ID: 931535527

View in Genome Browser
Species Human (GRCh38)
Location 2:63271575-63271597
Sequence ACATGCACCATTGTGGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931535522_931535527 -2 Left 931535522 2:63271554-63271576 CCATCACTGTCACTGGTGCCTAC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 88
931535521_931535527 -1 Left 931535521 2:63271553-63271575 CCCATCACTGTCACTGGTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 158
Right 931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 88
931535519_931535527 16 Left 931535519 2:63271536-63271558 CCTTGGGACTGACTCATCCCATC 0: 1
1: 0
2: 0
3: 23
4: 169
Right 931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 88
931535518_931535527 27 Left 931535518 2:63271525-63271547 CCATCTAGGGTCCTTGGGACTGA 0: 1
1: 0
2: 0
3: 8
4: 167
Right 931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931535527 Original CRISPR ACATGCACCATTGTGGTGCG GGG Intronic
911694658 1:100876315-100876337 ACATGTACCATTGTGGTAGGAGG - Intronic
915761148 1:158314727-158314749 ACATGTGCCATGCTGGTGCGCGG + Intergenic
916398233 1:164415319-164415341 ATATGCACCATTTTGATGGGAGG - Intergenic
916479913 1:165205856-165205878 ACATGCACCCTTATGGTAAGAGG - Exonic
917002651 1:170376296-170376318 ACATGCACACATGTGGTGTGTGG - Intergenic
1067347979 10:45451658-45451680 AAATGCACCACTGTGGGGGGGGG + Intergenic
1068825269 10:61430758-61430780 AAACGCACCACTGTGGTGCAGGG + Intronic
1069926275 10:71852734-71852756 ACATGGCCCACTGTGGTGCATGG - Intergenic
1073689183 10:105788351-105788373 AGATGCACCATATTGGTGCTGGG + Intergenic
1081821280 11:45998062-45998084 ACATGTACCACTGTGGAGAGAGG + Intronic
1082246980 11:49935224-49935246 ACGTGTACCACTGTGGTGTGTGG + Intergenic
1087985037 11:104668230-104668252 GCATGCACCTTTGTGGTGCGTGG + Intergenic
1104287280 12:127435182-127435204 ACATGTGCCATGGTGGTGTGTGG + Intergenic
1108243227 13:48488596-48488618 AAATGCACCACTCTGGTGGGGGG + Intergenic
1108552799 13:51563438-51563460 AAATGTACCACTGTGGTGGGGGG + Intergenic
1109185332 13:59261234-59261256 ACATGTCTCTTTGTGGTGCGAGG + Intergenic
1114293063 14:21304692-21304714 AAATGCACCACTCTGGTACGGGG - Intronic
1117259174 14:54012693-54012715 AAATGTACCACTGTGGTGCAAGG - Intergenic
1118856458 14:69627121-69627143 ACTTCCACCATGGTGGTGGGAGG - Intronic
1121018136 14:90561087-90561109 CCATGCATCTGTGTGGTGCGGGG + Intronic
1122389344 14:101369703-101369725 ACATGCTGCATTGGGGTGAGCGG + Intergenic
1125086131 15:35732214-35732236 ACAAGCACCATTATGGTCAGTGG + Intergenic
1131634258 15:94213244-94213266 ACATGTGCCATGTTGGTGCGCGG - Intergenic
1133528799 16:6633137-6633159 ACGTGCACCCCTGTGCTGCGTGG + Intronic
1135869203 16:26133866-26133888 AAATGCACCACTTTGGTGCAAGG + Intronic
1137679979 16:50333095-50333117 ACATACACCATTTTGTTACGTGG - Intronic
1141300178 16:82807749-82807771 AAATGCTCCATTGTGGTGTTTGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142082134 16:88155066-88155088 ACCAGCAGCATTGTGGTGCCCGG - Intergenic
1146282270 17:31552361-31552383 ACATGCACCCCTGTGGAGCCAGG + Intergenic
1146642408 17:34551225-34551247 ACATGCACCATGGTGCTTCCAGG - Intergenic
1148879698 17:50716414-50716436 ACATGCACCATTATAGTTTGTGG + Intergenic
1149391374 17:56194781-56194803 AAATGCACCACTCTGGTGAGGGG + Intronic
1155334846 18:24753047-24753069 AAATGCACCATTTGGGTGCTTGG + Intergenic
1155925108 18:31647706-31647728 ACATTCATCATTGTGGGGAGTGG + Intronic
1157457993 18:47854809-47854831 AAATGGACCATTGTGGTTTGCGG - Intronic
1157527622 18:48396809-48396831 ACAACCACCATTGTGGCTCGTGG - Intronic
1160226297 18:77014095-77014117 ACATGCTCCTTTGTTGTGAGAGG - Exonic
1164346788 19:27273106-27273128 ACATGTGCCATGCTGGTGCGCGG - Intergenic
930771938 2:55137910-55137932 ACATGCACTATTGCGGTGTGGGG - Intergenic
931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG + Intronic
935597537 2:104890791-104890813 ACATGCACCCATGTGGCCCGCGG - Intergenic
940994974 2:160138940-160138962 ACTATCACCATTGTGGTGCCAGG - Intronic
942287024 2:174429574-174429596 AAATGTACCATTCTGGTGCTGGG - Exonic
942460373 2:176164154-176164176 ACATACATAATTGTGGTGAGTGG + Intronic
945163739 2:206920358-206920380 ATCTGCACCCTTGTGGTGCCTGG - Intergenic
946690871 2:222307287-222307309 ACCTGCCCCATTGTGCTGCTGGG + Intergenic
947308901 2:228778757-228778779 ACATGCACCACTCTGTTGCCCGG + Intergenic
947944435 2:234089511-234089533 AAATGCACCACTGTGGTGTGTGG + Intergenic
948694340 2:239725665-239725687 ATTTGCACCTTTGTGGTGCCTGG + Intergenic
949006614 2:241653004-241653026 ACATGCACCATGGAACTGCGCGG - Intronic
1175390742 20:58625808-58625830 ACATGCAACACAGTGGTGCTTGG + Intergenic
1176696745 21:9986824-9986846 ACATTCACTATTTTGGTGTGTGG + Intergenic
1184732032 22:46375987-46376009 ACGTTCACCACTGTGGTGCAGGG - Intronic
950897423 3:16466133-16466155 AGATGCAAGATTGTGGTGCATGG - Intronic
955105486 3:55893603-55893625 ACATCCACCATTTTGGTCCAAGG + Intronic
955936423 3:64107106-64107128 ACCTGCACCCCTGTGGTGCATGG - Intronic
957664896 3:83215292-83215314 AAATGCACCACTCTGGTGGGGGG + Intergenic
959665883 3:108920890-108920912 AAATGTACCATTCTGGTGGGAGG - Intronic
964201311 3:154121778-154121800 AACTGCACCACTGCGGTGCGCGG - Intronic
966249395 3:177846152-177846174 AAATGCACCACTCTGGTGGGGGG + Intergenic
975740472 4:77424757-77424779 AGATGGACCACTGTGGTGGGGGG + Intronic
977828296 4:101559270-101559292 ACATGTGCCATTGTGGTTTGCGG - Intronic
979902142 4:126235316-126235338 AAATGTACCATTGTGGTGAGAGG - Intergenic
983364089 4:166764262-166764284 ACATGTACCATGTTGGTGTGCGG + Intronic
984152982 4:176157536-176157558 ACATTCACAATTGTGCTGTGAGG - Intronic
986404114 5:7408303-7408325 ACATCAACATTTGTGGTGCGTGG - Intronic
988012546 5:25508085-25508107 ACATGTGCCATGCTGGTGCGCGG - Intergenic
988426258 5:31068490-31068512 ACATGGAAAATTGTGGTGGGAGG - Intergenic
990896788 5:60708341-60708363 AAATGCACCACTGTGGTGGAGGG - Intergenic
994013649 5:94938911-94938933 ACATGCACCCTTGTGCAGAGGGG - Intronic
997234749 5:132266314-132266336 ACAGTCACCATTGTGGTACAGGG + Intronic
998005873 5:138656708-138656730 ATAATCACCATTGTGGAGCGTGG + Intronic
1005711940 6:28511642-28511664 CAATGCACCATCGTGGTGAGAGG + Intronic
1006421574 6:33937465-33937487 ACATGTACCACTCTGGTGCAGGG - Intergenic
1010522921 6:76863184-76863206 ATATGCATAATTGTGGTGAGAGG + Intergenic
1011557462 6:88585869-88585891 ACATGCACCTGTGTGGTGTTTGG + Intergenic
1011988693 6:93483919-93483941 ACATGCGCCATGGTGGTTTGTGG - Intergenic
1011999062 6:93631660-93631682 ACATGTGCCATGCTGGTGCGCGG + Intergenic
1017076796 6:150626134-150626156 ACATAGGCCATTGTGGGGCGGGG + Intronic
1026454992 7:70563563-70563585 TCATGCACCCTTGAGGTGAGTGG + Intronic
1028940527 7:96517265-96517287 AAATGTACCATTCTGGTGGGAGG + Intronic
1028968473 7:96829225-96829247 ACATGTGCCATGCTGGTGCGCGG + Intergenic
1033231610 7:139602768-139602790 ACATGCACCATCGCAGTGCCCGG - Intronic
1040347105 8:46515434-46515456 ACATGCACCATGTTGGTGTGCGG + Intergenic
1045172875 8:99689715-99689737 TCAGGCACCATTGTGGTCCCAGG - Intronic
1053069362 9:35092027-35092049 ATATGCACCATTGTGCCGTGGGG + Exonic
1053633722 9:39972670-39972692 ACATTCACTATTTTGGTGTGTGG + Intergenic
1053772028 9:41490830-41490852 ACATTCACTATTTTGGTGTGTGG - Intergenic
1054210165 9:62278027-62278049 ACATTCACTATTTTGGTGTGTGG - Intergenic
1054314826 9:63570900-63570922 ACATTCACTATTTTGGTGTGTGG + Intergenic
1057819113 9:98317718-98317740 TCATGCACCATGTTGGTGTGGGG + Intronic
1061435262 9:130557282-130557304 ACATACAGCATTGAGGTGCCAGG - Intergenic
1186765907 X:12770398-12770420 ACATGCACCAATGTGGGGGCCGG + Intergenic
1197071758 X:122307290-122307312 ACATGCGCCATGTTGGTGTGTGG - Intergenic