ID: 931528016

View in Genome Browser
Species Human (GRCh38)
Location 2:63179482-63179504
Sequence CTGGAGAAGGAGAAAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2678
Summary {0: 1, 1: 7, 2: 35, 3: 370, 4: 2265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931528016_931528025 16 Left 931528016 2:63179482-63179504 CCCTTCTCTTTCTCCTTCTCCAG 0: 1
1: 7
2: 35
3: 370
4: 2265
Right 931528025 2:63179521-63179543 CCATTTCACCTTCTGCCATGAGG 0: 1
1: 0
2: 11
3: 64
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931528016 Original CRISPR CTGGAGAAGGAGAAAGAGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr