ID: 931523597

View in Genome Browser
Species Human (GRCh38)
Location 2:63127728-63127750
Sequence GGAGTAATACATATAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931523597_931523604 3 Left 931523597 2:63127728-63127750 CCCTATTCTATATGTATTACTCC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 931523604 2:63127754-63127776 CTTTGGGTGATAGTAAAAACAGG 0: 1
1: 0
2: 2
3: 12
4: 144
931523597_931523605 15 Left 931523597 2:63127728-63127750 CCCTATTCTATATGTATTACTCC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 931523605 2:63127766-63127788 GTAAAAACAGGAAGTGCAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931523597 Original CRISPR GGAGTAATACATATAGAATA GGG (reversed) Intronic
909261917 1:73500931-73500953 GGAGTAATGCATTTTGAAGATGG - Intergenic
910155337 1:84211500-84211522 GAAGTAATAACTAGAGAATAAGG - Intronic
911373010 1:97016831-97016853 GGAGTATTTCACATAAAATAAGG - Intergenic
912330258 1:108813785-108813807 GGAAAATTACATTTAGAATATGG + Intergenic
914246882 1:145892785-145892807 GGAGCAATGAATGTAGAATAAGG - Exonic
914352070 1:146848862-146848884 AAAGTAATACATATAAAAGAAGG - Intergenic
915704340 1:157829547-157829569 GGAGTAATAGAAATAGAAATAGG + Intergenic
915890073 1:159765202-159765224 AGAAAAATACATATAAAATACGG + Intergenic
916700423 1:167287692-167287714 GGAGTTACACAGAAAGAATAGGG + Intronic
916933754 1:169606446-169606468 GGAGAAATAGACTTAGAATAAGG - Intronic
917599755 1:176562313-176562335 GGTGTCATCCACATAGAATATGG + Intronic
918505544 1:185249922-185249944 GAAGTAATACAAAAAGAAAAAGG - Intronic
918906921 1:190508116-190508138 TAAGTAAAACATATAGAGTAAGG + Intergenic
921572850 1:216799339-216799361 GGGGAAATACTTTTAGAATATGG - Intronic
922679602 1:227580974-227580996 AGAGTGATACATTTAGAGTATGG + Intronic
924070128 1:240268503-240268525 ACAGTAATTAATATAGAATATGG - Intronic
1063248000 10:4243469-4243491 GGAGTAAAACACAGAGGATAAGG + Intergenic
1068439608 10:57033839-57033861 GGAGTATTAAATATGGATTAAGG + Intergenic
1068926187 10:62541675-62541697 AGACTAATACATATATAATCTGG + Intronic
1068998358 10:63235165-63235187 GGCAAAATACTTATAGAATAAGG - Intronic
1071474777 10:86016772-86016794 GGAATAATACACATAAAAGAGGG - Intronic
1073791438 10:106944033-106944055 GGAGTATGACATATAGAGTGTGG - Intronic
1074851703 10:117444410-117444432 GGACTAATACATATATTATGGGG + Intergenic
1075927713 10:126266573-126266595 GGACTAATACATAAGGGATATGG - Intronic
1078971892 11:16423539-16423561 GCAATAATACATAAAGAAAAAGG + Intronic
1079108918 11:17592940-17592962 GTATTAATAAATATATAATAGGG - Intronic
1079304257 11:19308550-19308572 GGAGCTATACACATAGGATAAGG + Intergenic
1079993126 11:27267271-27267293 GTATTAATACATTTAGAAAATGG + Intergenic
1080190568 11:29541931-29541953 GGAAGAATACATATAGTATGTGG + Intergenic
1081292419 11:41343026-41343048 AGAGAAATACATAGAGAAAAGGG - Intronic
1081444517 11:43117670-43117692 GGATTAATATACATAGTATATGG - Intergenic
1082647355 11:55744497-55744519 GAACTAATAAATATACAATATGG + Intergenic
1086756369 11:90568112-90568134 GCAGTAACACAGATAAAATAGGG + Intergenic
1087112081 11:94481364-94481386 TTAGTAATAAATAAAGAATATGG - Intronic
1087710880 11:101549580-101549602 AGAGAAAAACATATTGAATAAGG + Intronic
1088703541 11:112437706-112437728 GGAGGAATAAATAGAGCATAAGG + Intergenic
1088929497 11:114336771-114336793 GAAGTAATACACACTGAATAAGG + Intergenic
1088947258 11:114526744-114526766 GAAGTAATACAAATTTAATACGG - Intronic
1090219161 11:125000918-125000940 AGAGAAATATATATAAAATAAGG - Intronic
1093903660 12:24664050-24664072 GTAGTAATATTTATAGAAAATGG - Intergenic
1094299583 12:28947552-28947574 TGACTAATACATACAAAATAGGG - Intergenic
1095516986 12:43016633-43016655 GGAGTAATTTATAAAGAAAAGGG - Intergenic
1095562072 12:43577094-43577116 GGAGTATTATATATGGAATAAGG + Intergenic
1095736238 12:45559382-45559404 TGAGTAAAACATACAGACTAAGG + Intergenic
1097542884 12:60962396-60962418 AGTGTGATACATATATAATATGG + Intergenic
1097864456 12:64547972-64547994 GAAGAAATACATATAGACAATGG - Intergenic
1098536225 12:71596312-71596334 GGAGAAATATTTATAGAATTGGG + Intergenic
1098636653 12:72792402-72792424 CAAGTAAAACATTTAGAATAGGG + Intergenic
1099883084 12:88492301-88492323 GGAGAAATGGATACAGAATAAGG - Intergenic
1100118530 12:91340324-91340346 GGAGTGAGCCATATAGAATAAGG + Intergenic
1101177551 12:102170871-102170893 AGAGAAAAGCATATAGAATAAGG - Intronic
1104082746 12:125445371-125445393 GGAGTAATACATTTATAACTGGG - Intronic
1107008784 13:35646574-35646596 AGAGTCATACATAGAGAAGATGG - Intronic
1108242016 13:48474830-48474852 ACAGTAATGCATATTGAATATGG - Intronic
1108538142 13:51407571-51407593 AGAGGAAAAAATATAGAATACGG + Intronic
1109072015 13:57782075-57782097 GGAAGAAGAAATATAGAATAAGG + Intergenic
1109794913 13:67298429-67298451 GGAGAAATGCATATAAAAGAAGG - Intergenic
1110432412 13:75440479-75440501 GAAGGAATACATATTGAAGAGGG + Intronic
1110917573 13:81042255-81042277 GGAGTAATTCATAATGAGTATGG + Intergenic
1111053695 13:82920156-82920178 GGAGTAATACACAGAGACTTGGG - Intergenic
1111251500 13:85607574-85607596 GGAGAAATGGAGATAGAATATGG + Intergenic
1111299525 13:86329539-86329561 GGAGTAATAGAAAGAGAAGACGG - Intergenic
1111793805 13:92891826-92891848 GAAGTACTAAATATAGATTAAGG - Intergenic
1111884079 13:93996843-93996865 ATAGTTATACATATAGAATTGGG + Intronic
1112550060 13:100411005-100411027 GGAGTTGCAAATATAGAATAGGG + Intronic
1112969174 13:105238126-105238148 TGAAAAATACATATAAAATAAGG - Intergenic
1113695981 13:112345878-112345900 GGAGAACTACATAATGAATATGG - Intergenic
1115919748 14:38359510-38359532 GGAGTAATTTATAAAGAAAAGGG + Intergenic
1116164019 14:41310773-41310795 GGAGTAATACATACAGTAAGTGG + Intergenic
1116779505 14:49220853-49220875 TGAGTAAAACAGAGAGAATAAGG + Intergenic
1117315968 14:54570482-54570504 GGGGTAACACATTTAGAATGGGG + Intronic
1119148986 14:72341036-72341058 GGAATAAAAAATATAGAACATGG + Intronic
1121179495 14:91918066-91918088 GGAGTGTCACATCTAGAATAAGG + Intronic
1121528792 14:94638278-94638300 GGAGTAACACAGACTGAATAAGG - Intergenic
1125118571 15:36124918-36124940 ATGGAAATACATATAGAATATGG - Intergenic
1126704149 15:51392119-51392141 GGAGTAATAAATATTCAAAATGG - Intronic
1127104747 15:55601004-55601026 GTACTAATACATATAGAACGTGG - Intergenic
1127286780 15:57539793-57539815 GGAGCAATATATAAAGAATAAGG - Intronic
1129020374 15:72511760-72511782 GGAGTCTTACAAATACAATATGG - Intronic
1131424866 15:92337531-92337553 GTATTAATACATAAAGCATAAGG - Intergenic
1132366112 15:101258138-101258160 GGAGGAACACATATAAAACAAGG - Intergenic
1136172244 16:28496194-28496216 GGAGTCAGACAGACAGAATATGG + Exonic
1137019023 16:35404831-35404853 GGAGTAATACAAATTCAGTATGG + Intergenic
1139073264 16:63410543-63410565 GTAGTAATATATAAGGAATATGG - Intergenic
1139098070 16:63729916-63729938 AAAGTAATATATATAGAATTTGG - Intergenic
1139981961 16:70866670-70866692 AAAGTAATACATATAAAAGAAGG + Intronic
1140081949 16:71756561-71756583 GGTGTAATAAAAGTAGAATATGG - Intronic
1143762235 17:9113341-9113363 GCAGAAATACATATAAAAAAAGG + Intronic
1144492112 17:15722064-15722086 GTAGTAATATATATAAAATGTGG + Intergenic
1144908361 17:18657136-18657158 GTAGTAATAAATATAAAATGTGG - Intronic
1145958914 17:28874276-28874298 TGATTAATACATAGAAAATAGGG - Intergenic
1148937131 17:51172344-51172366 GGAGTGAAACATACAGACTAGGG + Intergenic
1151558249 17:74858116-74858138 AGAGAAATACATTTAGAAAAAGG - Intronic
1153977741 18:10284315-10284337 GGAGAAATACACAAAAAATATGG + Intergenic
1155109329 18:22698387-22698409 GTAGTAATCCATATTGATTACGG + Intergenic
1155654720 18:28178652-28178674 GTAGTAATAGAAATAGAAAACGG - Intergenic
1155852081 18:30786519-30786541 GCATTAATTCATTTAGAATAAGG + Intergenic
1156670002 18:39457052-39457074 GGAGTATTGCACATAGAAGAGGG + Intergenic
1157056157 18:44231391-44231413 AAAGAAATACAGATAGAATATGG - Intergenic
1158215771 18:55099205-55099227 TGGGTAATACATAAAGAATTAGG + Intergenic
1159293895 18:66455877-66455899 GGAGTAATAAAAAGATAATAGGG - Intergenic
1159478254 18:68952555-68952577 TGAGTAAAACCTAAAGAATAGGG - Intronic
1160441598 18:78897296-78897318 TGTGTAATACAAATAAAATAAGG + Intergenic
1164896453 19:31881504-31881526 TGGGTAATACATAAAGAAAACGG + Intergenic
1166318929 19:42004381-42004403 GAAGAAATAAGTATAGAATAGGG - Intronic
925248694 2:2410107-2410129 GGAGTTATAAATATAGGATGTGG + Intergenic
925486723 2:4342673-4342695 GTAGTTATACATATATAATTAGG + Intergenic
928404169 2:31001743-31001765 GGAATACTAGATATAGAATAAGG + Intronic
931523597 2:63127728-63127750 GGAGTAATACATATAGAATAGGG - Intronic
932626991 2:73305355-73305377 GAAGTAATAAATATGGAAAAGGG + Intergenic
935672250 2:105565857-105565879 GCAGAGAAACATATAGAATAGGG + Intergenic
937315458 2:120929333-120929355 GGGGTAATACTTAGAGGATATGG + Intronic
937380061 2:121368286-121368308 GCAGGAATACATATAGTACAAGG - Intronic
939229160 2:139404897-139404919 GGGAAAATACTTATAGAATAGGG - Intergenic
939720197 2:145640229-145640251 TGTGTAATAGATATAGAATTAGG - Intergenic
940108355 2:150123823-150123845 GGAATAATATATAGAGAATCTGG - Intergenic
940642292 2:156358399-156358421 GGAGTAACAGGTATGGAATAAGG - Intergenic
942442839 2:176053938-176053960 GCTGTAATACTGATAGAATAAGG - Intergenic
944441408 2:199747375-199747397 GGAGTAATAACTATGGTATATGG + Intergenic
944819124 2:203411561-203411583 AGACAAATACATATAAAATAAGG + Intronic
944995535 2:205289535-205289557 AGAGTAACACAAATAGTATATGG + Intronic
945206626 2:207339893-207339915 AAAGTATTACATATAGAAAAGGG + Intergenic
945933011 2:215874842-215874864 GGAGTAGTATAGATAGAATTTGG + Intergenic
1168732048 20:92939-92961 GGAGAGATTAATATAGAATAGGG - Intronic
1170412888 20:16109385-16109407 GGAAGAATACATATTGAACAAGG - Intergenic
1173934046 20:46845824-46845846 TGAGTAATATATAAAGAAAAGGG + Intergenic
1176342689 21:5713397-5713419 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176474943 21:7145548-7145570 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176502138 21:7611059-7611081 GGAGTAATACACAGAGAAGGAGG + Intergenic
1176537010 21:8111466-8111488 GGAGTAATACACAGAGAAGGAGG - Intergenic
1177021257 21:15861021-15861043 GAAGTTATAAATTTAGAATATGG + Intronic
1177939566 21:27391894-27391916 GGCACAATACATATAAAATATGG - Intergenic
1179160300 21:38890726-38890748 GGACTAATACACAGAGATTATGG - Intergenic
1203241961 22_KI270733v1_random:27870-27892 GGAGTAATACACAGAGAAGGAGG - Intergenic
949219274 3:1610164-1610186 GAACAAATATATATAGAATATGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951941580 3:28085212-28085234 GGAGAAATACTTCTAGAATGAGG - Intergenic
953650261 3:44796191-44796213 GGCTTAATAAATATAGCATATGG + Intronic
954006581 3:47596138-47596160 GGAGTCATGCATGTAGAACAAGG + Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
956360846 3:68445007-68445029 TGAGTAATTCAAAAAGAATATGG + Intronic
958138347 3:89527091-89527113 GGAGCAATACATATGTAAGAGGG - Intergenic
960360476 3:116705086-116705108 GGAGTATTAAATAGAGAAGAGGG + Intronic
961123002 3:124389742-124389764 TCAATAACACATATAGAATAAGG + Intronic
964102465 3:153004038-153004060 GAAGCAATAAATATAGTATATGG + Intergenic
964108512 3:153064705-153064727 GAAGTAAAACATATAAAATGAGG - Intergenic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
965926106 3:173982530-173982552 GACGTAATAAATTTAGAATAAGG + Intronic
966480590 3:180404132-180404154 GAAGTGATACATAGAGAATAGGG + Intergenic
971740208 4:30509633-30509655 TGACTAATACATATGGAAAAGGG + Intergenic
971792719 4:31189120-31189142 GGATTAATCTATATAGATTAGGG - Intergenic
972387515 4:38581562-38581584 AGAGTAATACTTATAGAAAGGGG + Intergenic
974266648 4:59594488-59594510 GGAATAATTCATATGAAATATGG - Intergenic
974737623 4:65958490-65958512 TGAGTAAGACACATAGAAAATGG + Intergenic
974983082 4:68986064-68986086 GGACTAATAAATAAGGAATAAGG + Intergenic
974989581 4:69068824-69068846 GGACTAATAGACAAAGAATAAGG - Intronic
975445902 4:74465225-74465247 TGAGTAGTTAATATAGAATAGGG - Intergenic
976908610 4:90271761-90271783 GGACTAATACATATATAATCTGG - Intronic
978253054 4:106656630-106656652 GGTGTGATACATGTAGAGTATGG - Intergenic
978419981 4:108521440-108521462 GGACTAATACATAGAAAAAATGG + Intergenic
979497887 4:121405252-121405274 AAAGTAAGACATATAGCATATGG - Intergenic
979628323 4:122871696-122871718 GGAGCAAATCAGATAGAATAGGG + Intronic
979943441 4:126793156-126793178 AGAGATATACATATAAAATAGGG + Intergenic
981114930 4:140978698-140978720 GGAGTGATGAATATAGAATAAGG + Intronic
981301158 4:143186664-143186686 GGAGGAATACAGATAGAATGAGG + Intronic
982589408 4:157286769-157286791 AGAGTAATACCTACAAAATAAGG - Intronic
984595345 4:181660764-181660786 GGTGTAAAACATATTGAATGAGG - Intergenic
986499799 5:8386879-8386901 TGAATAATACATACATAATACGG + Intergenic
986805876 5:11308760-11308782 GGACTAATACAGATAGACTGTGG - Intronic
988236272 5:28550007-28550029 GGACTAATCCACATACAATATGG - Intergenic
988831965 5:34996644-34996666 TGAAGAATACAAATAGAATAGGG - Intergenic
989666395 5:43859118-43859140 GATGTAATACCTATAGAAAATGG + Intergenic
990787102 5:59433924-59433946 GGAATAATACATATTAATTAAGG + Intronic
990938407 5:61174958-61174980 GGAGTTATAAATATGGAAAAGGG - Intergenic
994667841 5:102728248-102728270 GGAGTAATACATTTTGAAGATGG + Intergenic
996580367 5:125025600-125025622 GCAGGGATAGATATAGAATAGGG + Intergenic
997324357 5:133007757-133007779 GGATTAATACATATAATAAATGG + Intronic
998291519 5:140919498-140919520 GAATTAAAACATATAGAAAAAGG - Intronic
998536651 5:142938806-142938828 GGACTAATACATCTAAAATAAGG - Intronic
998563705 5:143196486-143196508 GCAGAAATACATATAAAACAGGG - Intronic
999545804 5:152627223-152627245 GTAGTACTACATAAAGAAAAGGG - Intergenic
1000905867 5:166964862-166964884 GGACTAATACCTATAGTTTAAGG - Intergenic
1008713221 6:54255106-54255128 GGAGTATGACATATAGTAAAGGG - Intronic
1015067186 6:129044892-129044914 CAAGTAACACATATTGAATATGG + Intronic
1015127806 6:129773631-129773653 CGAGTAATAAATAAAGAGTATGG - Intergenic
1016422184 6:143897017-143897039 GGAGTAAGAAATAAAGGATAAGG + Intronic
1016429462 6:143967364-143967386 GGAGTAATATATATATATAATGG + Intronic
1017463114 6:154670138-154670160 TGATTAATACATAGAAAATATGG - Intergenic
1018633220 6:165838294-165838316 GAAATAATACATATAAACTAGGG + Intronic
1019686902 7:2387067-2387089 GGAGAAAAACATAAAGAAAAGGG + Intergenic
1021090038 7:16472620-16472642 GGAGAAATAAATATAGCAGAAGG - Intronic
1021335186 7:19391946-19391968 GTATTAATACATACAGAATCAGG + Intergenic
1023721303 7:43098047-43098069 GAAGTAATACATTAAGAATGGGG + Intergenic
1027521202 7:79210709-79210731 GGAGTAGAAAAAATAGAATAAGG - Intronic
1028095731 7:86758024-86758046 GCAGTAATAAATACAGAATTAGG - Intronic
1029047901 7:97650488-97650510 AGAGAAATACATATAAAACAAGG + Intergenic
1030077768 7:105751255-105751277 GGAGTTATGCATATAGGAAAAGG + Intronic
1030660502 7:112213353-112213375 GGACTAATACATTTTGTATAAGG + Intronic
1031012482 7:116538220-116538242 GGAGAAATGCCTATGGAATATGG + Intronic
1031358531 7:120818520-120818542 GGAGTATAAGATATAGAAAATGG + Intronic
1031499043 7:122488907-122488929 TGGGTAATACACATAGAGTATGG - Intronic
1031640582 7:124159032-124159054 AGAATAATTCGTATAGAATAAGG - Intergenic
1031649255 7:124266063-124266085 GGATAAATAGCTATAGAATAAGG + Intergenic
1035190246 7:157161225-157161247 TGAGTAAGACATATGGGATAAGG + Intronic
1036399061 8:8392280-8392302 AGACTAATACATATAGAAAAGGG - Intergenic
1038083768 8:24171408-24171430 GTATTAATATATATAGTATAAGG - Intergenic
1038703523 8:29873257-29873279 GGACTAATACAGAGGGAATATGG + Intergenic
1040449744 8:47532543-47532565 GGAGTATTACATAATGAAAAAGG + Intronic
1041321651 8:56619918-56619940 GGAGTCATACATATTAAAAATGG - Intergenic
1041948035 8:63468965-63468987 GGAGTAACACACAAAGCATACGG - Intergenic
1045147947 8:99368869-99368891 GCAAAAATACATAGAGAATATGG - Intronic
1045807194 8:106176911-106176933 TGAGTAATACACAAAGAATAAGG + Intergenic
1047165197 8:122431013-122431035 GGAGTTATAGATATAGACTAAGG + Intergenic
1048195215 8:132326982-132327004 TGAGCAGTAAATATAGAATATGG - Intronic
1048761783 8:137803533-137803555 AGAAAAACACATATAGAATAAGG - Intergenic
1050256654 9:3799402-3799424 GGGGTAAAAGATATAGAAAATGG + Intergenic
1050272457 9:3960408-3960430 GGAGAAATACATAGAAAATGTGG - Intronic
1051048279 9:12901495-12901517 GGAGTTACAAATACAGAATAGGG - Intergenic
1052167083 9:25344762-25344784 GTATTAATACATAAAAAATATGG + Intergenic
1056670217 9:88621436-88621458 GTACTCATACATATACAATATGG - Intergenic
1057000007 9:91499830-91499852 TTAGTAATACATTTAAAATAGGG + Intergenic
1059538982 9:115112044-115112066 GCAGTAATAGATAATGAATACGG + Intronic
1061897114 9:133654031-133654053 GGATTAAAACACAAAGAATAGGG - Intronic
1203458278 Un_GL000220v1:10947-10969 GGAGTAATACACAGAGAAGGAGG - Intergenic
1186786547 X:12961582-12961604 GGATACATACATATAGAATATGG - Intergenic
1188617144 X:32171426-32171448 GGATTAATAAATACAAAATAAGG - Intronic
1188696400 X:33197001-33197023 AAAGTAGGACATATAGAATACGG + Intronic
1189785937 X:44558863-44558885 GGAATATTACACATAGAATTGGG - Intergenic
1192929053 X:75785422-75785444 GGAGTAACAGATATAGCAAAAGG + Intergenic
1194935846 X:99947638-99947660 GGAGAAATTGATAAAGAATATGG + Intergenic
1196643667 X:118093163-118093185 GAAGAAATACATAAAGAATGAGG - Intronic
1197161912 X:123333307-123333329 GAGGTAATTCATATAGAAGAAGG + Intronic
1198382330 X:136095691-136095713 GGAGAAAAGCTTATAGAATAAGG - Intergenic