ID: 931495741

View in Genome Browser
Species Human (GRCh38)
Location 2:62805027-62805049
Sequence CAGCTGTTCTAGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931495732_931495741 30 Left 931495732 2:62804974-62804996 CCTGGAAAACTGTCTTCCATGAA 0: 1
1: 1
2: 4
3: 35
4: 365
Right 931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG 0: 1
1: 0
2: 1
3: 20
4: 204
931495739_931495741 -7 Left 931495739 2:62805011-62805033 CCAGAAAGATTGGGGACAGCTGT 0: 1
1: 3
2: 31
3: 299
4: 1240
Right 931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG 0: 1
1: 0
2: 1
3: 20
4: 204
931495735_931495741 14 Left 931495735 2:62804990-62805012 CCATGAAACTGGTCTCTGGTGCC 0: 27
1: 301
2: 654
3: 1181
4: 1436
Right 931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931495741 Original CRISPR CAGCTGTTCTAGAGGACAAA TGG Intronic
902964482 1:19989421-19989443 CATCAGTTCTACAGGACAATTGG - Intergenic
903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG + Intronic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
913068968 1:115283171-115283193 GAGCTGGAATAGAGGACAAAAGG - Intergenic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917411298 1:174762509-174762531 TAGATGTCCTAGAAGACAAAGGG - Intronic
918453912 1:184687646-184687668 CAGTGGTTGTAGTGGACAAATGG - Intergenic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1070618963 10:77991986-77992008 GACCATTTCTAGAGGACAAAAGG + Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG + Intergenic
1074125939 10:110529095-110529117 CAGCTGTTTGAAAGGAAAAAAGG - Intergenic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG + Intergenic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1076150303 10:128156927-128156949 CAGCTTTTCTTGAAGACACAAGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077417404 11:2431102-2431124 CAGCCATGCTAGGGGACAAAGGG - Intergenic
1079852178 11:25548668-25548690 TAGCTGTTCTACAGGGGAAAAGG + Intergenic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1080778536 11:35408683-35408705 CCACTGGTCCAGAGGACAAAAGG + Intronic
1084279685 11:68079846-68079868 CACCTGATCTATAGGCCAAAGGG - Intronic
1084706260 11:70817562-70817584 CAACGGTTCTAGGTGACAAAGGG + Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086543222 11:87938140-87938162 CAGGTGTTAAAGAGGCCAAATGG - Intergenic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG + Intergenic
1089811740 11:121137822-121137844 CAGCTGGTCTGGAAGTCAAAGGG - Exonic
1090148603 11:124357275-124357297 CATCTTTTCTAGAAGAAAAAAGG + Intergenic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092804977 12:12213024-12213046 CAGCTTCTTTAGAGGACTAATGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094649934 12:32365755-32365777 AAGCTGTTGGAGAAGACAAAAGG + Intronic
1095373303 12:41495945-41495967 CAGCTCTGCAAGAGCACAAAGGG - Intronic
1100558696 12:95724577-95724599 TAGCTGTTATAAAGGAGAAAAGG - Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1102361137 12:112288666-112288688 GAGCTTTTCAAGAGGACAAGTGG - Intronic
1102880169 12:116478782-116478804 CATCAGTTCTATAGGACAATTGG + Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104186462 12:126436760-126436782 CAGCTACTCTAGAGATCAAAAGG + Intergenic
1108423700 13:50276721-50276743 AACCTGTACTGGAGGACAAAGGG - Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1116082799 14:40197840-40197862 CAGATGTTTTAGAGAACTAAAGG - Intergenic
1116264499 14:42669906-42669928 CAGTGGTTATAGAGGACAAAGGG + Intergenic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123453267 15:20387809-20387831 CATCAGTTCTATAGGACAATTGG + Intergenic
1124486297 15:30120142-30120164 CATCAGTTCTATAGGACAATTGG + Intergenic
1124541372 15:30589127-30589149 CATCAGTTCTATAGGACAATTGG + Intergenic
1124548023 15:30650625-30650647 CATCAGTTCTATAGGACAATTGG + Intronic
1124757286 15:32418460-32418482 CATCAGTTCTATAGGACAATTGG - Intergenic
1127194673 15:56570782-56570804 CAGCAGTTAAAAAGGACAAAGGG + Intergenic
1128308243 15:66614031-66614053 TTGCTGTTCTAGGGGACAATGGG - Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1131426868 15:92352852-92352874 CAGATGTTTCAGAGGGCAAAGGG - Intergenic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1135410036 16:22226825-22226847 CAGCACTTTGAGAGGACAAAAGG + Intronic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137571378 16:49568446-49568468 CAGCTGGTCTAGGGAACAAGGGG - Intronic
1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG + Intergenic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1140239503 16:73188443-73188465 CATCAGCTCGAGAGGACAAAGGG - Intergenic
1140601215 16:76477275-76477297 CAGTTGTTCTGGCGCACAAATGG + Intronic
1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG + Intronic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143217667 17:5237237-5237259 CACATGTTCTACAGGACAGAAGG + Intergenic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1149410031 17:56395512-56395534 AAATTGTTCTAGAGGACCAATGG + Intronic
1152180528 17:78818178-78818200 CACCTGTTCTAGACATCAAAAGG + Intronic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
1165972592 19:39644940-39644962 CAGCTCTTATAGAGGGAAAAGGG - Intergenic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
926482033 2:13411425-13411447 CATCAGTTCTATAGGACAATTGG - Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
928330459 2:30354275-30354297 CAGCTGTGCTAGAAGACAGTTGG - Intergenic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
930086287 2:47499644-47499666 CATCAGTTCTATAGGACAACTGG - Intronic
930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG + Intergenic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG + Intergenic
935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG + Intronic
936855377 2:116951958-116951980 TAGCTGCTATAGAGGAGAAAGGG + Intergenic
939601363 2:144195073-144195095 CACCTGTTTTACAGGAAAAAAGG - Intronic
940337532 2:152544841-152544863 CAGCTGATCTAAAGGAAAATTGG - Intronic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
940564255 2:155340210-155340232 CAGCTAATCTAGAGGACAACTGG - Intergenic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
941223196 2:162811119-162811141 CTAATGTTCTAGAGGGCAAAGGG - Intronic
941655058 2:168134398-168134420 CAGCTCTGCTTGAGGTCAAAGGG - Intronic
942325468 2:174772649-174772671 CAGCTGTTCTAGATGAAGGAAGG - Intergenic
942625168 2:177892910-177892932 CAGCTTTTCTAGAGTCCCAAAGG - Intronic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
946543543 2:220712351-220712373 GTGCTGTGCTAGAGGACAACTGG + Intergenic
946696038 2:222360220-222360242 CAGCTGTGCAAGAGAGCAAACGG - Intergenic
946828330 2:223701964-223701986 CAGCTGCTCAAGCAGACAAATGG + Intergenic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1169759894 20:9079626-9079648 CCTCTGTTCTGGAGGGCAAATGG - Intronic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1181181788 22:21073655-21073677 CACTTGTTCAAGATGACAAATGG - Intergenic
1182649614 22:31840531-31840553 CAGCTATTCCAGAGAACAACAGG - Intronic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG + Intronic
1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG + Intronic
1184345476 22:43910159-43910181 CAGGTTTTCTAGAAGTCAAAGGG - Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
949793175 3:7816021-7816043 CATCTGTTAATGAGGACAAAAGG - Intergenic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
953312480 3:41892580-41892602 CATCAGTTCTATAGGACAATTGG - Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965229988 3:166038284-166038306 CAGCAATTCTAGAGGACATTTGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
967665641 3:192168728-192168750 CAACTATTATAGAAGACAAAGGG + Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
973701507 4:53541959-53541981 CAGCTGCTCCAGATGACACATGG + Intronic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
982102096 4:151977966-151977988 CATCAGTTCTATAGGACAACTGG + Intergenic
982272432 4:153604949-153604971 CAGCACTTCTGGAGGCCAAAGGG - Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
983770337 4:171541233-171541255 CCCCTGTTTTAAAGGACAAAAGG + Intergenic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
985089196 4:186346155-186346177 CAGCTGTTTTAGATCATAAAGGG - Intergenic
992160787 5:73999165-73999187 CAGGTATCCTAGAGGACAATGGG - Intergenic
992639372 5:78755597-78755619 CATCTGTTGAAGAGCACAAATGG - Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
993731639 5:91429698-91429720 CAGCCTCTCCAGAGGACAAAAGG - Intergenic
999454972 5:151707698-151707720 CAGCTGTTCTAAAACACAGATGG - Intergenic
1000772711 5:165376702-165376724 AAGCTGTGCTAGAGGGCAACTGG + Intergenic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1004461215 6:15838235-15838257 CAACCATTCTAGAAGACAAAAGG + Intergenic
1005279604 6:24258924-24258946 GATGTGTTCTAGAGAACAAAGGG - Intronic
1008204906 6:48643102-48643124 CATCTGTTCTATGGGACAACAGG - Intergenic
1008720742 6:54348053-54348075 CAGCTCTTATAGAAGACACAAGG - Intronic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1010661846 6:78580699-78580721 CAGCTGTTCTAAAAAACATAAGG + Intergenic
1012864264 6:104598621-104598643 AAGCTTTTCTATAGGACCAATGG - Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1019825480 7:3280712-3280734 CATCTGTTAGAGAGGCCAAAAGG - Intergenic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG + Intronic
1022194775 7:28054336-28054358 CAGTTGTTATAAAGGACAACTGG - Intronic
1022283174 7:28930874-28930896 CAGCTTTTCTTGGGGACAGATGG - Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG + Intergenic
1028537241 7:91903383-91903405 TAGCTGTTATAAAGGAGAAAAGG - Intergenic
1028802361 7:94981046-94981068 CAGCTGTGCTAGAGAATAATGGG + Intronic
1033175314 7:139118434-139118456 CAGGTGTTCTACAGGAGATATGG + Intergenic
1034327916 7:150254382-150254404 CATCAGTTCTATAGGACAATTGG - Intronic
1034765294 7:153715056-153715078 CATCAGTTCTATAGGACAATTGG + Intergenic
1040641688 8:49341763-49341785 CAGCTGGTCTAGAGAAAACATGG - Intergenic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1042475462 8:69244341-69244363 CAGCTGATCTAAAGAATAAATGG + Intergenic
1042741374 8:72050912-72050934 CAGCTGTTGTACAGAACAGAAGG - Intronic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG + Intergenic
1046834942 8:118789854-118789876 CAACTGCACTAGAGGACACATGG + Intergenic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG + Intronic
1059803034 9:117770288-117770310 CAGCTCTGAAAGAGGACAAAGGG + Intergenic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1191198839 X:57755361-57755383 AATCTGGACTAGAGGACAAATGG + Intergenic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1196071152 X:111523682-111523704 CATTTATTCTAGAGGGCAAATGG - Intergenic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1197232951 X:124026070-124026092 TACCTGGTCTAGAAGACAAAAGG - Intronic
1199280908 X:145998098-145998120 CAGCTTTTCTAGACCACTAAGGG - Intergenic