ID: 931514191

View in Genome Browser
Species Human (GRCh38)
Location 2:63033099-63033121
Sequence CTGGAGTCCTGCAATAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931514188_931514191 9 Left 931514188 2:63033067-63033089 CCTAAGTTTAAATATTTTCTAAA 0: 1
1: 0
2: 12
3: 107
4: 1110
Right 931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG 0: 1
1: 0
2: 0
3: 12
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931514191 Original CRISPR CTGGAGTCCTGCAATAATGT TGG Intronic
904382231 1:30119299-30119321 CTGGATCCCTGGAAGAATGTGGG - Intergenic
906200468 1:43957005-43957027 ATGGAGTCCAGAAATAATGAAGG + Intronic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
918496742 1:185148211-185148233 CTGGAGTTCAGGAAGAATGTGGG - Intronic
918777901 1:188659917-188659939 CAGAAGTCCTGAAAAAATGTAGG + Intergenic
919813751 1:201425018-201425040 CTGGCGTCCTGCAATGCTCTCGG - Intronic
922681688 1:227603549-227603571 CTGTAGTCCTGCTAGTATGTAGG + Intronic
1070782883 10:79147717-79147739 CCTGAGCCCTGCAACAATGTAGG - Intronic
1071409343 10:85373638-85373660 CTGGAATCCTTGAATATTGTAGG + Intergenic
1072206891 10:93212636-93212658 CTGGTGTCCTGCAGCACTGTGGG + Intergenic
1083110770 11:60404531-60404553 ATGAAGTCCTGGAATAATGTTGG - Intronic
1090559798 11:127919637-127919659 CTTGAATTCTGCTATAATGTAGG - Intergenic
1091639549 12:2224951-2224973 CTGCGGTCCTGCAAAAATTTGGG - Intronic
1091661471 12:2387092-2387114 CTCTAGGCCTGGAATAATGTTGG - Intronic
1095245303 12:39912717-39912739 CTGGAGCCCTGCCATAGTGTGGG + Intronic
1095530144 12:43177622-43177644 CTGTAATCCTGCAATTAAGTTGG + Intergenic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1102614440 12:114140979-114141001 CTGTACTCCTGCATTAATCTAGG - Intergenic
1106686600 13:32066852-32066874 CTTAAGTCCTGTAAAAATGTAGG - Intronic
1108026493 13:46183651-46183673 CTGGTGTCCTGAAAGAATGTAGG - Intronic
1108914994 13:55597480-55597502 CTGGTGAACTGCAAAAATGTAGG - Intergenic
1113081530 13:106525618-106525640 CTTGAGTCTTGAAATACTGTGGG - Intronic
1116970697 14:51061895-51061917 CTGGAGTCCTGCAATAGTAGGGG - Intronic
1119903130 14:78278317-78278339 CTGGAATCCTGCAAGAATATTGG - Intronic
1120969858 14:90198245-90198267 CTGGAGGCCTCCTATTATGTGGG - Intergenic
1122013830 14:98776459-98776481 CTGGATTCCTTGAATAATGCAGG - Intergenic
1122368399 14:101212875-101212897 CTGGATTCCTGGAAAGATGTTGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1125143592 15:36439540-36439562 CTGAAGTGCAGCAACAATGTGGG - Intergenic
1125475079 15:40041886-40041908 CTGGACTTCTGCAAAAATCTCGG + Intergenic
1125482247 15:40088867-40088889 CTGGACTCCTGCAATGAGGGTGG - Exonic
1129591434 15:76918448-76918470 CTGAAGCCCGGGAATAATGTTGG - Intergenic
1135733004 16:24909999-24910021 CTGGGGTCCTGCAATACTCTAGG + Intronic
1144584349 17:16479031-16479053 CTGGACCCCTGCAATACTGCAGG + Intronic
1149870232 17:60174441-60174463 CTGTTGTCCTGCAGGAATGTGGG - Intergenic
1152059063 17:78055721-78055743 CTGGAGTCGTGCAATAAATGTGG + Intronic
1157869790 18:51219325-51219347 CTGGAGGCCACCAATAAGGTAGG + Intergenic
1160047845 18:75404313-75404335 CTGGAGTCCTGCACTGAGTTTGG - Intergenic
1164989307 19:32673190-32673212 CTGGTGACCTGAAATAATCTTGG - Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1166988535 19:46677093-46677115 CTTGAGTCCTGGAGTAATATTGG - Intronic
1168549479 19:57280983-57281005 CCGCAGTCCTGCAACAGTGTTGG + Intronic
1168553742 19:57321017-57321039 CCGCAGTCCTGCAATAGTGTTGG + Intronic
925001392 2:405612-405634 ATGGATTCCTTCAATAATGTTGG - Intergenic
925855665 2:8126810-8126832 CTTGAGTCCTGCTATAATCCTGG + Intergenic
928385254 2:30862210-30862232 CTGGAGTCCTGCCATATTCATGG - Intergenic
928403843 2:30999056-30999078 CTGGATTCCTGCAAGAAGGCGGG + Intronic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG + Intronic
937820650 2:126306909-126306931 CTGCAGTCTTGGAATAATGAAGG - Intergenic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
944110653 2:196128473-196128495 CAGCAGTCCTGCTATACTGTGGG + Intergenic
946195324 2:218029165-218029187 CTGGAGTCCTGCATTGGAGTGGG - Intergenic
946721055 2:222608282-222608304 CTGGAGCCCTCAAATAATGGAGG - Intronic
1169963777 20:11192459-11192481 CTGATGTCCTGGAAAAATGTGGG + Intergenic
1174059549 20:47822916-47822938 CTGTATTCCTACAATAAAGTCGG - Intergenic
1175932784 20:62500806-62500828 CTGGCCTCCTGCACTAGTGTGGG + Intergenic
1176729064 21:10472019-10472041 CTGTAGTCTTTCAATAAAGTGGG + Intergenic
950007286 3:9699435-9699457 CTGAAGGCCTGCAAGACTGTGGG + Intronic
964791202 3:160454009-160454031 CTGTAGTCCAGCAATAATTTGGG + Intronic
966565773 3:181379330-181379352 CTAGAGTACTGCAATATTATTGG - Intergenic
966718568 3:183038320-183038342 AGGGAGCCCTGCAATCATGTGGG + Intronic
972463752 4:39331914-39331936 CTGGATCCCTCCCATAATGTGGG - Intronic
972645696 4:40966342-40966364 CTGGAGTGCTGCTATGATGCTGG + Intronic
973781011 4:54288170-54288192 AAGGAGTCCTGGAATAGTGTGGG + Intronic
984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG + Intergenic
985333322 4:188864841-188864863 CTGGAGTACTGGAACAATGCTGG - Intergenic
986891590 5:12315308-12315330 CTGGAGTCATTCAAAAATGTTGG - Intergenic
987680608 5:21131775-21131797 GTGGAGTACTGCCATAAAGTAGG + Intergenic
992776752 5:80095764-80095786 CTGGGTTCCTGCAAAAATTTGGG - Intergenic
992810861 5:80387043-80387065 GTGGGGTCCTACAACAATGTTGG + Intergenic
993595103 5:89844506-89844528 CTTGAGACATGCAATAATGCAGG - Intergenic
1001090330 5:168735383-168735405 CTAGAGTCCTGGAGTGATGTGGG + Intronic
1002650472 5:180688543-180688565 CTGGGTTCCTGTAACAATGTGGG - Intergenic
1008032244 6:46709953-46709975 CTGGAGTCTTGAAATTAGGTAGG + Intronic
1009910714 6:69923667-69923689 CTGGAGTCCTACAAATATGTTGG - Intronic
1010052858 6:71527942-71527964 CTGGAGACCAGCAGTAATCTGGG - Intergenic
1010285398 6:74071785-74071807 TTGGAGACCTTGAATAATGTGGG - Intergenic
1010620023 6:78062579-78062601 ATGCATGCCTGCAATAATGTAGG + Intergenic
1010629030 6:78175184-78175206 CTCCAGTCCTGCAATGATGGGGG - Intergenic
1013387165 6:109643028-109643050 CTGGGGTCCTGCAACACTGCAGG + Intronic
1015375418 6:132504544-132504566 CTGGAATACTGCAAAATTGTTGG + Intronic
1015634015 6:135258281-135258303 CTGCATGCCTGCCATAATGTGGG + Intergenic
1016937367 6:149457127-149457149 CTGGACTCCTGTCATGATGTGGG - Intronic
1017547821 6:155470352-155470374 TTGGAGTCCTGCCCTAATGCAGG + Intergenic
1018176022 6:161180152-161180174 CTGGAGGCTTGAAATATTGTTGG - Intronic
1020498210 7:8883565-8883587 TTGGACTCATGCAGTAATGTAGG - Intergenic
1026160408 7:67863550-67863572 CTGGAATTCTGCTAAAATGTAGG + Intergenic
1027859037 7:83552166-83552188 CTGACTTCCTGCAACAATGTAGG - Intronic
1031550437 7:123105148-123105170 ATGGAGTCCTGCAGTAGAGTAGG + Intergenic
1031605981 7:123768603-123768625 CTGAAGTGCTGCCATAAGGTTGG - Intergenic
1034600525 7:152249577-152249599 CTGTAGTCTTTCAATAAAGTGGG - Intronic
1047137407 8:122095966-122095988 CTGGATTCCAGAACTAATGTGGG - Intergenic
1048302061 8:133259167-133259189 CTGGAGTCCTTCAACAGTTTGGG - Exonic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1058735245 9:107888183-107888205 CTGGACTCATGAAATAATTTGGG + Intergenic
1059520774 9:114939822-114939844 ATGAAGCCCTGCAATAAGGTAGG + Intergenic
1203585188 Un_KI270746v1:62055-62077 CTGTAGTCTTTCAATAAAGTGGG - Intergenic
1189342809 X:40217471-40217493 CTGGAGTTCTGCAACCATCTTGG - Intergenic
1193726093 X:85041281-85041303 CTGGAGGCCAGCAATATTTTGGG + Intronic
1194140291 X:90200795-90200817 CTTGTGTCCTGCAATATTTTTGG + Intergenic
1195153241 X:102096057-102096079 CTGGTGTTCTGCAGCAATGTAGG + Intergenic