ID: 931496155

View in Genome Browser
Species Human (GRCh38)
Location 2:62809353-62809375
Sequence CAGTTGGGGGAGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2001
Summary {0: 1, 1: 0, 2: 8, 3: 204, 4: 1788}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931496155_931496168 4 Left 931496155 2:62809353-62809375 CCTCCTCCCCTCTCCCCCAACTG 0: 1
1: 0
2: 8
3: 204
4: 1788
Right 931496168 2:62809380-62809402 CCCAAGGGAATTTTCTACTGTGG 0: 1
1: 0
2: 2
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931496155 Original CRISPR CAGTTGGGGGAGAGGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr