-36239128 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1165683930 19:37801846-37801868 TCAGTAGTCCCCAATCTTTTTGG + Intronic
1165988537 19:39792037-39792059 GCAGCGGTCCCCAATGTTTTTGG + Intergenic
1166018305 19:40000756-40000778 ACAGCAGTTCCCAACCTTTTTGG + Intronic
1166526159 19:43511271-43511293 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1166908636 19:46134287-46134309 ACAGCAGTCCCTAACCTTTTTGG + Intergenic
1167224471 19:48228375-48228397 ACAGCAGTTCCCAACCTTTTAGG - Intronic
1167401220 19:49271389-49271411 TCAGTGGTCCCCAATCTTTTTGG - Intergenic
1167819881 19:51917978-51918000 ACAGCAGTCCCCAACTTTTTCGG + Intronic
1168663613 19:58185750-58185772 CCAGCAGTCCCCACTCTTCCGGG - Intronic
1168664767 19:58195651-58195673 TCAGCAGTCCCCAACCTTTTTGG + Intronic
925198387 2:1946420-1946442 GCAGCGGTCCCCATCCTTTCTGG - Intronic
925462409 2:4074759-4074781 GCAGCTGTCCCCAACCTTTTTGG - Intergenic
925529266 2:4841750-4841772 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
925530529 2:4855793-4855815 ACAGCAGTCCCCAACCTCTTTGG - Intergenic
925801307 2:7604706-7604728 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
925891489 2:8438563-8438585 GCAGGGGTCCCCAGTCTTTCTGG - Intergenic
926151217 2:10426647-10426669 AGAGCTGTCCCCATCCTCTCTGG + Intronic
926903607 2:17785200-17785222 TCAGCAGTCCCCAACCTTTCTGG - Exonic
927339523 2:21966584-21966606 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
927341625 2:21990060-21990082 TCAGCAGTCCCTAATCTTTTTGG - Intergenic
927856882 2:26533295-26533317 GCAGCAGTCCCCAACCTTTTTGG - Intronic
928132786 2:28665225-28665247 ACAGCTGTACTTAATCTTCCTGG - Intergenic
928154709 2:28866330-28866352 ACAGCGGTCCCCAACCTTTTGGG + Intronic
928187452 2:29125223-29125245 ACAGCAGTCCCCAATCTTTCTGG - Intronic
928716793 2:34070860-34070882 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
928829010 2:35456245-35456267 GCAGCTGTCCCCAACCTTTTTGG + Intergenic
928930530 2:36619365-36619387 CCAGCAGTCCCCAATATTTTTGG - Intronic
929008943 2:37422257-37422279 ACAGCGGTCCCCAAACTTTTTGG - Intergenic
929058175 2:37896868-37896890 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
929390322 2:41461860-41461882 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
929527061 2:42714653-42714675 ACAGTGGTCCCCAACCTTTTTGG + Intronic
929746235 2:44662023-44662045 ACAGCTGTCCCAAATCATGAGGG - Intronic
929987688 2:46752379-46752401 ACAGCAGTCCCCAACCTTTTTGG - Intronic
930040462 2:47118586-47118608 GCAGCGGTCCCCAACCTTTTTGG - Intronic
930222631 2:48760784-48760806 GCAGCTTTCCCCAACCTTTTTGG + Intronic
930649733 2:53952649-53952671 CCAGCAGTCCCCAACCTTTTTGG + Intronic
930797964 2:55412675-55412697 CCAGCGGTCCCCAACCTTTTTGG - Intronic
931298238 2:60951243-60951265 TCAGCAGTCCCCAACCTTTTTGG + Intronic
931367659 2:61632948-61632970 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
931377311 2:61718933-61718955 ACAGCAGTCCCCCACCTTTTTGG - Intergenic
931489044 2:62724964-62724986 TCAGCAGTCCCCAATCTTTATGG - Intronic
931495739 2:62805011-62805033 ACAGCTGTCCCCAATCTTTCTGG - Intronic
931597875 2:63969753-63969775 ACAGCAGTCCTCAATCTTTTTGG - Intronic
931774737 2:65530877-65530899 GCAGCAGTACCCAATCTTTTTGG + Intergenic
931909381 2:66880214-66880236 ACAGCAGCCCCCAAACTTTTTGG - Intergenic
932020738 2:68083478-68083500 ACAGCAGTCCCCAACCTTTTTGG - Intronic
932283510 2:70514547-70514569 ACAGCTGGCCCCAAGCTCTGGGG + Intronic
932604689 2:73157140-73157162 ACAGCTGTCACCTGTCCTTCGGG + Intergenic
933224217 2:79726642-79726664 CCAGCGGTCCCTAACCTTTCTGG - Intronic
933310776 2:80658823-80658845 AGAGTGGTCCCCAATCTTTTTGG - Intergenic
933410026 2:81913748-81913770 CCAGTGGTCCCCAATCTTTCTGG + Intergenic
933423084 2:82077066-82077088 ACAGCAGTCCCCAGCCTTTTTGG + Intergenic
933480443 2:82850818-82850840 GCAGCAGTCCCCAGGCTTTCTGG + Intergenic
934660586 2:96141515-96141537 ACAGCAGTTCCCAACCTTTGTGG + Intergenic
934671448 2:96216008-96216030 CCAGCGGTCCCCAAACTTTTTGG + Intergenic
934818155 2:97348299-97348321 GCAGAGGTCCCCAATCTTTTTGG - Intergenic
934876056 2:97922012-97922034 ACAGTGGTCCCCAACATTTCTGG + Intronic
934885851 2:98023558-98023580 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
934984795 2:98876663-98876685 GCAGCAGTCCCCAATCTTTTTGG - Intronic
935096498 2:99949335-99949357 GCAGCAGTCCCCAATCTTTTTGG + Intronic
935228151 2:101072494-101072516 CCAGCAGTCCCCAAACTTTCTGG + Intronic
935330772 2:101975811-101975833 GCAGCGGTCCCCAACCTTTCTGG - Intergenic
935433130 2:102999432-102999454 GCAGCAGTCCCCAACCTTTCTGG - Intergenic
935707083 2:105866418-105866440 ACAGCAGTCCCCAAACTTTTTGG + Intronic
935891301 2:107681755-107681777 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
936689963 2:114874744-114874766 CCAGCAGTCCCCAACCTTTTTGG - Intronic
937196513 2:120161960-120161982 GCAGCAGTCCCCAACCTTTTTGG - Intronic
937381105 2:121377122-121377144 GCAGCAGTCCCCAACCTTTTTGG - Intronic
937455336 2:122036388-122036410 GCAGCGGTCCCCAGTCTTTTTGG - Intergenic
937670276 2:124530920-124530942 CCAGCGGTCCCCAACCTTTTTGG + Intronic
937850322 2:126626630-126626652 ATAGCAGTCCCCAACCTTTTTGG + Intergenic
938054918 2:128207819-128207841 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
938284087 2:130093385-130093407 TCAGTTGTCCACAATCTTTTTGG - Intronic
938431520 2:131245508-131245530 TCAGTTGTCCACAATCTTTTTGG + Intronic
938522646 2:132086816-132086838 ACAAGTGACACCAATCTTTCTGG - Intergenic
938698681 2:133857438-133857460 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
938740776 2:134230060-134230082 ACAGCAGCCCCCAAACTTTTTGG + Intronic
938876530 2:135537028-135537050 GCAGCAGTCCCCAACCTTTTTGG - Intronic
938943703 2:136191623-136191645 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
938985361 2:136570364-136570386 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
939291493 2:140201860-140201882 GCAGTGGTCCCCAATGTTTCTGG + Intergenic
939301583 2:140348871-140348893 ACAGCGGTCCCCAACCTTTCTGG + Intronic
939892643 2:147755838-147755860 TCAGCAGTCCCCAATTTTTTTGG + Intergenic
940312383 2:152292174-152292196 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
940325745 2:152423453-152423475 ACTGCTTCCCCCATTCTTTCTGG - Intronic
940329704 2:152461050-152461072 GCAGCAGCCCCCAACCTTTCTGG - Intronic
940349422 2:152665086-152665108 GCAGCGGTCCCCAACCTTTTTGG - Intronic
940427977 2:153552703-153552725 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
940511186 2:154617085-154617107 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
940610063 2:155978900-155978922 GCAGCTGTCCCCAAGCTTTTTGG - Intergenic
940670469 2:156661211-156661233 ACAGCGATCCCCAAACTTTTTGG - Intergenic
940965479 2:159832470-159832492 CCAGCAGTCCCCAACCTTTTTGG - Intronic
941002768 2:160218996-160219018 CCAGCAGTCCCCAAACTTTTTGG - Intronic
941509041 2:166383064-166383086 TCAGCAGTCCCCAATCTTTTTGG - Intergenic
941769552 2:169330146-169330168 GCAGCGGTCCCCAAGCTTTTTGG - Intronic
941936476 2:170985352-170985374 ACAGCGGTCCCCAACCTTTGTGG + Intergenic
942009879 2:171750934-171750956 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
942158426 2:173156446-173156468 ACAGCAGTCCCCAACCTTTTTGG + Intronic
942228785 2:173840330-173840352 ACAGCTAATCCCAATCTTTGTGG - Intergenic
942235792 2:173903927-173903949 ACGGCGGTCCCCAAACTTTTTGG + Intergenic
942238835 2:173940199-173940221 ACAGCGGTCCCCAACCTTTTTGG + Intronic
942340013 2:174934007-174934029 ACAGTGGTCCCCAACCTTTTTGG + Intronic
942477676 2:176344947-176344969 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
942497550 2:176555763-176555785 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
942944757 2:181660023-181660045 GCAGCAGTCCCCAACCTTTTTGG + Intronic
943244697 2:185431544-185431566 GCAGCAGTCCCCAATCTTTTTGG - Intergenic
943256745 2:185603046-185603068 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
943360964 2:186918691-186918713 ACAGCAGTCCCCAACATTTTTGG - Intergenic
943597329 2:189873949-189873971 GCAGCAGTCCCCAAGCTTTTTGG - Intronic
943743026 2:191431552-191431574 GCAGCTGTCCACAACCTTTTTGG - Intergenic
943745161 2:191454644-191454666 GCAGCTGTCCCCAATGTTTTTGG + Intergenic
943768337 2:191687864-191687886 ACAGTGGTCCCCAACCTTTTTGG + Intronic
944775817 2:202963466-202963488 CCAGCAGTCCCCAATATTTTTGG + Intronic
944870936 2:203911287-203911309 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
944896246 2:204168244-204168266 ACAGCCGTTCCCAACCTCTCGGG - Intergenic
944977803 2:205076814-205076836 GCAGTGGTCCCCAATCTTTTTGG - Intronic
945013341 2:205488198-205488220 ACAGTGGTCCCCAACCTTTTTGG + Intronic
945393242 2:209290744-209290766 ACAGCGATCCCCAACCTTTTTGG + Intergenic
945458148 2:210072454-210072476 ACAGCAGTCCCCAACTTTTTTGG + Intronic
945568647 2:211435785-211435807 TCAGCAGTCCCCAACCTTTTTGG - Intronic
946785606 2:223240446-223240468 ACAGCGGTCCCCAAGCTTTTTGG + Intergenic
946867691 2:224057440-224057462 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
947378947 2:229526454-229526476 GCAGCAGTCCCCAACCTTTTTGG + Intronic
947509685 2:230740487-230740509 ACAGCAGACCCCAACCTTTTTGG + Intronic
947829425 2:233128302-233128324 ACAGTGGTCCCCAACCTTTTTGG - Intronic
947922601 2:233891280-233891302 ACAGGAGTGTCCAATCTTTCAGG - Intergenic
947929961 2:233956227-233956249 ACAGCAGTCACCAATCTTTTTGG - Intronic
948152719 2:235756928-235756950 GCAGCAGTCCCCAACCTTTTTGG - Intronic
948165404 2:235857388-235857410 ACAGCGGCCCCCAACCTTTTTGG - Intronic
948242266 2:236447421-236447443 ACAGTGGCCCCCAACCTTTCTGG - Intronic
948306586 2:236952665-236952687 GCAGCAGTCCCCAAGCTTTTTGG - Intergenic
948394881 2:237637984-237638006 ACAGCAGCCCCCAATCTTTTTGG + Intronic
948539790 2:238682475-238682497 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
948998645 2:241598468-241598490 ACAGCAGTCCCCAAACTTTTTGG + Intronic
1168909339 20:1434383-1434405 GCAGCAGTCCCCAATCTTTTTGG - Intergenic
1168926613 20:1586809-1586831 GCAGTGGTCCCCAATCTTTTTGG - Intronic
1169096657 20:2905261-2905283 TCAGCGGTCTCCAATCTTTTTGG - Intronic
1169417011 20:5425932-5425954 GCAGTGGTCCCCAATCTTTTTGG + Intergenic
1169555354 20:6743794-6743816 ACAGCGGTTCCCAATCTTTTTGG + Intergenic
1169812554 20:9622839-9622861 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1170135492 20:13069348-13069370 ACAGCAGTCCCCGATCTTTTTGG + Intronic
1170195912 20:13689291-13689313 CCAGCGGTCCCCAATCTTTCTGG - Intergenic
1170670273 20:18426349-18426371 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1171218619 20:23373176-23373198 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1172280447 20:33704008-33704030 GCAGCAGTCCCCAACCTTTTTGG + Exonic
1172575496 20:36005171-36005193 TCAGCGGTCCCCAAACTTTTTGG + Intronic
1172801295 20:37578094-37578116 ACAGTGGTCCCCAATCTTTGTGG - Intergenic
1173206290 20:40996974-40996996 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1173466621 20:43288035-43288057 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1173615145 20:44398361-44398383 ACAGCTGCCCAGAATCTTTGTGG - Intronic
1173833556 20:46109451-46109473 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1174142811 20:48428405-48428427 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1174389861 20:50212286-50212308 ACTGCTGTCCTCCATATTTCTGG + Intergenic
1174427922 20:50446366-50446388 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
1174455871 20:50648450-50648472 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1174564052 20:51452052-51452074 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1174635525 20:51996219-51996241 GCAGCAGTCCCCAATGTTTTTGG + Intergenic
1174714863 20:52746835-52746857 GCAGCAGTCCCCAATCTTTTTGG - Intergenic
1174957991 20:55122666-55122688 TCAGCAGTCCCCAACCTTTATGG + Intergenic
1175023517 20:55876828-55876850 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
1175056357 20:56202274-56202296 ACAGCTGTGCCCATTCTTTCAGG + Intergenic
1175142881 20:56873761-56873783 CCAGCGGTCCCCAACCTTTGTGG + Intergenic
1175142889 20:56873785-56873807 CCAGCGGTCCCCAACCTTTGTGG + Intergenic
1175211731 20:57362155-57362177 GCAGCGGTCCCCAACCTTTGTGG - Intronic
1175504595 20:59472678-59472700 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1175603974 20:60297438-60297460 ACAGCGGTCCCCGACCTTTTTGG + Intergenic
1176774047 21:13114241-13114263 ACAAGTGACACCAATCTTTCTGG + Intergenic
1176945257 21:14972659-14972681 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1177127404 21:17212725-17212747 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1177278097 21:18942147-18942169 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1177319258 21:19498969-19498991 ATAGCAGTCCCCAACCTTTTTGG - Intergenic
1177660053 21:24070958-24070980 GCAGCAGTCCCCAATCGTTTTGG - Intergenic
1177714153 21:24817595-24817617 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1178148692 21:29769369-29769391 ACTGCAGTCCCCAACCTTTTTGG + Intronic
1178296170 21:31412358-31412380 ACAGCAGTCCCCAGCCTTTTTGG + Intronic
1178333881 21:31726690-31726712 ACAGCTGTTCTCAAACTTTTTGG - Intronic
1178380658 21:32104910-32104932 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1178596435 21:33957616-33957638 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1178939534 21:36893506-36893528 ACAACAGTCCCCAACCTTTTTGG + Intronic
1178983469 21:37283962-37283984 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1179058201 21:37955273-37955295 ACAGCAGTCCCCAAACTTTTTGG + Intronic
1179199627 21:39204636-39204658 ATAGCAGTCCCCAAGCTTTCTGG + Intronic
1179442122 21:41402524-41402546 GCAGCGGTCCCCAGTCTTTATGG + Intronic
1179833122 21:44011027-44011049 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1179949411 21:44701340-44701362 ACAGCGGTCCCCAACCTTCATGG + Intronic
1180249432 21:46571313-46571335 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1180521669 22:16213964-16213986 ACAAGTGGCACCAATCTTTCTGG + Intergenic
1180897214 22:19345496-19345518 GCAGCAGTCCCCAACCTTTTCGG + Intronic
1181093498 22:20490578-20490600 TCAGCAGTCCCCAATCTTTTTGG + Intronic
1181624156 22:24111592-24111614 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1181780558 22:25189969-25189991 TCAGCGGTCCCCAACCTTTTTGG + Intronic
1182525949 22:30919362-30919384 ACAGCTGTCCCCAACATTTTTGG - Intergenic
1182580350 22:31305237-31305259 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1182859511 22:33547158-33547180 ACAGCAGTCCCTAACCTTTTTGG + Intronic
1182974510 22:34610414-34610436 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1182979398 22:34654356-34654378 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1183142413 22:35955485-35955507 ACAGTGGTCCCCAATCTTTTTGG + Intronic
1183228303 22:36564963-36564985 ACAGCTGTCCCCGTCCTTTACGG - Intronic
1183337709 22:37260022-37260044 CCAGCGGTCCCCAACCTTTTAGG + Intergenic
1183734867 22:39638733-39638755 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1183756544 22:39772056-39772078 GCAGCAGTCCCCAAGCTTTTTGG + Intronic
1184590773 22:45481448-45481470 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1184634371 22:45814998-45815020 GCAGCAGTCCCCAACCTTTTTGG - Intronic
949378540 3:3417568-3417590 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
949475534 3:4441526-4441548 TCAGCAGTCCCCAACCTTTTTGG - Intronic
949514031 3:4791282-4791304 GCAGCGGTCCCCAACCTTTAGGG + Intronic
949919293 3:8988672-8988694 GCAGCAGTCCCCAACCTTTTTGG + Intronic
950001650 3:9661212-9661234 ACAGCACTCCCCAACCTTTTTGG + Intronic
950219013 3:11180258-11180280 CCAGCAGTCCCCAACCTTTTTGG + Intronic
950294911 3:11821108-11821130 GCAGCAGTCCCCAAACTTTCTGG + Intronic
950374870 3:12563033-12563055 TCAGCAGTCCCCAATCTTTTTGG - Intronic
950758393 3:15197682-15197704 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
950969200 3:17169783-17169805 GCAGCAGTCCCCAACCTTTTTGG + Intronic
950992821 3:17459193-17459215 GCAGCGGTCCTCAATCTTTTTGG + Intronic
951207756 3:19942432-19942454 GCAGCTGTCCCCAACCTTTTTGG + Intronic
951242317 3:20301507-20301529 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
951493898 3:23303418-23303440 TCAGCGGTCCCCAACCTTTCTGG - Intronic
951628208 3:24689930-24689952 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
952210272 3:31223088-31223110 TCAGTGGTCCCCAAACTTTCTGG + Intergenic
952267270 3:31798839-31798861 GCAGCAATCCCCAATCTTTTTGG + Intronic
952352013 3:32548443-32548465 ACAGCAGTCCCCAGTCTTTTTGG - Intronic
952796202 3:37241697-37241719 GCAGTGGTCCCCAATCTTTTGGG + Intergenic
953123666 3:40070764-40070786 GCAGCAGTCCCCAGCCTTTCTGG - Intronic
953227408 3:41033393-41033415 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
953309870 3:41866332-41866354 GCAGCAGTCCCCAACCTTTTTGG + Intronic
953531783 3:43746102-43746124 ACAGCGGTCCCCATCCTTTTTGG + Intergenic
953678571 3:45022366-45022388 ACAGCAGTCCCCAACCTTTTTGG + Intronic
953748390 3:45592369-45592391 GCAGCGGTCCTCAATCTTTTTGG + Intronic
953872548 3:46639901-46639923 GCAGCTGTCCCCAATCTTTTTGG + Intergenic
954174186 3:48830559-48830581 ACAACAGTCCCCAACCTTTTTGG + Intronic
954513125 3:51145750-51145772 ACAGCACTCCCCAATGTTTTTGG + Intronic
954731425 3:52665797-52665819 ACAGTGGTCCCCAAGCTTTTTGG - Intronic
954920594 3:54187612-54187634 GCAGCAGTCCCCAACCTTTATGG + Intronic
954941611 3:54378157-54378179 TCAGCGGTCCCCAACCTTTTTGG + Intronic
955123254 3:56083037-56083059 TCAGCAGTCCCCAACCTTTTTGG - Intronic
955342295 3:58134376-58134398 GCAGCGGTCCCCAACCTTTTTGG - Intronic
955623941 3:60896224-60896246 ACAGTGGTCCCCAACCTTTTTGG - Intronic
955728564 3:61959331-61959353 CCAGCGGTCCCCAACCTTTTTGG + Intronic
955905514 3:63803714-63803736 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
955919607 3:63941564-63941586 GCAGCAGTCCCCAACCTTTCTGG - Intronic
956092487 3:65682852-65682874 ACAGCGGTCCCCAAACTTTTTGG + Intronic
956153177 3:66264724-66264746 CCAGCGGTCCCCAACCTTTTTGG - Intronic
956376222 3:68616167-68616189 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
956390639 3:68769476-68769498 ACAGTGGTCCCCAACCTTTTTGG - Intronic
956733947 3:72222208-72222230 CTAGCGGTCCCCAATCTTTTTGG + Intergenic
956917792 3:73891444-73891466 ACAGCAGTTCTCAATCTTTTTGG + Intergenic
956959129 3:74376746-74376768 TCAGCAGTCCCCAAACTTTTTGG - Intronic
957369942 3:79280627-79280649 CCAGCGGTCCCCAACCTTTTTGG + Intronic
957482079 3:80811073-80811095 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
957709592 3:83838696-83838718 ACAGCAGTCCCCAACCTTTCTGG - Intergenic
957856159 3:85881745-85881767 TCAGCGGTCCCCAACCTTTTTGG + Intronic
958189176 3:90162584-90162606 CCAGCAGTCCCCAAACTTTTTGG + Intergenic
958261505 3:91386542-91386564 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
958411488 3:93822216-93822238 CCAGCAGTCCCCAAACTTTTGGG + Intergenic
958500038 3:94893891-94893913 ATAGCTGTCCTCAAGCTTTGTGG + Intergenic
958849575 3:99307719-99307741 TCAGCAGTCCACAATCTTTTTGG - Intergenic
958898948 3:99863050-99863072 GCAGCGGTCCCCAACCTTTTTGG + Intronic
959033622 3:101333848-101333870 GCAGCAGTCCCCAACCTTTTTGG + Intronic
959040894 3:101422308-101422330 GCAGCAGTCCCCAACCTTTTTGG - Intronic
959045064 3:101464803-101464825 CCAGCGGTCCCCAACCTTTTTGG - Intronic
959270750 3:104206997-104207019 GCAGCAGTCTCCAATCTTTTTGG - Intergenic
959386423 3:105714219-105714241 GCAGCAGTCCCCAACCTTTTTGG + Intronic
959558367 3:107749979-107750001 AGAGCTGTCCCCAGTGCTTCAGG - Intronic
959644132 3:108678405-108678427 GCAGCGGTCCCCAATCTTTTCGG - Intronic
959775963 3:110163091-110163113 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
959856197 3:111161745-111161767 ACAGTAGTCACCAATCTTTTTGG - Intronic
960053653 3:113260970-113260992 ACAGTGGTCCCCAACCTTTTTGG - Intronic
960457855 3:117895334-117895356 ACAGCTATCCTCATTCTTTGGGG + Intergenic
960728862 3:120702206-120702228 ACAACAGTCCCCAACCTTTTTGG + Intronic
960879665 3:122331838-122331860 CCAGCTGTCCCCAACCTTTTTGG + Intronic
960908935 3:122629518-122629540 ACAGTGGTCCCCAAACTTTTTGG + Intronic
960976962 3:123184973-123184995 ACAGTGGTCCCCAACCTTTTTGG + Intronic
961137008 3:124520620-124520642 TCAGTGGTCCCCAACCTTTCTGG - Intronic
961580801 3:127880451-127880473 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
961842059 3:129722458-129722480 CCAGCAGTCCCCAACCTTTTTGG - Intronic
962053252 3:131841682-131841704 TCAGCTGTCTCCAACCTTTTTGG - Intronic
962087708 3:132209198-132209220 GCAGCAGTCCCCAACCTTTAAGG - Intronic
962468854 3:135687248-135687270 GCAGCTGTCCCAAACCTTTTAGG - Intergenic
962505161 3:136039407-136039429 GCAGCGGTCCCCAACCTTTTTGG + Intronic
962549353 3:136473406-136473428 ACAGCAGTCCCCAACCTTTTTGG - Intronic
962802948 3:138905821-138905843 GCAGCAGTCCTCAACCTTTCTGG + Intergenic
962842648 3:139249876-139249898 ACAGCAGTCCCCAACCTTTTTGG - Intronic
962857669 3:139363519-139363541 ACAGTGGTCCCCAACCTTTTTGG - Intronic
963200753 3:142583657-142583679 CCAGCTGTCCTCAACCTTTTTGG + Intergenic
963215363 3:142740159-142740181 ACAGCGGTCTCCAACCTTTTTGG - Intronic
963536732 3:146538941-146538963 ACAGTGGTCCCCAACCTTTTTGG + Intronic
963676360 3:148316472-148316494 ACAGCGGTCCCCAAACTTTTTGG + Intergenic
964051257 3:152396383-152396405 ACAGTGGTCCCCAACCTTTTTGG - Intronic
964451869 3:156821151-156821173 ACAGCTTTCACTAATATTTCTGG - Intergenic
964454137 3:156842151-156842173 TCAGCAGTCCCCAATTTTTTTGG - Intronic
964995570 3:162874836-162874858 ACAGCAGTCCCCAACTTTTTTGG - Intergenic
965304895 3:167051845-167051867 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
965569845 3:170161356-170161378 CCAGTGGTCCCCAAACTTTCTGG + Intronic
965724878 3:171704771-171704793 GCAGCAGTCCCCAACCTTTTTGG + Intronic
965769621 3:172167940-172167962 ACAGTGGTCCCCAACCTTTTTGG - Intronic
965791829 3:172396830-172396852 TCAGCGGTCCCCAACCTTTTGGG - Intronic
966090100 3:176123245-176123267 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
966158711 3:176945908-176945930 CCAGCAGTCCCCAAACTTTTGGG - Intergenic
966533671 3:181007847-181007869 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
966563700 3:181352176-181352198 ACAGCGGTCCCCAACCTTTTTGG + Intergenic
966687511 3:182711950-182711972 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
966790819 3:183667665-183667687 GCAGCAGTCCCCAACCTTTTTGG - Intronic
966802172 3:183774481-183774503 CCAGCTGTCCCCAAGCTTTGTGG - Intronic
966991572 3:185236447-185236469 TCAGCTGTCCTCAACCTTTTTGG - Intronic
967250867 3:187536787-187536809 TCAGCAGTCCCCAACCTTTGTGG + Intergenic
967589372 3:191255000-191255022 TCAGCTGTCCCCAGGCTTTTCGG + Intronic
967658939 3:192081739-192081761 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
967901852 3:194462613-194462635 ACAGTGGTCCCCAACCTTTTTGG - Intronic
968182327 3:196605174-196605196 GCAGCGGTCCCCAACCTTTCTGG - Intergenic
968257155 3:197286281-197286303 ACAGCGGTCTCCAACCTTTTTGG + Intronic
969055523 4:4399689-4399711 ATAGCGGTCCCCAACCTTTTTGG + Intronic
969695750 4:8733348-8733370 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
969697383 4:8742291-8742313 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
969745564 4:9068484-9068506 AAAGCTGTCCCCAGTGTTACAGG - Intergenic
970038687 4:11770932-11770954 ACAGTGGACCCCAATCTTTTTGG - Intergenic
970690383 4:18612915-18612937 GCAGCAGTCCCCAAACTTTCTGG + Intergenic
970809724 4:20078558-20078580 ACAGCAGTCCCCAGCCTTTTTGG + Intergenic
970869036 4:20793553-20793575 GCAGCAGTCCCCAACCTTTGTGG + Intronic
970905501 4:21211611-21211633 GCAGCAGTTCCCAATCTTTTTGG - Intronic
971211171 4:24618125-24618147 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
971364059 4:25962415-25962437 GCAGCAGTCCCCAATCTTTTTGG + Intergenic
972419856 4:38877117-38877139 CCAGCAGTCCCCAACCTTTTTGG + Intronic
972427236 4:38944879-38944901 CCAGTGGTCCCCAACCTTTCTGG - Exonic
972498586 4:39656909-39656931 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
972600735 4:40570094-40570116 GCAGCGGTCCCCAACCTTTTTGG + Intronic
972660429 4:41110772-41110794 GCAGCGGTCCCCAACCTTTTTGG + Intronic
972667772 4:41183759-41183781 CCAGTTGTCCCCAACCTTTTTGG + Intronic
972675073 4:41252266-41252288 ACAGCGGTCCCCAGCCTTTTTGG + Intergenic
972923158 4:43968499-43968521 GCAGCCGTCCTCAACCTTTCTGG - Intergenic
972975732 4:44633210-44633232 ACAGCAGTCCCCAACCTTTTTGG - Intronic
973079584 4:45972895-45972917 GCAGCAGTCCCCAAACTTTTTGG + Intergenic
973272077 4:48271570-48271592 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
973279771 4:48347212-48347234 ACAGCAGTCCGCAACCTTTTTGG + Intronic
973577337 4:52303258-52303280 AAAGTTGTCCCAAATATTTCAGG - Intergenic
973611997 4:52644697-52644719 ATAGCGGTCCCCAAACTTTTTGG - Intronic
973990646 4:56403533-56403555 GCAGCAGTCCCCAACCTTTTTGG + Intronic
974091008 4:57311557-57311579 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
974142697 4:57908281-57908303 ACAGCGGTCCCCAACCTTTTTGG + Intergenic
974227941 4:59072716-59072738 ACAGCAGTCCCCAATCATTTTGG + Intergenic
974356883 4:60824239-60824261 GCAGCAGTCCCCAAACTTTTTGG - Intergenic
974619327 4:64335597-64335619 GCAGCAGTCCCCAACCTTTTTGG - Intronic
974824122 4:67104806-67104828 GCAGCAGTCCCCAATCTTTTTGG + Intergenic
975343813 4:73271513-73271535 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
975477951 4:74844391-74844413 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
975540474 4:75505005-75505027 GCAGCGGTCACCAACCTTTCTGG + Intronic
975646965 4:76555226-76555248 AGAGCAGTCCCCAAACTTTTTGG - Intronic
975823067 4:78291215-78291237 GCAGCAGTCCCCAACCTTTTTGG + Intronic
975932146 4:79537935-79537957 ACAGCAGTCCCCAACATTTTTGG - Intergenic
976579897 4:86723517-86723539 GCAGCGGTCCCCGATCTTTTTGG - Intronic
976674608 4:87690612-87690634 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
976705581 4:88015892-88015914 TCAGCAGTCCCCAACCTTTTTGG + Intronic
976869045 4:89768529-89768551 GCAGCAGTCCCCAACCTTTCTGG + Intronic
977027053 4:91833082-91833104 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
977282913 4:95064540-95064562 ACAGCAGTCCTCAGTCTTTGCGG - Intronic
977306026 4:95324552-95324574 ACAACAGTCCCCAACCTTTTTGG - Intronic
977408675 4:96633195-96633217 GCAGTGGTCCCCAGTCTTTCTGG - Intergenic
977685091 4:99838450-99838472 ACAGTGGTCCCCAACCTTTTTGG + Intronic
977717085 4:100195061-100195083 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
977910099 4:102524460-102524482 GCAGCAGTCCCCAACCTTTTTGG + Intronic
977923596 4:102672902-102672924 ACAGCAGTCCCAAACCTTTTTGG - Intronic
977955257 4:103019074-103019096 CCAGCAGTCCCCAACCTTTTTGG - Intronic
978222497 4:106293583-106293605 CCAGCAGTCCCCAAACTTTTTGG - Intronic
978291929 4:107152138-107152160 TCAGTGGTCCCCAACCTTTCTGG + Intronic
978419401 4:108514242-108514264 ACAGCAGTCCCCAGCCTTTTTGG + Intergenic
978479715 4:109175124-109175146 ACAGAGGTCCCCAACCTTTTTGG - Intronic
978952069 4:114572756-114572778 CCAGCTGTCCCCAACCTTTTTGG - Intergenic
979230785 4:118346910-118346932 ACACCAGTCCCCAACCTTTTTGG - Intronic
979309178 4:119182466-119182488 ACAATGGTCCCCAACCTTTCTGG + Intronic
979464054 4:121016362-121016384 ACAGCGGTCCCCAACCTTTTTGG + Intergenic
979542294 4:121898572-121898594 ACAGTGGTCCCCAACCTTTTTGG - Intronic
979636572 4:122961926-122961948 TCAGTGGTCCCCAACCTTTCTGG + Intronic
979685106 4:123503509-123503531 CCAGCAGTCCCTAATCTTTTTGG + Intergenic
979835830 4:125366120-125366142 TCAGCAGTCCCCAACCTTTTTGG - Intronic
979971335 4:127139677-127139699 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
980021163 4:127711793-127711815 CCAGCAGTCCCCAACCTTTCTGG - Intronic
980066947 4:128200188-128200210 TCAGCAGTCCTCAATCTTTTTGG + Intronic
980164858 4:129213452-129213474 GCAGCAGTCCCCAGTCTTTTTGG - Intergenic
980508314 4:133752615-133752637 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
980627282 4:135390206-135390228 CCAGTTGTCCCCAACCTTTTTGG + Intergenic
980822846 4:138039030-138039052 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
981000160 4:139821536-139821558 ACAGTGGTCCCCAACCTTTTTGG - Intronic
981091477 4:140736935-140736957 TCAGCAGTCTCCAATCTTTTTGG + Intronic
981164582 4:141542340-141542362 ACAGCGGTCCTCAACCTTTTTGG + Intergenic
981207109 4:142055749-142055771 ACAGCAGTCCCCACACTTTTTGG + Intronic
981357627 4:143808604-143808626 GCAGCGGTCCCCAAGCTTTTTGG + Intergenic
981369092 4:143938157-143938179 GCAGCGGTCCCCAAGCTTTTTGG + Intergenic
981378834 4:144048092-144048114 GCAGCGGTCCCCAAGCTTTATGG + Intergenic
981492431 4:145353720-145353742 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
981520022 4:145651726-145651748 ACAGTGGTCCCCAACCTTTTTGG + Intronic
981691110 4:147509987-147510009 TCAGCGGTCCCCAACCTTTTTGG - Intronic
981721832 4:147809654-147809676 CCAGCGGTCCCCAACCTTTTCGG + Intronic
981755934 4:148141928-148141950 GCAGCGGTCCCCAACCTTTTGGG - Intronic
981979995 4:150780744-150780766 CCAGCAGTCCCCAACCTTTTTGG + Intronic
981990403 4:150912668-150912690 GCAGCAGTCCCCAACCTTTTTGG - Intronic
981997015 4:150986169-150986191 ATAGCAGTCCCCAACCTTTATGG + Intronic
982023952 4:151233369-151233391 GCAGCGGTCCCCAACCTTTTTGG - Intronic
982079909 4:151779030-151779052 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
982727929 4:158925446-158925468 TCAGCAGTCCCCAACCTTTTTGG + Intronic
982782625 4:159507055-159507077 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
983248101 4:165311906-165311928 ACAGCAGTCCCCAACCTTTTTGG + Intronic
983251801 4:165354191-165354213 CCAGTGGTCCCCAATCTTTTTGG + Intergenic
983354094 4:166633038-166633060 TCAGCAGTCCCCAATCTTTTTGG + Intergenic
983375492 4:166922201-166922223 GCAGCGGTCCCCAATCTTTTTGG - Intronic
983479914 4:168260466-168260488 GCAGCAGTCCCCAACCTTTGTGG + Intronic
983811228 4:172065100-172065122 TCAGCAGTCCCCAACCTTTTTGG + Intronic
983813515 4:172094040-172094062 TCAGCGGTCCCCAACCTTTTTGG - Intronic
983923953 4:173376068-173376090 ACAGTGGTCCCCAACCTTTTTGG - Intronic
984179486 4:176464255-176464277 GCAGCGGTCCCCAACCTTTGTGG + Intergenic
984311598 4:178067910-178067932 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
984630946 4:182060270-182060292 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
984736070 4:183109403-183109425 CCAGCAGTCCCCAACCTTTCAGG + Intronic
984772849 4:183453343-183453365 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
984911734 4:184679937-184679959 ACGGCAGTCCCCAACCTTTCTGG - Intronic
985080505 4:186259848-186259870 ACAGAGGTCCCCAACCTTTTTGG + Intergenic
985143872 4:186872684-186872706 ACAGAAGTCCCCAACCTTTTTGG - Intergenic
985358395 4:189145290-189145312 CCCCCTGACCCCAATCTTTCTGG + Intergenic
986198008 5:5555529-5555551 ACAGCAGTCCCCAGCCTTTTTGG - Intergenic
986649476 5:9949205-9949227 TCAGTGGTCCCCAACCTTTCTGG + Intergenic
987046286 5:14112183-14112205 ACAGTGGTCCCCAACCTTTTGGG - Intergenic
987133293 5:14879063-14879085 TCAGCTGTCCCCAATCTTTTTGG - Intergenic
987134990 5:14892052-14892074 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
987230713 5:15890727-15890749 ACAGCGGTCCCCAGCCTTTTCGG - Intronic
987489170 5:18554732-18554754 ACAGTGGTCCCCAATATTTTTGG - Intergenic
987742581 5:21929140-21929162 TCAGCGGTCCCCAACCTTTTTGG + Intronic
988130753 5:27101592-27101614 ACAGCAGTCCCCAATCTTTTTGG - Intronic
988390063 5:30616222-30616244 GCAGCAGTCCCCAACCTTTGTGG - Intergenic
988553358 5:32216520-32216542 GCAGTGGTCCCCAACCTTTCTGG - Intergenic
988666013 5:33328539-33328561 TCAGCTGTCCCCAAGTTTCCTGG - Intergenic
988882325 5:35516870-35516892 GCAGCAGTCCCCAAACTTTATGG - Intergenic
989091770 5:37741412-37741434 CCAGCTGTCTCCAACCTTTTTGG + Intronic
989180309 5:38569655-38569677 GCAGCGGTCCCCAAACTTTCTGG - Intronic
989227496 5:39047178-39047200 ACAGTAGTCCCCAACCTTTTTGG + Intronic
989704812 5:44316277-44316299 CCAGCGGTCCCCAACCTTTTTGG - Intronic
990002497 5:50910475-50910497 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
990397176 5:55394391-55394413 CCAGCAGTCCCCAGTCTTTTTGG + Intronic
990468844 5:56094821-56094843 ACAGCAGTCCCCAACCTTCCTGG + Intergenic
990472447 5:56128622-56128644 ACAGTTGTCACCATTCTTCCTGG - Intronic
990650822 5:57897817-57897839 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
990890757 5:60647155-60647177 GCAGCAGTCCCCAACCTTTTTGG - Intronic
990941738 5:61209134-61209156 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
990970758 5:61502966-61502988 ACAGCAGTCCCCAACCTTTTTGG - Intronic
990972131 5:61519754-61519776 ATAGCAGTCCCCAACCTTTTTGG + Intronic
991084472 5:62635932-62635954 ACTGCAGTCCCCAACCTTTTTGG - Intergenic
991098025 5:62759827-62759849 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
991172654 5:63646559-63646581 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
991575337 5:68097475-68097497 ACAGCAGTCCCCAATCTTCTGGG + Intergenic
991625489 5:68596646-68596668 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
991677809 5:69106001-69106023 ACAGTGGTCCCCAACCTTTTTGG - Intronic
992022540 5:72638737-72638759 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
992285231 5:75228038-75228060 GCAGCGGTCCCCAACCTTTTTGG - Intronic
992474671 5:77089553-77089575 ACAGCAATCCCCAACCTTTTTGG - Intergenic
992485639 5:77191672-77191694 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
992518346 5:77521102-77521124 CCAGCAGTCCCCAACCTTTTTGG + Intronic
992664067 5:78988827-78988849 GCAGCAGTCACCAACCTTTCTGG + Intergenic
992685400 5:79194539-79194561 CCAGCGGTCCCCAAACTTTTTGG - Intronic
993037252 5:82771372-82771394 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
993077181 5:83247483-83247505 ACAACAGTCCCCAACCTTTTTGG - Intronic
993179026 5:84524779-84524801 ACACATGTCCCCAAACTTACTGG - Intergenic
993313496 5:86369163-86369185 ACAGCTTTCCCCAACTTTCCTGG + Intergenic
993467312 5:88265266-88265288 ACAGCAGTCCCCAACCTTTTTGG + Intronic
993558102 5:89367133-89367155 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
993861599 5:93143436-93143458 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
993913103 5:93708394-93708416 TCAGCAGTCCCCAACCTTTTTGG + Intronic
993938917 5:94035067-94035089 ACAGCAGTTCCCAACCTTTTTGG - Intronic
994197972 5:96940853-96940875 GCAGCAGTCCCCAAACTTTTCGG + Intronic
994453496 5:99974392-99974414 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
995305277 5:110639744-110639766 CCAGCAGTCCCCAACCTTTTTGG + Intronic
995354443 5:111222766-111222788 CCAGCGGTCCCCAACCTTTTCGG - Intergenic
995390451 5:111634795-111634817 ACAGCAGTCCCTAACCTTTTTGG - Intergenic
995492947 5:112711388-112711410 GCAGCAGTCCCCAACCTTTTTGG - Intronic
995627864 5:114098661-114098683 CCAGCGGTCCCCAACCTTTTTGG - Intergenic
995911753 5:117196241-117196263 GCAGTGGTCCCCAACCTTTCTGG + Intergenic
996049890 5:118920119-118920141 CCAGCAGTCCCCAGTCTTTTTGG - Intronic
996529113 5:124508939-124508961 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
996557726 5:124796362-124796384 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
996585184 5:125079604-125079626 GCAGCAGTCCCCAACCTTTCTGG - Intergenic
996619100 5:125478513-125478535 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
996628844 5:125603326-125603348 GCAGCGGTTCCCAAGCTTTCTGG - Intergenic
996713767 5:126569320-126569342 ATAGCGGTCCCCAACCTTTCTGG - Intronic
996808679 5:127488815-127488837 ACAGCGGTCCCCAACCCTTTTGG + Intergenic
996861584 5:128073168-128073190 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
996869234 5:128168435-128168457 GCAGCAGTCCCCAACCTTTTTGG + Intronic
997236736 5:132276456-132276478 ACAGCAGTCCCCAACCTTTTCGG - Intronic
997272650 5:132554886-132554908 ACAGTGGTCCCCAACCTTTTTGG + Intronic
997498919 5:134355911-134355933 ACAGCAGTCTCCAACCTTTTTGG + Intronic
997689342 5:135815145-135815167 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
997715630 5:136040600-136040622 ACAGCGGTCCCCAACCTTTTTGG - Intronic
998008053 5:138670635-138670657 ACAGCGGTCCCCAACTTTTTTGG + Intronic
998069978 5:139189943-139189965 ACAGCAGTCCCCAACCTTTTTGG - Intronic
998814884 5:146002958-146002980 ACAGCGGTACCCAACCTTTTTGG - Intronic
999512862 5:152270869-152270891 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
999571540 5:152925202-152925224 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1000011836 5:157240477-157240499 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1000224795 5:159250195-159250217 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1000771284 5:165358025-165358047 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1000857047 5:166412064-166412086 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1000957348 5:167558851-167558873 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1001350241 5:170955172-170955194 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1001854638 5:175000261-175000283 ACAGCAGTCCCTAACCTTTTTGG + Intergenic
1001894506 5:175366827-175366849 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1002395087 5:178946397-178946419 TCAGCTGCCCCCACTCTTCCTGG - Exonic
1002779196 6:353511-353533 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1003344903 6:5257823-5257845 ACAGCTATCCCCAACCTTCTTGG - Intronic
1003486428 6:6584097-6584119 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1003560018 6:7172542-7172564 CCAGCTCTCCCCAATCTCTTAGG + Intronic
1003905548 6:10696132-10696154 ACAGCTGACCCCAAAATGTCAGG + Intronic
1003948445 6:11096128-11096150 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1004157890 6:13186708-13186730 GCAGCTGTCCTCAACCTTTCTGG + Intronic
1004165039 6:13249417-13249439 CCAGCTGTCCCCAACCTTTTTGG - Intronic
1004177068 6:13349279-13349301 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1004178787 6:13363766-13363788 ACAGCTCTCCCCAGTCTTTGGGG + Exonic
1004327210 6:14686292-14686314 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1004501026 6:16210345-16210367 TTAGCAGTCCCCAACCTTTCTGG + Intergenic
1004597451 6:17113987-17114009 ACAGCAGTCACCAACCTTTTTGG + Intronic
1004599317 6:17132479-17132501 ACAGAGGTCCCCAACCTTTTTGG - Intergenic
1004699508 6:18065690-18065712 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1004834763 6:19517746-19517768 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1004897341 6:20161486-20161508 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1005051298 6:21686281-21686303 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1005387928 6:25304368-25304390 ACAGCCGTCCCCAACCTTTTTGG + Intronic
1005527590 6:26666426-26666448 ACAGCAGTCCCCAATCTTGTGGG + Intergenic
1005588773 6:27303177-27303199 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1005673649 6:28132466-28132488 TGAGCAGTCCCCAACCTTTCTGG + Intergenic
1006512807 6:34530733-34530755 GCAGCCGTCCCCAATCTTTTTGG + Intronic
1006686195 6:35836339-35836361 GCAGCGGTCCCCAATCTTTTTGG - Intronic
1006726010 6:36199395-36199417 ACAGCAGTCCCCAGCCTTTTTGG - Intronic
1007066991 6:39000841-39000863 ACAGCGGTTCCCAACCTTTTTGG - Intronic
1007141958 6:39585151-39585173 ACAACAGTCCCCAACCTTTTTGG + Intronic
1007344129 6:41215588-41215610 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1007401931 6:41607659-41607681 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1007420959 6:41719426-41719448 CCAGCGGTCCCCAACCTTTTTGG - Intronic
1007819152 6:44547749-44547771 AGAGCTGTCCCCAATCTTTTTGG - Intergenic
1008686215 6:53928845-53928867 GCAGCTGTTCCAAATCTTTTTGG - Intergenic
1008744131 6:54647716-54647738 ACAGCGGTACCCAAACTTTTTGG - Intergenic
1008907971 6:56700289-56700311 ACAGCAGTCCCCAACCTTTCTGG - Intronic
1008993659 6:57633605-57633627 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1009052185 6:58289603-58289625 TCAGTGGTCCCCAATCTTTTTGG + Intergenic
1009182265 6:60532690-60532712 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1009513457 6:64582454-64582476 TCAGCAGTCCCCAAAATTTCTGG - Intronic
1009517821 6:64641975-64641997 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1010632190 6:78210735-78210757 GCAGCAGTCCCCAATCTTTTTGG - Intergenic
1010740328 6:79495303-79495325 ACAGCGGTCCCCAACCTTTTTGG - Intronic
1011035893 6:82974276-82974298 GCAGCAGTCCCCAACCTTTTCGG - Intronic
1011637584 6:89388605-89388627 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1011656675 6:89558120-89558142 ACAGCAGTCCTCAAACTTTTTGG - Intronic
1012046454 6:94281613-94281635 ACAACGGTCCCCAACCTTTTTGG + Intergenic
1012132730 6:95517665-95517687 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1012152228 6:95769002-95769024 ACAGCGGTCCCCATCCTTTTTGG - Intergenic
1012214971 6:96571914-96571936 ACAGCTGTCCTCCACCATTCTGG - Intronic
1012433943 6:99194629-99194651 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1012534125 6:100275397-100275419 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1012614579 6:101261015-101261037 TCAGTGGTCCCCAATCTTTTTGG - Intergenic
1012973451 6:105755388-105755410 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1012979883 6:105818158-105818180 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1013320611 6:108984215-108984237 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1013331513 6:109106251-109106273 TCAGTGGTCCCCAATCTTTTTGG - Intronic
1013385501 6:109625731-109625753 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1013547596 6:111173944-111173966 ACAGGAATCCCCAATCTTTTTGG - Intronic
1013594667 6:111649829-111649851 CCAGCTGTCCCCAACCTTTTTGG + Intergenic
1014010425 6:116469363-116469385 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1014108913 6:117598474-117598496 ACAGCGGTCACCAATGTTTTTGG + Intronic
1014147113 6:118011063-118011085 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1014151483 6:118061675-118061697 CCAGCAGTCCCCAACCTTTGTGG + Intronic
1014449123 6:121562954-121562976 ACTGCTGTACCCAAGTTTTCAGG - Intergenic
1014747493 6:125217159-125217181 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1014830801 6:126100651-126100673 ACAGCAGGCCCCAACCTTTTCGG + Intergenic
1015074125 6:129134483-129134505 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1015201182 6:130583244-130583266 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1015392859 6:132702412-132702434 TCAGCTGTCCCCAACGTTTTTGG - Intronic
1015652788 6:135481031-135481053 CCAGCCGTCCCCAACCTTTTTGG - Intronic
1015973846 6:138769575-138769597 GCAACAGTCCCCAATCTTTTTGG + Intronic
1016203245 6:141439358-141439380 TCAGTGGTCCCCAATCTTTTTGG - Intergenic
1016322441 6:142860339-142860361 ACAGTGGTCCCCAACCTTTTGGG + Intronic
1016666964 6:146653401-146653423 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1016756970 6:147697900-147697922 GCAGCTGTCCCCAACCTTTTTGG + Intronic
1017230609 6:152069511-152069533 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1017256175 6:152336376-152336398 GCAGCGGTCCCCAAACTTTTTGG + Intronic
1017318216 6:153057533-153057555 CCAGCGGTCCCCAACTTTTCTGG + Intronic
1017375352 6:153761817-153761839 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1017735534 6:157359612-157359634 ACAGCGGTCCCCAACCTTTTTGG + Intergenic
1017804370 6:157930771-157930793 GCAACGGTCCCCAACCTTTCTGG - Intronic
1017969467 6:159299231-159299253 CCAGCGGTGCCCAACCTTTCTGG - Intergenic
1018421818 6:163646749-163646771 ACATCTGACGCCACTCTTTCTGG - Intergenic
1018554949 6:165039591-165039613 ACAGCGGTCCCCAACCTTTCTGG + Intergenic
1018741854 6:166735356-166735378 GCAGCAGTCCCCAATCTTTTTGG + Intronic
1018834381 6:167471980-167472002 ACAGTAGTCCCCAATCTTTTTGG + Intergenic
1019048233 6:169163955-169163977 TCAGCAGTCCCCAAACTTTATGG + Intergenic
1019133632 6:169894887-169894909 ACAGCAGGCCCCAACCTTTTTGG - Intergenic
1019834055 7:3363527-3363549 ACAGCGGCCCCCAACCTTTTTGG + Intronic
1019881169 7:3862762-3862784 GCAGCCGTCCCCAACCTTTTTGG + Intronic
1019893827 7:3967568-3967590 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1019979750 7:4612812-4612834 ACAGCAGTCCCTAAGCTTTTTGG - Intergenic
1020151682 7:5686728-5686750 ACAGCGGTCCCCAACATTTTTGG + Intronic
1020583797 7:10039151-10039173 ACATCTGTACACATTCTTTCAGG - Intergenic
1020780272 7:12509107-12509129 TCAGCAGTCCCCAATCTTTTTGG - Intergenic
1020848307 7:13315871-13315893 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1020964972 7:14854375-14854397 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1021006427 7:15399846-15399868 AAAGCTGTTCACATTCTTTCTGG + Intronic
1021040139 7:15851492-15851514 ACAGCAGTCCCCAGCCTTTTTGG - Intergenic
1021090151 7:16473529-16473551 ACAGCAGTCCCCAATCTTTTTGG - Intronic
1021157050 7:17222977-17222999 AGAGCTGTTCACATTCTTTCTGG - Intergenic
1021205034 7:17769706-17769728 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1021284255 7:18759692-18759714 ACAGCGGTTTCCAATCTTTTTGG - Intronic
1021347099 7:19542141-19542163 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1021372901 7:19872015-19872037 GCAGCAGTCCCCAAACTTTTTGG - Intergenic
1021448739 7:20761084-20761106 ACAGCAGTCCCTAACCTTTTTGG - Intronic
1021461195 7:20888787-20888809 CCAGTGGTCCCCAACCTTTCTGG - Intergenic
1021478208 7:21086490-21086512 GCAGTTGTCCCCAACCTTTTTGG - Intergenic
1021560269 7:21962472-21962494 GCAGCAGTCCCCAACCTTTGTGG + Intergenic
1021590351 7:22254654-22254676 AGAGCAGTCCTCAACCTTTCTGG + Intronic
1021669435 7:23020568-23020590 ACACCTGTCCCCAAGCATACAGG + Intergenic
1021877641 7:25063557-25063579 GCAGCGGTCCCCAAACTTTTTGG - Intergenic
1021885257 7:25131447-25131469 CCAGCAGTCCACAACCTTTCTGG - Intergenic
1022001275 7:26228709-26228731 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1022049868 7:26656023-26656045 ACATCTGTCCCCTGTCTTTGGGG - Intergenic
1022204897 7:28154095-28154117 ACAGCAGTCCCCAAAACTTCGGG - Intronic
1022367038 7:29731485-29731507 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1022539796 7:31125085-31125107 GCAGCGGTTCCCAATCTTTTTGG + Intergenic
1022566034 7:31402618-31402640 ACAACAGTCCCCAACCTTTTTGG - Intergenic
1022584403 7:31592484-31592506 ACAGCCTTCCCCAACCTTTTTGG + Intronic
1023200628 7:37693656-37693678 ACAGCTGTGCCCCACCATTCTGG - Intronic
1023310287 7:38879530-38879552 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1023491031 7:40742340-40742362 TCAGCTGTCCCCAATCTTTTTGG + Intronic
1023591048 7:41780791-41780813 GCAGCTGTCCCCAACTTTTTTGG - Intergenic
1023729099 7:43173447-43173469 GCAGCAGTCCCCAATATTTTGGG + Intronic
1023742609 7:43294091-43294113 GCAGCGGTCCCCAAACTTTTTGG - Intronic
1024127198 7:46311680-46311702 ACAGCAATCCCCAACCTTTTTGG + Intergenic
1025137180 7:56428205-56428227 CCAGCTGTCCCCGGTCTTTTTGG + Intergenic
1025185852 7:56857807-56857829 GCAGCGGTCCCCAATTTTTTTGG + Intergenic
1025686074 7:63719134-63719156 GCAGCGGTCCCCAATTTTTTTGG - Intergenic
1026106149 7:67422377-67422399 ACAGCGGTCCCCAAACTTTCTGG + Intergenic
1026152269 7:67798250-67798272 ACAGTGGTCCCCAACCTTTGGGG + Intergenic
1026209930 7:68295080-68295102 GCAGAGGTCCCCAATCTTTTTGG + Intergenic
1026225252 7:68434677-68434699 ACAGCGGCCCCCAACCTTTTTGG + Intergenic
1026260103 7:68747745-68747767 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1026310167 7:69176327-69176349 ACAACAGTCCCCAACCTTTTTGG - Intergenic
1026314066 7:69212527-69212549 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1026315977 7:69227996-69228018 ACAGCGGTCCTCAAGCTTTTTGG + Intergenic
1026344421 7:69461954-69461976 GCAGCGGTCCCCAACCTTTCTGG - Intergenic
1026533309 7:71219026-71219048 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1026555175 7:71401968-71401990 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1026620492 7:71945918-71945940 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1026634560 7:72069984-72070006 ACATCTGTCCCCAAACTCTATGG + Intronic
1026663386 7:72321934-72321956 CCAGCTGTCCCCAACATTTTTGG + Intronic
1027154624 7:75757871-75757893 ACAGGAGTCCCCAACCTTTTTGG + Intergenic
1027195819 7:76029465-76029487 GCAGCGATCCCCAATCTTTTTGG + Intronic
1027205301 7:76093121-76093143 GCAGCGGTCCCCAATTTTTGGGG + Intergenic
1027655918 7:80930502-80930524 ACAGTGATCCCCAATCTTTTTGG - Intergenic
1027905433 7:84174267-84174289 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1028181836 7:87733563-87733585 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1028348657 7:89816378-89816400 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1028473110 7:91225584-91225606 GCAGCGGTCCCCAAGCTTTTTGG - Intergenic
1028554358 7:92106122-92106144 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1028649679 7:93137664-93137686 ACAGCAGTCCCCAATCTTTTTGG - Intronic
1028768701 7:94589950-94589972 ACAGTGGTCCCCAAGCTTTTTGG - Intronic
1029015660 7:97313184-97313206 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1029019628 7:97350804-97350826 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1029047278 7:97643831-97643853 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1029263880 7:99323952-99323974 TCAGTGGTCCCCAATCTTTTTGG + Intergenic
1029490963 7:100869738-100869760 ATAGCAGTCCCCAATCTTTTTGG + Intronic
1029501859 7:100936012-100936034 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
1029683169 7:102126678-102126700 ACAGCTGTCCCCAACCTTGTTGG + Intronic
1029887719 7:103890620-103890642 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1029954111 7:104619778-104619800 ACAGTAGTCCCCAATCTTTTTGG + Intronic
1029994699 7:104995884-104995906 ACAGCAGTCCCCAACGTTTTTGG - Intergenic
1030115710 7:106060818-106060840 TCTGCGGTCCCCAACCTTTCTGG + Intergenic
1030279013 7:107751063-107751085 GCAGCAGTCCCTAATCTTTTTGG + Intronic
1030282590 7:107792181-107792203 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1030613837 7:111717195-111717217 GCAGCAGTCCCCAACCTTTTAGG - Intergenic
1030771793 7:113484500-113484522 ATAGCTGTCCCTAACCTTTTTGG - Intergenic
1030812379 7:113989897-113989919 GCAGTTGTCCCCAACCTTTTTGG - Intronic
1030845149 7:114400536-114400558 GCAGCGGTCCCCAATCTTTTTGG + Intronic
1031221805 7:118976269-118976291 TCAGCCGTCCCCAACCTTTATGG + Intergenic
1031306101 7:120129698-120129720 ACAGCAGTTCCCAACCTTTTTGG - Intergenic
1031759417 7:125692795-125692817 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1031963906 7:128013534-128013556 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1032073380 7:128823783-128823805 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1032224860 7:130023222-130023244 GCAGCGGTCCCCAACCTTTTTGG - Intronic
1032247199 7:130223005-130223027 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1032343254 7:131095298-131095320 GCAGCAGTCTCCAATCTTTTTGG - Intergenic
1032370182 7:131341585-131341607 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1032446123 7:131985098-131985120 GCAGCAGTCCCCAAACTTTTTGG - Intergenic
1032654769 7:133916036-133916058 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1032698859 7:134361300-134361322 GCAGCGGTCCCCAACCTTTTTGG + Intergenic
1032795566 7:135273524-135273546 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1033335197 7:140446465-140446487 ACAGCAGTCCCCAAACTTTTTGG + Intergenic
1033435924 7:141333690-141333712 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1033479870 7:141728987-141729009 CCAGCGGTCCCCAACCTTTTTGG - Intronic
1033916124 7:146328329-146328351 ACAGTGGTCCCCAAACTTTTTGG - Intronic
1034040984 7:147876456-147876478 ATTGCTGTCCCCATTCTCTCTGG - Intronic
1034107010 7:148498710-148498732 GCAGCGGTCCCCCATCTTTTTGG - Intergenic
1034316340 7:150136844-150136866 GCAGCAGTCCCCAAATTTTCTGG + Intergenic
1034502423 7:151459425-151459447 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1034635162 7:152561362-152561384 CCAGCAGTCCCCAAACTTTTTGG - Intergenic
1034790523 7:153963833-153963855 GCAGCAGTCCCCAAATTTTCTGG - Intronic
1034845514 7:154440823-154440845 CCAGCTGTCCCCAATGTGGCTGG + Intronic
1035112581 7:156495535-156495557 ACAGCAGTCCCCAACCTCTGTGG - Intergenic
1035371660 7:158382997-158383019 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1035986068 8:4433327-4433349 ATAGCAGTCCCCAACCTTTCTGG - Intronic
1036115972 8:5961249-5961271 ACAGCAGTCCCCAACCATTTTGG + Intergenic
1036285248 8:7438818-7438840 GAAGCTGTCCCCAACCTTTTTGG - Intergenic
1036336228 8:7872711-7872733 GAAGCTGTCCCCAACCTTTTTGG + Intergenic
1036402536 8:8423121-8423143 ACAGCTGTCCCCAACTTTTTTGG + Intergenic
1037023081 8:13998278-13998300 ACAGTGGTCCCCAGTCTTTTCGG + Intergenic
1037207743 8:16343803-16343825 GCAGCAGTCCCCAAACTTTTTGG - Intronic
1037254380 8:16936011-16936033 ACAGCAGTCGCCAACCTTTCTGG + Intergenic
1037266950 8:17073674-17073696 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1037311843 8:17564477-17564499 GCAGCGGTCCCCAACCTTTTTGG + Intronic
1037354967 8:18008554-18008576 TTAGCAGTCCCCAACCTTTCTGG - Intronic
1037380990 8:18284861-18284883 ACAGCTGCCAACAATCTTTGAGG - Intergenic
1037514458 8:19616837-19616859 CCAGCGGTCCCCAACCTTTTTGG + Intronic
1037527117 8:19736813-19736835 ACCTCTTTCCCCAATGTTTCTGG - Intronic
1037923287 8:22824433-22824455 ACAGCGCTCCCCAATATTTTTGG + Intronic
1038032959 8:23661041-23661063 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1038166821 8:25093524-25093546 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1038324398 8:26561606-26561628 ACAGCAGTCCCCAACTTTTTTGG + Intronic
1038362445 8:26894428-26894450 ACAGCAGTCTCCAACCTTTTTGG - Intergenic
1038600500 8:28937195-28937217 ACAGATGTCCTAAATCTTTTGGG + Intronic
1038729742 8:30116310-30116332 TCAGCAGTCCCCAATCTTGTTGG + Intronic
1038829086 8:31036933-31036955 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1038898757 8:31818410-31818432 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1039375544 8:37029014-37029036 ACAGTGGTCCCCAAACTTTTTGG - Intergenic
1039437570 8:37570534-37570556 ACAGATGTCACCAATCTGTCAGG - Intergenic
1039604018 8:38866176-38866198 TTAGCAGTCCCCAACCTTTCTGG + Intergenic
1039730633 8:40272468-40272490 ACAGCAGTCCCCAACTTTTTTGG - Intergenic
1039909426 8:41812657-41812679 ATAGCGGTCCCCAAGCTTTTTGG + Intronic
1040010633 8:42658428-42658450 CCAGCGGTCCCCAACCTTTTTGG + Intergenic
1040629812 8:49197229-49197251 GCAGCAGTCCCCAGTCTTTTTGG - Intergenic
1040905257 8:52463316-52463338 ACAGCAGTCCCCAACCTATCTGG + Intergenic
1041028072 8:53707288-53707310 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1041041013 8:53845560-53845582 ACAGCAGTCCCCAACCCTTTTGG - Intergenic
1041224688 8:55686629-55686651 GCAACAGTCCCCAACCTTTCTGG - Intergenic
1041333583 8:56754909-56754931 ATAGCAGTCCTCAATCTTTTTGG + Intergenic
1042159960 8:65882487-65882509 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1042315768 8:67424358-67424380 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1042406242 8:68408453-68408475 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1042461320 8:69072712-69072734 AGAGCAGTCCCCAACCTTTTAGG + Intergenic
1042928503 8:73990716-73990738 ACAGCAGTCCCCAACATTTTTGG - Intergenic
1043308798 8:78832283-78832305 TCAGCTGTCCCCAATCTTTTTGG + Intergenic
1043483541 8:80676668-80676690 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1043517066 8:81004802-81004824 AGAACTGTCCCCAATGTGTCTGG + Intronic
1043935780 8:86140718-86140740 GCAGCAGTCCCCAACCTTTAGGG + Intronic
1043979105 8:86617783-86617805 CCAGCAGTCCCCAGTCTTTTTGG + Intronic
1044365185 8:91336573-91336595 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1044416405 8:91945136-91945158 GCAGTGGTCCCCAATCTTTTTGG + Intergenic
1044519876 8:93187258-93187280 GTAGCTGTCCCCAACCTTTTTGG + Intergenic
1044545662 8:93456468-93456490 GCAGCTGTCCCCAACCATTTTGG + Intergenic
1045001978 8:97886387-97886409 TCAGTGGTCCCCAATCTTTTTGG - Intronic
1045006684 8:97922157-97922179 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1045176034 8:99725573-99725595 GCAGTGGTCCCCAATCTTTTTGG - Intronic
1045249128 8:100468517-100468539 ACAGCGGTCCCCAAACTTCTTGG + Intergenic
1045531520 8:102989487-102989509 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1045654913 8:104376891-104376913 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1045676546 8:104614298-104614320 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1045842824 8:106599771-106599793 GCAGCAGTCCCCAACCTTTTCGG + Intronic
1045981879 8:108199450-108199472 CCAGCAGTCCCCAATCGTTTTGG + Intergenic
1046070429 8:109246147-109246169 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1046259718 8:111751522-111751544 ACAGCAGTCCCCAAACTTTTTGG - Intergenic
1046461407 8:114542173-114542195 GCAGCAGTTCCCAATCTTTCTGG + Intergenic
1046526656 8:115389625-115389647 GCAGCGGTCCCCAACCTTTACGG + Intergenic
1046534909 8:115497140-115497162 ACAGCGGTCCCCACTCTGTTTGG + Intronic
1047175204 8:122534237-122534259 ACAGTGGTCCCCAAACTTTTTGG - Intergenic
1047260755 8:123257521-123257543 ACAGCAGTCCTCAACCTTTTTGG + Intronic
1047340704 8:123977691-123977713 GCAGCAGTCCCCAGCCTTTCTGG + Intronic
1047982156 8:130194551-130194573 TTAGCAGTCCCCAACCTTTCTGG + Intronic
1048136597 8:131752400-131752422 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1048258413 8:132923892-132923914 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1048429916 8:134360696-134360718 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1048583913 8:135755345-135755367 ACAGCGGTCCTCAACCTTTCTGG - Intergenic
1048629764 8:136229376-136229398 ACAGCTCTTCCCTATCTGTCTGG - Intergenic
1048938137 8:139373987-139374009 ACAGCTGTCCCCAACCTTTTTGG - Intergenic
1049329269 8:142041407-142041429 GCAGCTGTCCCCAACCTTTTTGG + Intergenic
1049459290 8:142716165-142716187 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1050161793 9:2727016-2727038 ACAGCGGTCCCCAACCTCTTTGG - Intronic
1050289520 9:4139597-4139619 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1050412738 9:5383388-5383410 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1050427126 9:5522939-5522961 GCAGCTGTCCCCTTCCTTTCTGG + Intronic
1050571067 9:6939534-6939556 GCAGTGGTCCCCATTCTTTCTGG - Intronic
1051261710 9:15271371-15271393 ACAGCAGTTCCCAACCTTTTTGG + Intronic
1051378598 9:16431677-16431699 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1051766990 9:20535361-20535383 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1051807370 9:21010555-21010577 ACAGCAGTCCCCAACCTTTTTGG + Intronic
1051849894 9:21494307-21494329 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1051879669 9:21827082-21827104 ACAGCTGCCCCTAATCTTTTTGG - Intronic
1052390373 9:27872293-27872315 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1052409622 9:28106213-28106235 CCAGCAGTCCCCAATCTTTTTGG - Intronic
1052564690 9:30134403-30134425 GCAGTTGTCCCCAACCTTTTTGG + Intergenic
1052652758 9:31325254-31325276 ACAGCAGTCCCCAACCTTTTTGG + Intergenic
1052783156 9:32801856-32801878 ACAGCAGTCCCTAACCTTTTTGG + Intergenic
1052868518 9:33481427-33481449 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1053153117 9:35755462-35755484 TCAGCAGTCCCCAACCTTTTTGG + Exonic
1053215290 9:36265637-36265659 GCAGCGGTCCCCAGTCTTTTTGG + Intronic
1053701332 9:40693947-40693969 ACAAGTGACACCAATCTTTCTGG - Intergenic
1054411396 9:64817403-64817425 ACAAGTGACACCAATCTTTCTGG - Intergenic
1054747498 9:68869451-68869473 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1055045420 9:71918980-71919002 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1055057857 9:72040059-72040081 GCAGCGGTCCCCAGTCTTTTTGG + Intergenic
1055699795 9:78931224-78931246 GCAGCGGTCCCCAAACTTTTTGG + Intergenic
1055767894 9:79684649-79684671 CCAGCAGTCCCCAATCTTTTTGG - Intronic
1055817048 9:80218922-80218944 TCAGCAGTCCCCAACCTTTTTGG - Intergenic
1055846362 9:80568503-80568525 ACAGTGGTCCCCAATCTTTTTGG + Intergenic
1056115012 9:83433440-83433462 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1056593766 9:87987801-87987823 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1056599656 9:88036719-88036741 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1056674703 9:88665387-88665409 ACAGCAGTCTCCAACCTTTCTGG - Intergenic
1056751681 9:89356342-89356364 ACAGCGGTCCCCAATCTTTTTGG - Intronic
1056921126 9:90790001-90790023 ACAGCTGTTACCAGTCTTTGAGG - Intergenic
1056958138 9:91098959-91098981 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1057007113 9:91570081-91570103 ACAGCGGTCCCCAACTTTTTTGG + Intronic
1057414544 9:94849546-94849568 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1057586594 9:96334096-96334118 GCAGCAGTCCCCAACCTTTTTGG + Intronic
1057775291 9:98003132-98003154 AAAGCTGTCCCCAGCCCTTCTGG - Intronic
1057775872 9:98008938-98008960 ACAGCGGTCCTCAACCTTTTTGG - Intronic
1057804055 9:98208290-98208312 ACAACGGTCCCCAACCTTTTTGG + Intronic
1057977576 9:99622629-99622651 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1058167240 9:101633792-101633814 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1058287178 9:103192604-103192626 ACATCAGTCTCCAATCTTTTTGG - Intergenic
1058359470 9:104126227-104126249 AGAGCAGTCCCCAACCTTTTTGG - Intronic
1059359931 9:113734279-113734301 ACAGCGGTCCCCAACCTTTTTGG - Intergenic
1059361854 9:113749708-113749730 AGAGCAGTCCCCAACCTTTTTGG - Intergenic
1059563863 9:115363171-115363193 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1060945556 9:127568064-127568086 ACAGCTGTCCCCAAGGCTCCTGG - Intronic
1061844208 9:133377680-133377702 ATAGCAGTCCCCAACCTTTTTGG + Intronic
1062217391 9:135396640-135396662 GCAGCTGTCCCCAACATTTATGG - Intergenic
1062663845 9:137655886-137655908 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1185720446 X:2377084-2377106 CCAGCCGTCCCCAGCCTTTCTGG + Intronic
1185760195 X:2684665-2684687 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1185840978 X:3390986-3391008 GCAGTGGTCCCCAATCTTTTTGG - Intergenic
1185853620 X:3512006-3512028 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1185948819 X:4407739-4407761 ACAGTTGTCCCCAACCTTTTTGG + Intergenic
1186050205 X:5584424-5584446 CCAGCTGTCCCCAATCTTTTTGG + Intergenic
1186146329 X:6627835-6627857 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1186204780 X:7189981-7190003 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1186336605 X:8596262-8596284 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1186588026 X:10897705-10897727 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1186644191 X:11488874-11488896 CCAGCGGTCCCCAACCTTTTTGG - Intronic
1186668620 X:11745842-11745864 CCAGCAGTCCCCAATCTTTGTGG + Intergenic
1187022081 X:15394057-15394079 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1187266774 X:17741086-17741108 ACTGCTGTCCCCAGTCTTTTTGG + Intronic
1187459579 X:19474926-19474948 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1187570585 X:20496657-20496679 GCAGCAGTCCCCAACCTTTTTGG - Intergenic
1187693214 X:21892913-21892935 ACAGCAGTCCCCAACCCTTTTGG + Intergenic
1188034116 X:25297530-25297552 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1188700186 X:33250159-33250181 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1188818894 X:34749037-34749059 GCAGCAGTCCCCAACCTTTTTGG + Intergenic
1189373929 X:40451589-40451611 GCAGTTGTCCCCAACCTTTTTGG - Intergenic
1189384945 X:40529517-40529539 ACAGTGGTCCCCAACCTTTTTGG - Intergenic
1189453165 X:41158666-41158688 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1189503247 X:41584405-41584427 ACAGTGGTCCCCAACCTTTTTGG + Intronic
1189972563 X:46433024-46433046 TCAGCGGTCCCCAACCTTTTTGG - Intergenic
1190027235 X:46935713-46935735 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1190134136 X:47779625-47779647 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1190248109 X:48704167-48704189 CCATCTGTTCCCAAGCTTTCAGG + Intronic
1190261057 X:48797130-48797152 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1190421412 X:50288252-50288274 ACAGCGGTCCCTAACCTTTTTGG - Intronic
1190550222 X:51572183-51572205 ACAGCAGTCCTCAACCTTTTTGG + Intergenic
1190951548 X:55150235-55150257 TCAGCAGTCCCCAACCTTTTTGG + Intronic
1191706090 X:64095931-64095953 ACAGCTCCTCCAAATCTTTCAGG - Intergenic
1191975596 X:66867842-66867864 TCAGCTGTGCCCAGTCTTTCTGG - Intergenic
1192295412 X:69842507-69842529 ACAGTGGTCCCCAATATTTTTGG - Intronic
1192356666 X:70410532-70410554 ACAGCGGTCCCCAATCTTTTTGG + Intronic
1192394280 X:70762711-70762733 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1192557291 X:72100809-72100831 ACAGCAGTCCCCAACCTTTTTGG - Intergenic
1192590895 X:72358711-72358733 CCAGCAGTCCCCAACCTTTTTGG + Intronic
1192634486 X:72804735-72804757 CCACCTGTCCTCAATCTCTCTGG - Intronic
1192647226 X:72916066-72916088 CCACCTGTCCTCAATCTCTCTGG + Intronic
1193736186 X:85159567-85159589 TCAGCGATCCCCAATCTTTTTGG - Intergenic
1193869153 X:86775583-86775605 ACAGCAGTCCCCAACCTTTTTGG - Intronic
1193932707 X:87575468-87575490 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1194282300 X:91967587-91967609 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1194601050 X:95922566-95922588 CCAGCAGTCCCCAACCTTTTTGG + Intergenic
1194649070 X:96493209-96493231 ACAGCAGTCCCCAAACTTTTTGG - Intergenic
1195341883 X:103914573-103914595 CCAGCGGTCCCCAACCTTTCTGG + Intergenic
1195349388 X:103982452-103982474 CCAGCGGTCCCCAACCTTTCTGG - Intergenic
1195358055 X:104056387-104056409 CCAGCGGTCCCCAACCTTTCTGG + Intergenic
1195527042 X:105902904-105902926 ACAGTGGTCCCCAAACTTTTTGG - Intronic
1195656194 X:107333686-107333708 ACAGTGGTCCCCAACCTTTTTGG + Intergenic
1195768880 X:108327376-108327398 TCAGCAGTCCCCAACCTTTTGGG - Intronic
1195884871 X:109627124-109627146 ACAGCAGTCCTCAACCTTTTTGG - Intronic
1195922320 X:109995911-109995933 ACAGCAGTCCCCAACGTTTTTGG + Intergenic
1196364715 X:114911575-114911597 TCAGCAGTCCCCAACCTTTTTGG + Intergenic
1196394632 X:115246194-115246216 ACAGCAGTCCTCAACCTTTTTGG + Intergenic
1196488529 X:116242829-116242851 ACAGTGGTCCCCAATCTTTTTGG + Intergenic
1196627487 X:117893065-117893087 CCAGCTGTTCTCAATCTTTCTGG + Intergenic
1197452598 X:126638711-126638733 TCAGCGGTCCCCAAACTTTTGGG + Intergenic
1197840885 X:130745087-130745109 ACAGCCGTCCGCAACCTTTTTGG - Intronic
1197985886 X:132266092-132266114 ACAGTAGTCCCCAACCTTTTTGG - Intergenic
1198066813 X:133106301-133106323 CCAGCAGTCCCCAACCTTTTTGG - Intergenic
1198121961 X:133602589-133602611 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1198271313 X:135058816-135058838 ACAGTTGTCCCCAACCTTTTTGG - Intergenic
1198395583 X:136215688-136215710 CCAGCAGTCCCCAACCTTTTTGG - Intronic
1198733349 X:139758509-139758531 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1198828266 X:140721327-140721349 ACAGCAGTCCCCAACCTGTTTGG + Intergenic
1199023019 X:142904651-142904673 TCAGCGGTCCCCAACCTTTTTGG + Intergenic
1199271077 X:145883321-145883343 TCAGCAGTCCCCAATCTTTTTGG + Intergenic
1199285860 X:146053565-146053587 TCAGCTGTCCCCAAACTTTTTGG + Intergenic
1199440141 X:147858313-147858335 GCAGCGGTCCCCAACCTTTTTGG - Intergenic
1199659886 X:150038283-150038305 ACAGCAGTCCCTAACCTTTTTGG + Intergenic
1200112966 X:153752276-153752298 GCAGTGGTCCCCAATCTTTTTGG - Intergenic
1200254169 X:154570614-154570636 ACAGCGGTCTCCAACCTTTTTGG + Intergenic
1200263600 X:154633794-154633816 ACAGCGGTCTCCAACCTTTTTGG - Intergenic
1200386494 X:155896066-155896088 TCAGCAGTCCCCAACCTTTTTGG - Intronic
1200599889 Y:5192238-5192260 ACAGTGGTCCCCAACCTTTTTGG - Intronic
1200809826 Y:7472509-7472531 GCAGCCGTCCCCAACCTTTTTGG - Intergenic
1201326485 Y:12765736-12765758 GCAGCAGTCCCCAACCTTTTTGG - Intronic
1201577468 Y:15476624-15476646 ACAGCAGTCCTCAACCTTTTTGG + Intergenic
1201626971 Y:16025159-16025181 ACAACTGTCCCCAATCTTTTTGG - Intergenic
1201735930 Y:17261675-17261697 ACAACAGTCCCCAACCTTTTTGG + Intergenic
1201911260 Y:19135578-19135600 AGAGCTGTCCCTAATCTCTTTGG - Intergenic
1201954433 Y:19607252-19607274 ACAGCAGTCCCCAACTTTTCTGG - Intergenic
1202193148 Y:22265756-22265778 GCAGATGTTCCCAACCTTTCTGG + Intergenic