ID: 931545529

View in Genome Browser
Species Human (GRCh38)
Location 2:63380945-63380967
Sequence TTTTGGCAATGTAATAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931545525_931545529 8 Left 931545525 2:63380914-63380936 CCTACAGAATTCTATCCAAACAA 0: 1
1: 1
2: 2
3: 31
4: 260
Right 931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 296
931545527_931545529 -7 Left 931545527 2:63380929-63380951 CCAAACAACTTGTTTATTTTGGC 0: 1
1: 0
2: 0
3: 15
4: 237
Right 931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931545529 Original CRISPR TTTTGGCAATGTAATAAAGT GGG Intronic
902944995 1:19829128-19829150 TTTCCAAAATGTAATAAAGTTGG + Intergenic
902982554 1:20136143-20136165 TTTTGGCATTAGAATAATGTTGG + Intergenic
903391748 1:22969256-22969278 TTTTGGTTATAGAATAAAGTAGG + Intergenic
904113074 1:28141852-28141874 TTTTTGCAATGGAATCATGTTGG - Intergenic
905697143 1:39983070-39983092 TTATGCCACTGTAATCAAGTAGG - Intergenic
906041430 1:42790537-42790559 TTTTTGGAGTATAATAAAGTAGG + Intronic
909138041 1:71826787-71826809 TTTTAGAAATGTAATTATGTAGG - Intronic
909246708 1:73295157-73295179 TTTTGTCTATGTAACATAGTGGG + Intergenic
909296757 1:73959396-73959418 TTTTTGGAATCTAATAAAGATGG + Intergenic
909397307 1:75184831-75184853 TTTTGGAAAATTAATAAAATAGG + Intergenic
909753606 1:79195033-79195055 TTTTAGCAGTTTAATGAAGTTGG - Intergenic
910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG + Intergenic
910631339 1:89358085-89358107 TTTCTGCAATGTCATATAGTTGG + Intergenic
911397662 1:97332398-97332420 TTTTAGCAATATAATAAGGATGG + Intronic
911966552 1:104379473-104379495 TTTTGGTATTGGAATAATGTTGG - Intergenic
912010890 1:104960911-104960933 TTTTCAGAATGTAATACAGTTGG - Intergenic
912929981 1:113949338-113949360 TTTTGGCATTGTCATGAACTTGG + Intronic
915948082 1:160168783-160168805 GTTAGTCAATGTAATAAAATAGG + Intronic
917245762 1:172998606-172998628 CTTTAGCAATCTAATAAAATAGG + Intergenic
917616386 1:176749693-176749715 TTCTGGAAATGTCATATAGTTGG + Intronic
918830555 1:189391809-189391831 TTTTGCCTATGTTAAAAAGTAGG - Intergenic
919145804 1:193633227-193633249 AATTGTCAATGTAATGAAGTTGG + Intergenic
919166211 1:193897033-193897055 TTTTGAAAATTTTATAAAGTTGG + Intergenic
919261522 1:195201014-195201036 ATATTGCAATGTTATAAAGTAGG + Intergenic
919722983 1:200860868-200860890 TTAGGGCAATGTTAAAAAGTCGG + Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
921578578 1:216867978-216868000 TTTTGTGAATGTCATAAAATGGG + Intronic
921678010 1:217998416-217998438 TGTTTGGAAAGTAATAAAGTTGG + Intergenic
924045631 1:240026380-240026402 TTTTGGAAAAATAATAAAATTGG + Intronic
1062788690 10:286895-286917 TTTTGGCAAAATGATATAGTAGG + Intronic
1063182059 10:3611995-3612017 TTTTGTCTATGTTAAAAAGTAGG - Intergenic
1063794799 10:9501386-9501408 TTTTTCCAAAGTAAAAAAGTGGG - Intergenic
1064857706 10:19789483-19789505 TTTTATCTATTTAATAAAGTTGG - Intronic
1065659950 10:27995636-27995658 TATTGTCACTGTAAGAAAGTCGG - Intronic
1067856463 10:49797631-49797653 TTTTGTATATGTGATAAAGTAGG - Intergenic
1068476014 10:57526396-57526418 TTTTGGAAGTGAAATAAAATGGG - Intergenic
1070405996 10:76095842-76095864 TTTTGTCCATTTAAAAAAGTGGG + Intronic
1072923828 10:99598802-99598824 TCTTGGCAATGTAATTGTGTGGG + Intergenic
1074037619 10:109756840-109756862 TTGTTGCAAAGTAATCAAGTAGG - Intergenic
1075430590 10:122376666-122376688 TTTTAGCAGTGTAACAAAATAGG + Intronic
1075548888 10:123377580-123377602 CTTTGGCAAAGTAATAAGGTAGG - Intergenic
1075917130 10:126177776-126177798 TTGTTGCAATGTAAGAAAGCAGG - Intronic
1079877907 11:25883554-25883576 TTCTGGCAAAGAAATAAAATTGG + Intergenic
1080145103 11:28972723-28972745 TACTGGAAATGTAATAAAATAGG - Intergenic
1080220038 11:29892146-29892168 TTTTGGTAAAATATTAAAGTGGG + Intergenic
1082111581 11:48282057-48282079 TTTTGGAATAGTATTAAAGTTGG + Intergenic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086980588 11:93193401-93193423 TTTTGGCTAAGTACTAAATTGGG + Intronic
1087748998 11:101985193-101985215 TTTTGTCCATGAAATGAAGTTGG - Intronic
1088872462 11:113902683-113902705 ATGTGGCAATGTAGTAATGTTGG - Intergenic
1089361989 11:117896972-117896994 TCATGGCAATGTCATAAAGTAGG + Intergenic
1089956013 11:122571982-122572004 ATTTGGCAATATATTAAAATAGG - Intergenic
1090223464 11:125052484-125052506 TTCTGGCAATGTGATAAGATGGG - Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1091859919 12:3771738-3771760 TTATGACAATGTAATAAAACTGG + Intergenic
1092650332 12:10627773-10627795 ATTTGGAAAAGAAATAAAGTTGG + Intronic
1093504861 12:19853469-19853491 TTTTAGCAATGCAATAAAAAAGG + Intergenic
1093621355 12:21293644-21293666 TTTTATCATTGAAATAAAGTTGG - Intronic
1094071765 12:26423990-26424012 TTTTGGAAAAGGAATCAAGTGGG - Intronic
1095309569 12:40681949-40681971 ATTTGGCATTGAAATAAAATTGG - Intergenic
1096035251 12:48462396-48462418 TTTTGGCATCATAATAATGTTGG - Intergenic
1096724585 12:53550949-53550971 TTGGGGCAAGGTTATAAAGTTGG - Intronic
1097823529 12:64151862-64151884 TTTTTGGAATGAAACAAAGTGGG - Exonic
1098356893 12:69620511-69620533 TTCTTTCAATTTAATAAAGTGGG + Intergenic
1098695302 12:73545768-73545790 ATTTGGCAATTTGACAAAGTAGG - Intergenic
1099142085 12:78990744-78990766 TTCTGAAAATGTAATAAAGAAGG + Intronic
1100145240 12:91669800-91669822 ATTATGCAATGTAATTAAGTGGG - Intergenic
1101033662 12:100684461-100684483 TTTAGGCATTTTAATCAAGTGGG - Intergenic
1102090489 12:110183323-110183345 TTGTGGCAATTTAATAACATCGG - Intronic
1105745854 13:23376173-23376195 TTTTGGCAATATTATATTGTTGG + Intronic
1106538595 13:30670291-30670313 TTTTGGCTTAGTAATTAAGTAGG - Intergenic
1108419225 13:50232016-50232038 TTTTGGCAAAGCCATGAAGTTGG + Intronic
1109116413 13:58392516-58392538 TATTGGCAATGTTTTAATGTAGG + Intergenic
1109440528 13:62366029-62366051 GTTTGGCAATGTGATACAGGAGG + Intergenic
1109631334 13:65051442-65051464 TTTAGGCAATTTTATACAGTTGG - Intergenic
1109792066 13:67262032-67262054 TTTTGGAAATGCAACGAAGTTGG + Intergenic
1111510178 13:89250859-89250881 TTTTGGCAATAGACTAAAGTGGG - Intergenic
1113529357 13:111009699-111009721 TTAAGAAAATGTAATAAAGTTGG + Intergenic
1113780819 13:112976357-112976379 TTTTGGCAATATATTAGAGATGG + Intronic
1114988266 14:28256711-28256733 CTTTGTCAATGTAAAAAAATTGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116641713 14:47471975-47471997 TCAAGGCAATGTAATACAGTGGG + Intronic
1116914634 14:50511816-50511838 TTTTCGGAATGTCATAGAGTTGG - Intronic
1119021804 14:71122509-71122531 AGTTAGAAATGTAATAAAGTAGG - Intergenic
1119290145 14:73489230-73489252 ATTTGGCAATGTCATATAGGGGG - Intronic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1120584692 14:86297485-86297507 TTCTGGGAATGTAATCCAGTAGG + Intergenic
1120627312 14:86844556-86844578 ATTTGTCAATGTAATTAATTTGG + Intergenic
1120691631 14:87599276-87599298 ATTTTGCAATTTAATATAGTAGG - Intergenic
1122675542 14:103410025-103410047 TTTTGGTAGAATAATAAAGTAGG - Intronic
1122733809 14:103823000-103823022 TATGGGCAATGTGATATAGTAGG - Intronic
1123486226 15:20742045-20742067 GTTTGGCAATTTAAGCAAGTTGG + Intergenic
1123542718 15:21311097-21311119 GTTTGGCAATTTAAGCAAGTTGG + Intergenic
1123668298 15:22627889-22627911 CCTTGGCAATTTAATAAAGCAGG + Intergenic
1124524273 15:30434331-30434353 CCTTGGCAATTTAATAAAGCAGG + Intergenic
1124534393 15:30531891-30531913 CCTTGGCAATTTAATAAAGCAGG - Intergenic
1124764255 15:32475720-32475742 CCTTGGCAATTTAATAAAGCAGG + Intergenic
1124774380 15:32573382-32573404 CCTTGGCAATTTAATAAAGCAGG - Intergenic
1126253958 15:46602953-46602975 TTTTAGCAATGTAAAAAACTTGG - Intergenic
1126921629 15:53533009-53533031 TTGTGTCAATGTAAAAATGTAGG + Intronic
1127412551 15:58723734-58723756 TTTTTGCTATGATATAAAGTGGG - Intronic
1127449917 15:59106046-59106068 TTTCGGCAAAGGAAAAAAGTAGG - Intronic
1127610827 15:60634701-60634723 TTTTGAGAAGGTAAAAAAGTGGG - Intronic
1127705986 15:61547696-61547718 TTTTGGCAATATAGTCAGGTAGG + Intergenic
1131298274 15:91171775-91171797 TTTTGGCATTTTGACAAAGTCGG + Intronic
1131635213 15:94225923-94225945 ATTTTGCAAAGTAATGAAGTAGG + Intergenic
1131653349 15:94426987-94427009 TTCTGGCAATGTCACAGAGTTGG - Intronic
1131947295 15:97638572-97638594 TTTTGTCAATGAGATAAAATAGG - Intergenic
1132206560 15:99989832-99989854 TTTGGGCAATGAAATGAAATGGG + Intronic
1202951035 15_KI270727v1_random:38220-38242 GTTTGGCAATTTAAGCAAGTTGG + Intergenic
1133755899 16:8762192-8762214 TGTTGGCAATGTAATGAGATGGG - Intronic
1135202246 16:20448165-20448187 ATTTAGCAAGGAAATAAAGTAGG + Intergenic
1135216858 16:20579701-20579723 ATTTAGCAAGGAAATAAAGTAGG - Intergenic
1143080276 17:4376463-4376485 TTTTCGTATTTTAATAAAGTTGG + Intergenic
1146419877 17:32673485-32673507 TTTTGGCAATAAAATAAAATAGG + Intronic
1147735531 17:42635351-42635373 TTTTTAAAATGTAATAGAGTCGG - Intergenic
1149106220 17:52969914-52969936 ATTTGGCCATGAAATAAAGACGG - Intergenic
1149293910 17:55243364-55243386 TTTAGGCAATGAAATAAAGATGG - Intergenic
1155552913 18:26985332-26985354 TTTTGGCAAGAGAATAAATTTGG - Intronic
1155595064 18:27476332-27476354 TTATGGCAATGTGATAAAAATGG + Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156029412 18:32695076-32695098 TTTTATCAATATAATAACGTGGG - Intronic
1156208710 18:34914465-34914487 TTTTGGCTTTATATTAAAGTTGG + Intergenic
1159164070 18:64681037-64681059 TTTTGATAATGTCATAGAGTTGG + Intergenic
1159451691 18:68610971-68610993 TTTGGGAAATGTGAGAAAGTAGG - Intergenic
1162144680 19:8606361-8606383 TTTTGGAAATGAAATACGGTGGG - Intronic
1162607273 19:11719310-11719332 TTTTGATAATAAAATAAAGTGGG + Intergenic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165264172 19:34646619-34646641 TGTTGGGAAAGAAATAAAGTGGG - Intronic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1166780764 19:45341315-45341337 TTTTAGCAATGTGAAAACGTGGG + Intronic
925089867 2:1145708-1145730 TTTTGGTATTGTGATAAAGCTGG - Intronic
926390785 2:12390429-12390451 TTTTGTCAAGGGAAGAAAGTGGG + Intergenic
926511733 2:13789892-13789914 TTTTGGTAATATAATAAAAATGG + Intergenic
928832312 2:35502095-35502117 TTTTCACCATGTATTAAAGTAGG - Intergenic
929162698 2:38848772-38848794 TTTTGTCTGTGAAATAAAGTTGG + Intronic
929434224 2:41915128-41915150 TTTTAGCAATGAAATGAAGTGGG + Intergenic
929819495 2:45261888-45261910 TTGTGACAATATAATTAAGTGGG - Intergenic
930602448 2:53457765-53457787 TTTAGGTATTGTTATAAAGTTGG - Intergenic
931491020 2:62747692-62747714 TGTTGCCAATGTAATAGAATAGG + Intronic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
932031623 2:68192682-68192704 TGTTGGCAATGTAAAGAAGATGG - Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
935747390 2:106200642-106200664 ATGTGGCAATGTATTAGAGTTGG - Intergenic
937074754 2:119094436-119094458 TTTTGTAGATGTAATATAGTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
940569194 2:155408680-155408702 TTTTGGCAAAGTAATTAATATGG + Intergenic
941563204 2:167075508-167075530 CTTTAGCAATCTAATAAAATTGG - Intronic
941633527 2:167910168-167910190 TTTTGGGAATGTCATGTAGTTGG + Intergenic
941703795 2:168635655-168635677 TTTTAAAAATGTAATAAAATAGG - Intronic
944821394 2:203435736-203435758 TTTTGGTAATGTACAAAAATAGG + Exonic
945373662 2:209052717-209052739 TTCTGGCAATGTAACAAAACAGG + Intergenic
945726200 2:213474461-213474483 TGTGGGGAATGTAATAAAGCTGG - Intronic
946105058 2:217361869-217361891 TTTTGTTAAGGTAATAAGGTGGG - Intronic
946750048 2:222885177-222885199 CTTGGGCCATTTAATAAAGTAGG + Intronic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947381302 2:229547717-229547739 TTTTAGCCATCTAATAAAATGGG + Intronic
947481605 2:230505740-230505762 TTATGGAAATGTTATATAGTGGG - Intronic
947945759 2:234100737-234100759 TTTTGGAAATGTAATATTTTTGG + Intergenic
947954279 2:234174354-234174376 TTTTGGTAATTTAATAATGTTGG - Intergenic
948331914 2:237175817-237175839 TTTTGGCTACGTCAAAAAGTTGG + Intergenic
1168899190 20:1346262-1346284 TTTTGCCCATGTAAAAAATTAGG + Intronic
1169312138 20:4552821-4552843 TTTTGGCAATGAAATATATTAGG + Intergenic
1169434967 20:5578819-5578841 TTTTTGCAAAGTATTAAAATGGG + Intronic
1169553780 20:6728353-6728375 TTTTGGCAACATAAAAAAGGAGG - Intergenic
1171458436 20:25284979-25285001 ATTTTGTAATTTAATAAAGTAGG + Intronic
1175112510 20:56658460-56658482 ATTTGGCAATGTCATAACTTTGG + Intergenic
1177225656 21:18251133-18251155 TCTTGGCAATGATATAAAGTGGG - Intronic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1178025843 21:28465622-28465644 TTTTGGCAGAGAATTAAAGTAGG - Intergenic
1180690217 22:17708388-17708410 TTTTCCCAAAGTAATAAAGCTGG - Intronic
1181991269 22:26838771-26838793 TTGTAGCATGGTAATAAAGTTGG - Intergenic
1182181482 22:28353846-28353868 CTTTGGCTATGTAAAAAATTGGG - Intronic
1184159438 22:42689160-42689182 TTTTGGCAGTGGACTAAAGCTGG - Intergenic
949102981 3:168313-168335 TTTTTGCAATATAAAAAAATTGG + Intergenic
949325168 3:2855481-2855503 TTTTGAAAATGTAAAGAAGTAGG + Intronic
949902877 3:8834170-8834192 TCTTGGGAATGTCATATAGTTGG - Intronic
950087899 3:10273583-10273605 TTTTTTTAATGTAATAAAGATGG - Intronic
952360147 3:32622936-32622958 ATTTGGCAAGGTAGTAAACTTGG - Intergenic
952790368 3:37195682-37195704 TTTTAACAATGTATGAAAGTAGG - Intergenic
953114833 3:39982062-39982084 TCTTGGAAATGTAATAAGATAGG - Intronic
953461122 3:43081855-43081877 TTATGGCAGTGTCATAAAGAGGG - Intronic
956986311 3:74705023-74705045 TTTTGGTAAGCTAATAAAATTGG - Intergenic
957434789 3:80160999-80161021 TTTTTGCAATTTAATAGAGTTGG + Intergenic
957647205 3:82946333-82946355 AATTGACAATGTAATAAAATGGG - Intergenic
957863346 3:85989216-85989238 TTTTTGGAAACTAATAAAGTAGG + Intronic
958631390 3:96687695-96687717 ATTTAGCAATGAGATAAAGTGGG + Intergenic
960211781 3:114976775-114976797 CTTTGACAATGTAATCTAGTGGG - Intronic
962590579 3:136885860-136885882 TTTTTAGAATGTTATAAAGTTGG + Intronic
963068052 3:141279442-141279464 TTTTGGGAATGACATACAGTGGG - Exonic
964345641 3:155751888-155751910 TTTTGCCAAGGCAGTAAAGTGGG - Intergenic
964593035 3:158387979-158388001 TTTTGGCAGGCTAAGAAAGTTGG + Intronic
964688269 3:159421745-159421767 TTCTGGCAAAGTAATCAAATTGG + Intronic
965339494 3:167469705-167469727 TTTTGACAATGAAGTAAAGAAGG + Intronic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
970082980 4:12309791-12309813 TTTTGAAAATATAACAAAGTGGG - Intergenic
972584571 4:40425691-40425713 TTTTGGAAATGTATGAACGTAGG + Exonic
973303847 4:48620923-48620945 GTTTAGCCAAGTAATAAAGTTGG + Intronic
973922455 4:55702324-55702346 TTTTTTCAGTGTAATGAAGTAGG + Intergenic
974169219 4:58244846-58244868 TTTTGTCAAAGTTATAAAATAGG + Intergenic
974313599 4:60246848-60246870 TATTCGCAATGTAATATAATTGG - Intergenic
974652463 4:64772710-64772732 TTTTGGCACTGTAAGAAATGGGG + Intergenic
974835368 4:67242007-67242029 TATTGGTAATGTATTAATGTAGG + Intergenic
975868845 4:78755750-78755772 ATTTTTTAATGTAATAAAGTAGG - Intergenic
977588323 4:98799987-98800009 TTTTTGCAATGTTATAAAGATGG - Intergenic
978569335 4:110119120-110119142 TATTGGAATTGTAATAAAATAGG + Intronic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979150557 4:117309130-117309152 TGTGGGCTATGTAATTAAGTGGG + Intergenic
979343003 4:119550284-119550306 TTTTGGCTCTGTCATCAAGTAGG + Intronic
981432146 4:144673416-144673438 TTGTGGTAATGTAATGAAGAGGG + Intronic
982277056 4:153646843-153646865 TTTTAACAATGAAATAAGGTAGG - Intergenic
983015892 4:162611520-162611542 TATAGGCAATGTAGTAAAATAGG + Intergenic
983525565 4:168757288-168757310 ACTTGGCAATGTAATACATTGGG - Intronic
984265246 4:177490524-177490546 TTTTGGATATGTAATAATTTGGG + Intergenic
984399207 4:179240269-179240291 TTTTGACAATGTACTTAATTAGG - Intergenic
984468405 4:180130720-180130742 TTTTGGTTATTTGATAAAGTAGG + Intergenic
986349480 5:6864122-6864144 TTTTGGCAGAGAAATGAAGTAGG + Intergenic
986881681 5:12180936-12180958 TTTGTGCAATTTAATACAGTTGG + Intergenic
987299913 5:16588108-16588130 TTCTTGCAAAGTAATACAGTTGG - Intronic
988330283 5:29828847-29828869 CTGTGGCAATTTCATAAAGTAGG + Intergenic
988873577 5:35418658-35418680 TTTTGGCCAAGTCAAAAAGTGGG - Intergenic
989059411 5:37395547-37395569 TTTTGGCAATGTAGGAAACTTGG + Intronic
991165053 5:63556293-63556315 TTTGTTCAATGTAATAGAGTAGG - Intergenic
992751732 5:79868690-79868712 TGTTGAGAATGGAATAAAGTTGG + Intergenic
993023596 5:82621628-82621650 TTTTGGAAAGGGAATAAAGAAGG - Intergenic
994250091 5:97525603-97525625 TTTTGCCACTGTAACAGAGTGGG - Intergenic
995716590 5:115086827-115086849 TTGTTGCATTGTTATAAAGTGGG - Intergenic
997023191 5:130026307-130026329 ATTTGGAAAAGTAATAAAATGGG + Intronic
997162737 5:131625969-131625991 TTTTGGAGATGTAATTGAGTGGG - Intronic
998021100 5:138771008-138771030 TAATGGCAATGGAATTAAGTAGG - Intronic
998121696 5:139583459-139583481 TTTTGTCAATTTAAAGAAGTTGG + Intronic
1003582664 6:7356024-7356046 TTTAGGCAACTTAATAAAGAAGG - Exonic
1006172358 6:32101137-32101159 TTTTGACAATTTAAAAAACTAGG - Intronic
1006277401 6:33016235-33016257 TTTTGGCAAATTGATAAAATTGG - Intergenic
1008047074 6:46862310-46862332 TTCTGTCAATGTAAAAAAATGGG - Intronic
1008842678 6:55922619-55922641 TTTTGCCATTCAAATAAAGTTGG + Intergenic
1008855346 6:56079260-56079282 TTCTGTCAATGTAATAACCTTGG + Intronic
1009004037 6:57759584-57759606 TTTTTGGAATGTCATATAGTAGG + Intergenic
1009732432 6:67626220-67626242 TTTGTGCAATGTCATAAAGTAGG + Intergenic
1009903671 6:69841636-69841658 CTTTGGCACTATAATAAACTTGG + Intergenic
1009973340 6:70647819-70647841 CTTTGACAATCTAATAAATTTGG + Intergenic
1010867601 6:80998714-80998736 TTTTTGCAAGGTAAAAAAATAGG + Intergenic
1012020915 6:93918041-93918063 ATTTGGCAATATAAAAAAATAGG + Intergenic
1013265502 6:108493569-108493591 TTTTGGAAATGGGATAAACTGGG - Intronic
1013321379 6:108993569-108993591 TTTTGACAATATAATAGAGTGGG - Intronic
1013346039 6:109261726-109261748 TTTTGGTAATGTACTCAATTTGG - Intergenic
1013968992 6:115993040-115993062 TAATGGAAATGTAATAATGTAGG + Intronic
1014228570 6:118876152-118876174 TTTCGAGAATGTAATATAGTTGG - Intronic
1014486013 6:122000099-122000121 TTTTTGCAATTTAGTAAAGATGG - Intergenic
1015720186 6:136233642-136233664 TTTTCGCAATGAAATAAGGAAGG + Intronic
1020062825 7:5165390-5165412 TTTTCTGAATGTAATATAGTTGG - Intergenic
1020165432 7:5803948-5803970 TTTTCTGAATGTAATATAGTTGG + Intergenic
1023013549 7:35943877-35943899 TCTTTGCAATGTAATGAATTGGG + Intergenic
1023031869 7:36096732-36096754 TTCTGGAAATGGACTAAAGTGGG - Intergenic
1024077579 7:45829957-45829979 TCTTTGCAATGTAATGAATTGGG - Intergenic
1024205144 7:47152223-47152245 GTTTGGCAATGAAAGAAATTTGG - Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1025126834 7:56351455-56351477 TCTTTGCAATGTAATGAATTGGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1030734872 7:113036006-113036028 TTTTAACAATCTAATAAAGTTGG + Intergenic
1030822238 7:114108562-114108584 GTTTGGGAATGTATTAAAATGGG + Intronic
1032632134 7:133664832-133664854 TTTTGGTAAGGTAATGAAGAAGG + Intronic
1032832287 7:135640403-135640425 TTTTGGTAATTATATAAAGTTGG + Intronic
1033306302 7:140228312-140228334 TTTTTGCAATGTTCTACAGTGGG + Intergenic
1037148106 8:15598661-15598683 TTTTCAGAATGTCATAAAGTTGG + Intronic
1039406111 8:37314077-37314099 TTTTGGCTAAGTTATAATGTTGG + Intergenic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1041428228 8:57747888-57747910 TTGTGGAAATGTTATAAACTTGG + Intergenic
1041533276 8:58896127-58896149 GTTTGGCTATGTCAAAAAGTGGG + Intronic
1042098766 8:65249175-65249197 GTTTGGCAGTGTAATATAGCAGG - Intergenic
1042469948 8:69175415-69175437 TTTTGGCAATGTTGTGAAATTGG + Intergenic
1042506213 8:69563666-69563688 TTTTGGCAATGAATTGAAATAGG + Intronic
1042686334 8:71445043-71445065 TAGTGGCAATGTAAAAAAATTGG - Intronic
1044125056 8:88450046-88450068 TTTTTGGAACGTCATAAAGTTGG - Intergenic
1045765061 8:105657738-105657760 TTTGGCCAATGTTATAAAGCTGG + Intronic
1046260683 8:111763820-111763842 ATGTGGCAATGTATTAGAGTTGG + Intergenic
1047855705 8:128908981-128909003 TTTTGGAAATGTAGCAGAGTAGG + Intergenic
1048201295 8:132376196-132376218 TTTTAGAAATATAATAATGTGGG - Intronic
1051655308 9:19375460-19375482 TTTTAGTAATGTAAAAATGTGGG + Intergenic
1051993702 9:23186643-23186665 TTTTGGCGATTTAATAAGTTAGG - Intergenic
1055014887 9:71605776-71605798 TTTTTGTAATGTAATAAAATAGG + Intergenic
1055727577 9:79248067-79248089 TTTTCGGAATGTAATATAATTGG - Intergenic
1057529918 9:95835624-95835646 GTCTGGCAAAGTAAGAAAGTCGG + Intergenic
1057563100 9:96144307-96144329 TTTTGGAAAAGAAATAAAGTAGG + Intergenic
1058078243 9:100672623-100672645 TTATGACAATTTAATAAGGTAGG - Intergenic
1058351767 9:104033804-104033826 TTGTGGCACTGTTATAATGTGGG + Intergenic
1058592118 9:106576307-106576329 TTTTGGCACTGTAATAAAATAGG + Intergenic
1060386331 9:123232503-123232525 TTTTGTGAATGGAATGAAGTAGG - Intronic
1060902977 9:127277574-127277596 TTTTGCTTATGAAATAAAGTAGG + Intronic
1062723428 9:138057551-138057573 TTTTGTCTATGGAGTAAAGTAGG + Intronic
1186555782 X:10556920-10556942 TTTTGACATTGCCATAAAGTGGG - Intronic
1186815345 X:13231714-13231736 TTTTTGAAATGGAATAAACTTGG + Intergenic
1186975251 X:14895572-14895594 TGTTTGCATTATAATAAAGTAGG + Intronic
1188267972 X:28101902-28101924 TTTTAGCAATGATATAAACTAGG + Intergenic
1188376360 X:29433852-29433874 TTTAGGCAATGTAATTAATAAGG - Intronic
1190371646 X:49748355-49748377 TGTTGGGAATGTAAGAGAGTTGG - Intergenic
1191992274 X:67051285-67051307 TTTTAGCAATGTAATTGAGAAGG + Intergenic
1192288215 X:69761533-69761555 TTGAGGCAGTGTAATACAGTGGG - Intronic
1192885515 X:75333852-75333874 TTTTGGCAATGTGGCAAAATAGG - Intergenic
1193222567 X:78944100-78944122 TTTTGTCTGTGAAATAAAGTTGG + Intergenic
1193322206 X:80136013-80136035 TTTTGATAATATTATAAAGTAGG - Intergenic
1194304574 X:92227205-92227227 ATTTGGCAATGAAATAAAAGAGG - Intronic
1195461616 X:105132612-105132634 TTTTGGAAAGGAAATAGAGTGGG - Intronic
1195646899 X:107242251-107242273 TTTTTGCAAAGGAATAAAGAAGG + Intronic
1195848668 X:109257769-109257791 TTTTGGCAGTGTAATATTGCTGG + Intergenic
1196325597 X:114398568-114398590 TTTTGGCAGTGTATTCTAGTTGG + Intergenic
1197007432 X:121518887-121518909 TTTTGCCAATGTCATTATGTTGG + Intergenic
1197065578 X:122229934-122229956 TTTTGGCAAAATAATAACTTAGG + Intergenic
1197842158 X:130760349-130760371 TTTAGCCAATGAAATAAGGTGGG - Intronic
1197908795 X:131457461-131457483 TTTTGGTAATGTTATAAGGTAGG + Intergenic
1198521156 X:137454001-137454023 TTTTGGCAAGCAAAGAAAGTAGG - Intergenic
1199723345 X:150558883-150558905 TTTTGGCAGTGAAACAAAGAGGG + Intergenic
1201857378 Y:18559641-18559663 ACTTGGAAATGAAATAAAGTTGG + Intronic
1201875943 Y:18760739-18760761 ACTTGGAAATGAAATAAAGTTGG - Intronic