ID: 931508147

View in Genome Browser
Species Human (GRCh38)
Location 2:62955697-62955719
Sequence CATTGTAATCATGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931508147 Original CRISPR CATTGTAATCATGGGGAGGA GGG Intronic
901138647 1:7013743-7013765 CATTGTGTTCTTGGTGAGGAGGG + Intronic
903724090 1:25428242-25428264 CACTGCAGTCATGGGGATGAGGG + Intronic
904357919 1:29953308-29953330 CATGGTAATCTTGGCCAGGAAGG - Intergenic
905417703 1:37815660-37815682 CATGGGAACCATGGGAAGGATGG + Intronic
905426223 1:37886887-37886909 GACAGGAATCATGGGGAGGATGG - Exonic
906517004 1:46445540-46445562 CATGGTATTCATGAGAAGGAAGG - Intergenic
908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG + Intergenic
909420072 1:75454054-75454076 CATTGGGATCAGGGTGAGGATGG - Intronic
910958271 1:92731461-92731483 CATTGTGTTCATGGGGAGGAAGG + Intronic
911508662 1:98784828-98784850 CATTGTGATCATTTGGAGAAGGG - Intergenic
912901146 1:113650717-113650739 CATTGTAATGATAGGGATAATGG + Intronic
913722094 1:121606952-121606974 CATTCAAATCATGGGAATGATGG + Intergenic
913741879 1:121854532-121854554 CATTCAAATCATGGGAATGATGG + Intergenic
915999330 1:160599722-160599744 CATTATAATCAGGAGGAGGTGGG + Intergenic
918532169 1:185535522-185535544 CATTTTATGCATGGAGAGGAAGG + Intergenic
920773374 1:208911597-208911619 CATTGTAACCATGTGGATAAGGG - Intergenic
923466851 1:234256016-234256038 GATATTAATAATGGGGAGGAGGG + Intronic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
924200443 1:241653040-241653062 CAATGGAATCATGGTGAGGCAGG - Intronic
1063655047 10:7980038-7980060 CATGGTGATAATGGGGAGGGAGG + Intronic
1065631790 10:27687750-27687772 CATTTTAAACTTGGGGAAGATGG - Intronic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1068384916 10:56313841-56313863 ATTTGTGATCATGGGGATGAGGG - Intergenic
1070421471 10:76241743-76241765 CATTGTAAGCCTGGTGAGGATGG - Intronic
1071078362 10:81781549-81781571 CATTGTAACCATGAGTAGAATGG + Intergenic
1072953440 10:99869027-99869049 AGTTGTAATCATTTGGAGGAGGG + Intergenic
1073764522 10:106667348-106667370 CATTGTATCCATGATGAGGAAGG - Intronic
1073769528 10:106720362-106720384 CATTTTAATGATGGGGAAGTGGG - Intronic
1074846630 10:117404521-117404543 CATTGAAGAGATGGGGAGGAAGG + Intergenic
1075488986 10:122850014-122850036 CCTTGTGCTCATGTGGAGGACGG - Intronic
1075494981 10:122912168-122912190 CCTTGTGCTCATGCGGAGGATGG + Intronic
1076035061 10:127193182-127193204 CAGTGGAATCATGGTGGGGAGGG + Intronic
1080711556 11:34752684-34752706 CATTATACTCATAGGGAAGAGGG + Intergenic
1083265133 11:61543087-61543109 CCTAGTAATCCTGGGGAGGCCGG + Intronic
1084578085 11:70003686-70003708 AATTGTATTGATGGAGAGGATGG + Intergenic
1086838933 11:91660535-91660557 CAATGTAAGAATGGGGATGAGGG + Intergenic
1086961796 11:92985508-92985530 CGTTGTCACCATGGGGATGAAGG - Intergenic
1087843894 11:102949550-102949572 CATTGTACTCGTGGGGCGGGGGG - Intronic
1089213599 11:116822318-116822340 CAGTGGAATCAAGGGGAGGGAGG - Intronic
1090225499 11:125069847-125069869 CATTGTCATCCTGACGAGGAAGG - Intronic
1091350327 11:134888843-134888865 GATAGTGATCATGGAGAGGAGGG + Intergenic
1092853845 12:12654615-12654637 CATTTTAATCATGGAGAAGGCGG + Intergenic
1093215961 12:16361446-16361468 AAATGTAATCATGGGGAAGAAGG + Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1104449132 12:128854791-128854813 CATTTTAATGATGAGGAGGCCGG - Intronic
1104744018 12:131199462-131199484 GATGGTAATGATGGTGAGGATGG - Intergenic
1105562692 13:21509192-21509214 CATTATTATCATTGGGAAGATGG + Intronic
1109802059 13:67393232-67393254 CCTTGTCATCCTGGGGAGAAAGG - Intergenic
1112408723 13:99143716-99143738 CATTGCTCTCATGGGGAGGTGGG - Intergenic
1113871560 13:113562996-113563018 CATTGTAACCATGGGAAGTCTGG + Intergenic
1115963674 14:38863620-38863642 CATTGTAAGCCTGGGGCGGGAGG - Intergenic
1116280267 14:42898061-42898083 CATTGTTCTCATGTGCAGGATGG - Intergenic
1117047964 14:51831982-51832004 CATTAAAATGATGGGGAGGCTGG + Intronic
1119428020 14:74548393-74548415 AATTGTAAGCTTGGAGAGGAAGG + Intronic
1120663784 14:87281278-87281300 CATTATCATCAAGGTGAGGAAGG + Intergenic
1121661778 14:95640517-95640539 CATGGCAGTAATGGGGAGGAGGG + Intergenic
1124864914 15:33480057-33480079 CATGGTAAGACTGGGGAGGAGGG + Intronic
1125077437 15:35635630-35635652 CAGTGTAATTATGGGGATAAAGG + Intergenic
1135615284 16:23906074-23906096 CATTGGAATCATGAGGACGGAGG + Intronic
1137533059 16:49295712-49295734 GAATGTAATCATTGGAAGGATGG - Intergenic
1140656177 16:77142544-77142566 AATACTTATCATGGGGAGGAGGG - Intergenic
1143557944 17:7674192-7674214 CAGTGTGATGATGGTGAGGATGG + Exonic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1149501412 17:57155658-57155680 AATTGTAATCATGGGGTAGTAGG + Intergenic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1150707055 17:67496522-67496544 CATAGTAAACACGGGGAGGCTGG - Intronic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1152436163 17:80277805-80277827 CATTCTAACCATGGTGAGGAGGG + Intronic
1155899676 18:31373411-31373433 CACTGTAGTCATCGGGAGGCAGG + Intergenic
1156215503 18:34994117-34994139 CATTGTACTAACTGGGAGGATGG + Intronic
1158327521 18:56327086-56327108 CATTTTAAACATGGAGAGGAAGG + Intergenic
1159779715 18:72646755-72646777 GATTGTTATGATGGGGAGAAAGG + Intergenic
1160208463 18:76857134-76857156 CATAGGAATTATGGGGAGGCGGG - Intronic
1160222296 18:76986022-76986044 CACTGCAAACATGGGGAGGAAGG + Intronic
1161758901 19:6156282-6156304 CATTGTTAAGTTGGGGAGGAAGG + Intronic
1162551329 19:11359984-11360006 CATGGTAATGGTGGGGAGGTGGG + Intronic
925683259 2:6445285-6445307 CTTTGTTTTCATGGGGAGTAAGG + Intergenic
931508147 2:62955697-62955719 CATTGTAATCATGGGGAGGAGGG + Intronic
932735130 2:74249119-74249141 CATTGTTATAACTGGGAGGAGGG - Intronic
932869152 2:75379672-75379694 CATTCTAATCAGGCAGAGGAGGG + Intergenic
933460399 2:82576309-82576331 CATTTTAATTCTGGGGATGAGGG - Intergenic
934622891 2:95826340-95826362 CACTGAACTCCTGGGGAGGAAGG - Intergenic
934810879 2:97275763-97275785 CACTGAACTCCTGGGGAGGAAGG + Intergenic
934826813 2:97432176-97432198 CACTGAACTCCTGGGGAGGAAGG - Intergenic
935468454 2:103428370-103428392 CATTGAAATCACCTGGAGGAAGG + Intergenic
936011041 2:108925445-108925467 CATTTTGAGCATGGGGAGGGTGG + Intronic
936981007 2:118265326-118265348 CATTGTCATTGTGGGGAGGGCGG + Intergenic
938174880 2:129116572-129116594 TAACGTAATCATGGGGATGATGG + Intergenic
938319251 2:130352078-130352100 CATTTTAAAGATGGGGAAGAGGG + Intergenic
939980974 2:148780700-148780722 GATTGAAATCATTGGGAGAAAGG + Intronic
940424193 2:153512023-153512045 CAATGTAACCATGGGGAGAGGGG + Intergenic
940976347 2:159949376-159949398 CATTGTATTCATTTGGAGAAAGG - Intronic
942982295 2:182096669-182096691 CATGTTAATCATCTGGAGGAAGG - Intronic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
947337344 2:229101080-229101102 CAATGGAAACTTGGGGAGGATGG + Intronic
948664950 2:239528937-239528959 CATTGTACTCCTGAGGAGGGAGG + Intergenic
1169918377 20:10706463-10706485 CTTTATGATCCTGGGGAGGATGG + Intergenic
1171286420 20:23942789-23942811 AATGGTAATCATGGGGGTGATGG - Intergenic
1173542754 20:43866941-43866963 CTTTGGAATCATGGGGATCAGGG - Intergenic
1175764918 20:61585690-61585712 GATTGTGGTCATGTGGAGGATGG + Intronic
1176105839 20:63386113-63386135 CATTGTAAGCATGGGCGTGATGG - Intergenic
1182358661 22:29734280-29734302 CCTTGTAAACATGGGGAAGTGGG - Intronic
1183907945 22:41056687-41056709 CATTCTCATCCTGGGCAGGACGG + Intergenic
1184550332 22:45201010-45201032 TATTGTTGGCATGGGGAGGAGGG - Intronic
1185136149 22:49073867-49073889 AATGGTAATCATGGTGATGATGG - Intergenic
1185136178 22:49074139-49074161 AATGGTAATCATGGTGATGATGG - Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
951714261 3:25622540-25622562 ATTTTAAATCATGGGGAGGAAGG + Intronic
951785845 3:26418311-26418333 GATTGTTAGCATGGGGAGTAGGG - Intergenic
952335470 3:32399953-32399975 CTTTTTAATCTTGGGGAAGAGGG - Intronic
952627604 3:35425835-35425857 CATTTTAATGATGGGGAAGGGGG - Intergenic
953167391 3:40477354-40477376 CGCGGTATTCATGGGGAGGATGG + Exonic
954231307 3:49219844-49219866 CATACTAATGATGAGGAGGAAGG + Intronic
955422241 3:58750377-58750399 CAATGTAACCATGTGGAAGATGG + Intronic
958833764 3:99119811-99119833 TATTGTAATCATTAGGAGGCTGG + Intergenic
959344034 3:105170243-105170265 CATTGTAAAAATTGGGAGAAGGG + Intergenic
960794700 3:121473115-121473137 CATTTTAATGATAGGAAGGAAGG + Intronic
960855850 3:122101393-122101415 CGTTGTAATCTTTGGGAGAAGGG + Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
965413542 3:168363386-168363408 CATTGTTATTATGGGAAGCATGG + Intergenic
966473935 3:180322888-180322910 CATTGTAAACAGGCGGAGGCTGG + Intergenic
966968419 3:185019073-185019095 CACTCTAATGATGAGGAGGAAGG - Intronic
966999324 3:185316859-185316881 CATTGTGAGCTTGGGCAGGAAGG + Intronic
967266072 3:187693397-187693419 CATTGTTCTTAGGGGGAGGAAGG + Intergenic
967294984 3:187955800-187955822 CATTGAAAACATGGGCAGGTTGG - Intergenic
971194175 4:24456228-24456250 CATTGAAGTCCTGGAGAGGATGG + Intergenic
973628942 4:52800657-52800679 TATTGTAATTATTTGGAGGATGG + Intergenic
978299163 4:107246630-107246652 CTTTGTAATCATGAGGAGTCAGG - Intronic
979823041 4:125197411-125197433 CTTTGCAATCTTGTGGAGGAGGG - Intergenic
980483194 4:133416491-133416513 CATTGAAATCAAGGAAAGGATGG + Intergenic
980629012 4:135409951-135409973 AATTGTTAACATGGGGAAGAGGG + Intergenic
985337302 4:188910501-188910523 CCTTGTAATTATGGGGAAGATGG - Intergenic
985382573 4:189410590-189410612 CATTCTATTTGTGGGGAGGAGGG + Intergenic
986785114 5:11106946-11106968 AATCGTGACCATGGGGAGGAAGG + Intronic
987764316 5:22205325-22205347 CATTCTAATAATGGGGAGAGGGG + Intronic
989090670 5:37727293-37727315 TGTTTTAATCATGGGCAGGATGG - Intronic
990812071 5:59738428-59738450 AAATGCAATCATGGGGGGGAAGG + Intronic
991134331 5:63163567-63163589 ACCTGTAATCATGGGAAGGAAGG + Intergenic
991899050 5:71438455-71438477 CATTCTAATAATGGGGAGTGGGG + Intergenic
992166040 5:74052821-74052843 TGTTGTAATCAGGGGTAGGATGG + Intergenic
993335520 5:86653583-86653605 AATTGAAATGATGGGGAGCAAGG + Intergenic
994001662 5:94788681-94788703 TATTCTAAACATGGGGAGGGAGG - Intronic
994057250 5:95431848-95431870 GATTGTGTTCTTGGGGAGGAAGG - Intronic
995426012 5:112023520-112023542 CATTACAATGATGGGGAGAAAGG - Intergenic
999035699 5:148346817-148346839 CTTTGTGTTCATGGGCAGGAAGG - Intergenic
1003622784 6:7716278-7716300 AATTGAAATTATGGGGGGGAGGG + Intergenic
1003869255 6:10389029-10389051 CATGATGATCAAGGGGAGGAAGG - Intergenic
1005225328 6:23635894-23635916 CATTGTAATAATGATGAGAAAGG + Intergenic
1010359740 6:74978937-74978959 CTTTGTAGTCTTGGGGAAGAGGG - Intergenic
1010933802 6:81835950-81835972 CAGTGTCATCATGGGAAGGGAGG + Intergenic
1011175157 6:84551967-84551989 CATTGTATTCGAGGGGAGCAAGG - Intergenic
1011596481 6:89021504-89021526 CATGGGACTCATGGGAAGGATGG + Intergenic
1011599986 6:89050969-89050991 CCTTGTAACCATGGGTAGAAAGG + Intergenic
1013131631 6:107238734-107238756 CATTCTTATCATTTGGAGGATGG + Intronic
1014859822 6:126451837-126451859 TGTGGCAATCATGGGGAGGATGG + Intergenic
1018478937 6:164170896-164170918 CCTGGGAATGATGGGGAGGATGG - Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022397914 7:30007515-30007537 AATTCTAACCCTGGGGAGGATGG + Intergenic
1022773849 7:33503784-33503806 CGTTGTAATCATGGTGGGGGTGG + Intronic
1023106121 7:36764723-36764745 CATTGTTAGCATGTGGAGGGTGG + Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1027991693 7:85371189-85371211 CAGTGTACTAATGGGAAGGAAGG - Intergenic
1028123977 7:87090278-87090300 CATTGAAATAGTGGGGATGATGG - Intergenic
1028780345 7:94728584-94728606 CATAGTAATGATGAGGAAGAAGG - Intergenic
1029600535 7:101560763-101560785 CACAGCAATCATGTGGAGGAAGG + Intergenic
1029982294 7:104890397-104890419 CGTTGTAATGCGGGGGAGGAAGG - Intronic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1030157715 7:106472652-106472674 AATTGGAATCTTGGAGAGGAGGG + Intergenic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1035521139 8:275710-275732 CATTAGAGTCATGGGGAGGCTGG + Intergenic
1038655385 8:29445935-29445957 AATTCTAAGAATGGGGAGGAGGG - Intergenic
1039901610 8:41756751-41756773 CATTTTAAACAGGGGCAGGATGG + Intronic
1041306719 8:56469373-56469395 CATTGTGATGATGGGAATGAGGG - Intergenic
1042183039 8:66111183-66111205 CAATGTACTCCTGGGGAGGAAGG + Intergenic
1044076275 8:87825403-87825425 AATTTTCATCATGGGGGGGAAGG + Intergenic
1045198951 8:99959483-99959505 CATTGTGATAAGGGAGAGGAGGG + Intergenic
1046843214 8:118884890-118884912 CAGTGTAATTATGGGGGGAAAGG - Intergenic
1047752132 8:127889869-127889891 TATTGTTATCATTGGGTGGATGG + Intergenic
1054879019 9:70125681-70125703 AATTGTAAACATGTGCAGGAGGG + Intronic
1055267729 9:74517273-74517295 CATTGGAATCATGGGAATAAAGG - Intronic
1055671659 9:78613018-78613040 AACTGTCAGCATGGGGAGGAAGG + Intergenic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1058944768 9:109846107-109846129 CATTGGAAGAATGAGGAGGAAGG + Intronic
1059936971 9:119321240-119321262 CATTTTATACATGGTGAGGAGGG + Intronic
1188546534 X:31313746-31313768 CATTCTAATAAAGGGGAGGGGGG - Intronic
1195159027 X:102153953-102153975 CATGATGATCATGGTGAGGAGGG + Exonic
1195765585 X:108293452-108293474 CATTCTAAGCATGGGCAGGGTGG - Intronic
1198021269 X:132660562-132660584 GATCCTATTCATGGGGAGGAGGG - Intronic
1198102629 X:133435487-133435509 CATTCCAGTCAAGGGGAGGAAGG - Intergenic
1198831362 X:140754241-140754263 AATTAGAACCATGGGGAGGAAGG - Intergenic
1199506767 X:148571298-148571320 CACAGTAATCATAGGCAGGAGGG - Intronic
1202081627 Y:21089629-21089651 AATTGTTAACATGGGGAAGAGGG - Intergenic