ID: 931547806

View in Genome Browser
Species Human (GRCh38)
Location 2:63408488-63408510
Sequence GGGGGTGGCCAGAAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 0, 2: 4, 3: 90, 4: 848}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931547792_931547806 20 Left 931547792 2:63408445-63408467 CCAAGCAGGCCATTCCTAACCTG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547802_931547806 -6 Left 931547802 2:63408471-63408493 CCATAGGGATCCATTGAGGGGGT 0: 1
1: 0
2: 1
3: 33
4: 121
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547793_931547806 11 Left 931547793 2:63408454-63408476 CCATTCCTAACCTGATACCATAG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547796_931547806 6 Left 931547796 2:63408459-63408481 CCTAACCTGATACCATAGGGATC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547791_931547806 21 Left 931547791 2:63408444-63408466 CCCAAGCAGGCCATTCCTAACCT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547797_931547806 1 Left 931547797 2:63408464-63408486 CCTGATACCATAGGGATCCATTG 0: 1
1: 1
2: 3
3: 35
4: 164
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848
931547790_931547806 22 Left 931547790 2:63408443-63408465 CCCCAAGCAGGCCATTCCTAACC 0: 1
1: 0
2: 5
3: 79
4: 290
Right 931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG 0: 1
1: 0
2: 4
3: 90
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931547806 Original CRISPR GGGGGTGGCCAGAAGGAAGA CGG Intronic
900413895 1:2526372-2526394 GGGGGCGGCGGGAAGGACGAAGG - Intronic
900422447 1:2561465-2561487 GGAGGTGGAGAGAAGGAAGGAGG - Intronic
900624992 1:3603927-3603949 GGGGGTGGGCTGAAGTCAGAGGG - Intronic
900656945 1:3763156-3763178 GGAGGTGGCGAGGAGGACGAGGG + Exonic
900771938 1:4552277-4552299 GGGGGTGGCAAGAGAGAATAAGG + Intergenic
900803787 1:4754418-4754440 GTGGGTAGCCAGAAGGGAAAGGG - Intronic
900933151 1:5749068-5749090 GGGGGCCGCCAGCAGGAACACGG + Intergenic
900940219 1:5793621-5793643 GGTGGTGGCCAGATGGCAGGAGG + Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901059025 1:6463139-6463161 GGGGGTGGCCTGAGGGATGAGGG + Exonic
901395042 1:8975128-8975150 GGGGGCGGGCAGAACAAAGAAGG - Intergenic
902038962 1:13478829-13478851 GGGGCAGGACAGAAGGAAGGAGG - Intronic
902360164 1:15937985-15938007 AGGGGTTGCCCGAAGGATGACGG + Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902754005 1:18537311-18537333 GGCGGTGGAGAGAAGGCAGATGG + Intergenic
902830758 1:19010764-19010786 AGGGGTGGCCAAAAGAAAGGAGG + Intergenic
903018709 1:20378741-20378763 TGGGGTGGAGACAAGGAAGAAGG - Intergenic
903033771 1:20481401-20481423 GGGGGCAGGCAGGAGGAAGAGGG - Intergenic
903705742 1:25284539-25284561 GGAGATGGCGAGAAGGACGAGGG - Intronic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
904817953 1:33219888-33219910 TGGGGTAGCAAGGAGGAAGACGG - Intergenic
904836669 1:33342148-33342170 GGGGCTGGCCAGCAGGATGAAGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905240213 1:36576376-36576398 GGGGGTGGGGTGAGGGAAGAAGG + Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905356592 1:37389147-37389169 GGAAGTCCCCAGAAGGAAGATGG + Intergenic
905530080 1:38671044-38671066 GAGGGTGGTGGGAAGGAAGAAGG - Intergenic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
905618500 1:39419115-39419137 GGGAGTTGACAGAAGGAAGCAGG + Intronic
906201162 1:43961215-43961237 GGAGGTGACGAGCAGGAAGAGGG - Exonic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906814235 1:48861794-48861816 GGGAGTAGCCAGAATGAATATGG + Intronic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
906864630 1:49404107-49404129 GGGGGTGGCCAGAAGCATTTAGG - Intronic
907078682 1:51601590-51601612 GGGGTTTCCCAGAATGAAGAGGG - Intronic
907625884 1:56028797-56028819 GGGTGTGGCCTGAAGGAAATTGG + Intergenic
907838889 1:58137508-58137530 GGGGGTGGTTGGATGGAAGATGG - Intronic
908309672 1:62867063-62867085 TGGGGTGGGCGGAAGGAGGAGGG - Intergenic
908339674 1:63163855-63163877 GGAGGGGACAAGAAGGAAGATGG + Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
908605438 1:65792859-65792881 GGGGGTGGACAGTAGGGAGAGGG + Intronic
908697832 1:66864896-66864918 AGAGGTGGCTAGAAGAAAGAGGG + Intronic
908929918 1:69306096-69306118 TGGGGAGGCCAGAAGCAGGATGG + Intergenic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910079784 1:83327965-83327987 GGAGGAGGGCTGAAGGAAGAAGG - Intergenic
911301784 1:96183488-96183510 GGGGGAGGGCAGGGGGAAGAAGG + Intergenic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
912407001 1:109447655-109447677 GGGATTGGGCAGAAGGAAGGAGG + Intergenic
912718789 1:112002592-112002614 GGGGGTGGGAAGAAGAATGATGG - Intergenic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914946412 1:152070768-152070790 GGGGGAAGACAAAAGGAAGACGG - Intergenic
915271328 1:154755834-154755856 GGAGGGGGAAAGAAGGAAGAAGG + Intronic
915271378 1:154756082-154756104 GGAGGGGGAAAGAAGGAAGAAGG + Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915462036 1:156076175-156076197 GGGGGTGGGTAAAAGGGAGAGGG - Exonic
915529164 1:156493556-156493578 AGGGGGGCCCAGAAGGAAGGGGG + Intronic
915580162 1:156808673-156808695 AGGGCTGGGGAGAAGGAAGAGGG + Intronic
915974945 1:160379221-160379243 GGAGCTGCCCAGAAGGAAGTTGG + Intergenic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
918024791 1:180732906-180732928 GGGGAAAGCCAGAAGGGAGATGG + Intronic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
919772577 1:201171938-201171960 GGGGATGACCAGGTGGAAGAGGG + Intergenic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920449762 1:206051103-206051125 GTGGGTGGCCAAGGGGAAGAAGG - Intronic
920701919 1:208224361-208224383 GGGGGTGGGGAGCAGGGAGAGGG + Intronic
920859436 1:209693377-209693399 GGGGAGGGCCAGGAAGAAGAAGG - Intronic
920897779 1:210075054-210075076 TGGGATAGCCAGAAGGGAGATGG + Intronic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921260900 1:213384388-213384410 GGATGTGGCCAGGAGGAAGAGGG + Intergenic
921625589 1:217374750-217374772 GGGTGTGGCCAGATGAAAGCTGG - Intergenic
921900909 1:220449606-220449628 AGGGGTTGCCAGCAGGATGAGGG - Intergenic
921933583 1:220775669-220775691 GAGGGTGGAGAGTAGGAAGAGGG - Intronic
922426119 1:225496328-225496350 GGTGGTGGGAAGAAGGAAGGTGG - Exonic
923013420 1:230107008-230107030 GGGGCTGGACAGAAGGAAGCTGG + Intronic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
923498415 1:234544512-234544534 GGGGCTGGCTGGAAGGAAGGAGG + Intergenic
923516474 1:234702015-234702037 GTGAGTGGCTAGAAGGGAGAAGG + Intergenic
923591375 1:235322788-235322810 GGGGTGAGACAGAAGGAAGAGGG + Intronic
924193191 1:241577898-241577920 AGGGGAGGCCAGAAGGAAAAGGG - Intronic
924454326 1:244206486-244206508 GTGGGTGGAGAGGAGGAAGAAGG - Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1062805114 10:413682-413704 GGGGGTGGGCAAAGGGCAGAGGG + Intronic
1063040639 10:2333835-2333857 AGGGGTGGTCAGGAGGCAGAGGG - Intergenic
1063239013 10:4149277-4149299 TGGGGGAGCCAGAAGGAAAATGG + Intergenic
1063536003 10:6884058-6884080 GGAGTTGGCCAGCAGGAAGCAGG - Intergenic
1064574073 10:16726750-16726772 GGTGGTGGGCAGAAGGCAGCCGG - Intronic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1066460457 10:35608273-35608295 GAGGGTGGGCGGGAGGAAGAGGG + Exonic
1067259537 10:44676406-44676428 GGGGTTGGCTAGAAGGAAAAGGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068607924 10:59026274-59026296 TGGGGGAGCCAGAAGGTAGATGG - Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069209080 10:65733605-65733627 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1069419676 10:68235826-68235848 GGGGGTGGACCCAGGGAAGAAGG + Intergenic
1069474525 10:68721190-68721212 GGGGGCGGCGTGGAGGAAGAGGG + Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069887652 10:71634149-71634171 GGGCCTGGCCAGAAAGCAGAGGG + Intronic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1070144693 10:73765232-73765254 GGGGGTGGGATGTAGGAAGAGGG + Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070304909 10:75234341-75234363 GGAGGTGCCCAGACGGAAGGCGG + Intronic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071137447 10:82468507-82468529 GGTGGTGGTCAGCAGGGAGATGG - Intronic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071281348 10:84106859-84106881 GAGGGTGGCAAGAGGAAAGAGGG + Intergenic
1071567484 10:86679324-86679346 GGGGGTGAGCATAAGGAAGGTGG - Intronic
1071815455 10:89227823-89227845 TGGTGGAGCCAGAAGGAAGAGGG + Intronic
1071949340 10:90684809-90684831 TGGGGTGGCATGAGGGAAGAGGG + Intergenic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1074096515 10:110318157-110318179 TGGGGAGGCCAGGAGGGAGATGG - Intergenic
1074529375 10:114286558-114286580 GGTGGTGGCCAAAAGGAGGAAGG - Intronic
1074898081 10:117794198-117794220 GGGGGTGGCCAGAAAGAGAATGG + Intergenic
1075480338 10:122775632-122775654 GTGTGTGGCAAGAAGGCAGATGG + Intergenic
1075571349 10:123548621-123548643 TGGTGTGGCCAGAAGAAACAAGG - Intergenic
1075959028 10:126550961-126550983 GGGTGAGGACAGAAGGGAGAGGG + Intronic
1076011730 10:126994847-126994869 CGGGGTGGCCACCAGGCAGAGGG + Intronic
1077228744 11:1449457-1449479 GGGGGTGGACGGAAGGACGAGGG - Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077307156 11:1873557-1873579 GGAGGAGGGAAGAAGGAAGAGGG + Intronic
1077360167 11:2137362-2137384 GGGAGTGGTCAGCAGGGAGAGGG - Intronic
1077453864 11:2666278-2666300 GGGGGTGGAAAGAAGGCAGAGGG + Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1077813081 11:5658335-5658357 TGAAGAGGCCAGAAGGAAGATGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1080421342 11:32113716-32113738 GGACGTTGGCAGAAGGAAGAAGG - Intergenic
1080749832 11:35141455-35141477 GGGCCTGGCCTGAAAGAAGAGGG + Intronic
1081061354 11:38481701-38481723 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081507629 11:43734628-43734650 GGGTGGGGGCAGAAGGAAGGCGG - Intronic
1081666648 11:44920625-44920647 GGGGCTGGTCAGTGGGAAGAAGG - Intronic
1081802163 11:45867649-45867671 GGGGCTGGCCAGGAGGGAGTTGG - Exonic
1081910594 11:46697457-46697479 GGGGGTGGGCAGGAAGAAGAGGG + Intronic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082008705 11:47436175-47436197 GGGGGTGAACATGAGGAAGAGGG + Intergenic
1083050959 11:59776149-59776171 GGGAGTGGGGAGAAGTAAGAGGG + Intronic
1083302136 11:61744919-61744941 GGGGGTGGCCAGGACGATGCCGG - Exonic
1083533782 11:63449927-63449949 GGGGGTGGGCAGAAAGGGGAGGG - Intergenic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083855358 11:65390540-65390562 GGGGGTGGAGAGAAGGATGAGGG - Intronic
1083946997 11:65929248-65929270 TGGGGTGGCCTGAAGGAAGAAGG - Intergenic
1083984029 11:66198595-66198617 GGGGGTGGGCAGACTGCAGAGGG + Intronic
1084013220 11:66364114-66364136 TGGGCTGGCCAGAAGCAGGATGG + Intronic
1084085721 11:66854211-66854233 GGAGGTGGCCACAATGAGGAAGG - Intronic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084530107 11:69722166-69722188 GTTGGTGGACAGATGGAAGATGG + Intergenic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1085242744 11:75072026-75072048 GGGGATGCCCATAAGGTAGAAGG + Intergenic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085430818 11:76445825-76445847 AGGGGTGGGGAGGAGGAAGAAGG - Intronic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087633968 11:100682536-100682558 AGGGGTGGGGAGAAGGAAAAAGG - Intergenic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1088827534 11:113508188-113508210 GGGGGAGGGAAGAAGGAAAACGG + Intergenic
1088849730 11:113695098-113695120 GGGGCTTTCCAGAAGAAAGATGG + Intronic
1089256224 11:117195712-117195734 AGGGGTGCCCAGGAGCAAGATGG + Intronic
1089788104 11:120922514-120922536 AGGGATGGCCAGAGGGCAGAGGG - Intronic
1090202267 11:124865380-124865402 GGGGGTGGAGAGAAGGACGAGGG + Exonic
1090333043 11:125946029-125946051 GTGGGTGGCCATCAGGGAGATGG + Intergenic
1090478174 11:127043561-127043583 GAGGGTGGACTGAAGGAACAAGG + Intergenic
1090902566 11:131045891-131045913 GGAGGTGGCGGGAAGGAGGAGGG + Intergenic
1091174532 11:133546677-133546699 GGAGGAGGCCACAATGAAGAAGG - Intergenic
1091432523 12:448590-448612 GGATGAGGCCAGAAGGAAAATGG + Intergenic
1091660457 12:2379451-2379473 GGGGCTGGGGACAAGGAAGAAGG + Intronic
1091671763 12:2457137-2457159 GGGGGTATCTAGAAGGAAGGAGG + Intronic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093655972 12:21694695-21694717 TGAGGGAGCCAGAAGGAAGATGG + Intronic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094493497 12:30975762-30975784 GGTGGTGGAGAGAAGGAAGGTGG + Intronic
1094498862 12:31006022-31006044 GGGTGTGGCAGGAAGGGAGAGGG + Intergenic
1095321431 12:40832967-40832989 GGGGCTGGTCAGGAGGCAGAGGG - Intronic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096359363 12:50969936-50969958 GGAAGTAGCCAGAAGGAATAGGG - Intronic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1096693725 12:53335974-53335996 AGGGGTGGGAAGCAGGAAGAGGG + Intronic
1096965178 12:55620539-55620561 TGGGAAGGCGAGAAGGAAGAAGG + Intergenic
1097007664 12:55931016-55931038 GGGGGTGGGAAGAAGGGGGAGGG - Exonic
1097055679 12:56247799-56247821 GGGCAGGGCCAGGAGGAAGAAGG + Intronic
1097347132 12:58505944-58505966 GGTGGAGGCCAGACAGAAGAGGG - Intergenic
1098636207 12:72786793-72786815 GGGGGAGGCAAGGAAGAAGAAGG + Intergenic
1100355891 12:93829447-93829469 GGGGGTAGCCAGGATGAGGATGG + Intronic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101843208 12:108342294-108342316 GGAGGGGGTCAGAAGGAGGAAGG + Intergenic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102817007 12:115874580-115874602 GTGGTTGACCAGAAGGGAGAAGG + Intergenic
1102870599 12:116411107-116411129 GCGGGAGGAGAGAAGGAAGAGGG + Intergenic
1102913719 12:116737736-116737758 GGGGGAGGAAGGAAGGAAGAAGG + Intronic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1102979511 12:117230276-117230298 GAGGGTGGCTAATAGGAAGAAGG - Intronic
1103053381 12:117800168-117800190 GGGCAGGGCCAGGAGGAAGAAGG + Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103257557 12:119555196-119555218 GGGCCTGGCCAGGAGGAGGAGGG - Intergenic
1103480116 12:121245312-121245334 GGGGCTGGGGAGAAGGAAGAGGG - Intronic
1103725798 12:122996823-122996845 GGAGGTGGCCAGCAGGGGGAGGG + Exonic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104670274 12:130675522-130675544 GGGGGTGGACGGAAGGGAGTGGG - Intronic
1105258262 13:18759602-18759624 GGTGGTGGGCAGTAGGAAGAGGG - Intergenic
1105260920 13:18778902-18778924 TGTGGTGGGCAGTAGGAAGAGGG - Intergenic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105284728 13:18994739-18994761 GAGGAAGGCCAGAAGAAAGAAGG + Intergenic
1105620481 13:22061361-22061383 GGGGGTTGGCAGAAGGAAAAGGG - Intergenic
1105683267 13:22751917-22751939 GAGGGTGGCCAGGAGGAATGGGG - Intergenic
1106037404 13:26056544-26056566 GGGGCTGGGAGGAAGGAAGAAGG + Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106522872 13:30513241-30513263 TGGGGTGGCCAGAGAGAAAATGG - Intronic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1107033555 13:35878075-35878097 GGGGGTGCTCAGAAGGAAGCTGG - Intronic
1107918087 13:45173513-45173535 GGGGGTGGTTAGGAGGAAGGTGG - Intronic
1108454349 13:50598067-50598089 GGTGGTGGGCAGATGGAAGGCGG - Intronic
1108698465 13:52923602-52923624 GGGGTTAGCCTGGAGGAAGAAGG - Intergenic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109368942 13:61396500-61396522 TGGGGTGCCCAAAGGGAAGAAGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111406239 13:87810890-87810912 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1112466096 13:99646320-99646342 TGGGGTGGCCTGGGGGAAGAAGG + Intronic
1112543075 13:100336413-100336435 GAGGGTGGCCAGTAGCATGAGGG + Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113656776 13:112072671-112072693 GGGGGAGGCGGGGAGGAAGAGGG - Intergenic
1114359321 14:21953195-21953217 GGAGGTGGAGAGTAGGAAGAGGG - Intergenic
1114612708 14:24052781-24052803 GTGGGTAGCGAGAAGGAAGCAGG - Intronic
1114713328 14:24800409-24800431 GTGGGTGGCAATAAGGAAGCAGG - Intergenic
1115270126 14:31542133-31542155 GGGGATGGGGAAAAGGAAGAGGG - Intronic
1115672400 14:35628996-35629018 GGGGAGGGGGAGAAGGAAGAAGG + Intronic
1115998430 14:39217346-39217368 GGGGGAGGAAAGAAGGAAGTGGG + Intergenic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1117322887 14:54640851-54640873 GGGGAAGGCCAGTAGGAAGCAGG - Intronic
1117843309 14:59883178-59883200 GGGGGTGGGAAGAAGAAAGTTGG + Intergenic
1118112733 14:62740432-62740454 GGGGCTGGACAGCAGGAGGAGGG - Intronic
1118249651 14:64147232-64147254 GAGGGTGGTCTGAAGGAAGCCGG - Intronic
1118715455 14:68556526-68556548 GGAGGTGGCTAGAAAGAGGAAGG + Intronic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119406504 14:74402651-74402673 GGGGGTGGGCAGATGGCAGAGGG - Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1120946613 14:90003649-90003671 GTGGGTGGTCAGAAGCAAGGTGG + Intronic
1121473676 14:94174960-94174982 GGGGGGGGGCGGAAGGAAGGGGG - Intronic
1121489091 14:94345049-94345071 GGGGCTGGGGAGAGGGAAGATGG + Intergenic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1122251629 14:100444110-100444132 AGGGGTGGCCCACAGGAAGATGG + Intronic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1122904131 14:104794253-104794275 GGGCGTGGCCTGGAGGCAGAGGG + Intronic
1122920879 14:104879644-104879666 GGGGGTGGCCAGAGGCAGGAAGG + Intronic
1123989329 15:25671849-25671871 GGGGGTGGCCAGGAGCTGGAAGG - Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1125687567 15:41572580-41572602 GGGGGTGGCCAGGAGGAAACGGG + Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1126577251 15:50209350-50209372 GAGGGAGGCCAAAAGAAAGAGGG + Intronic
1127093641 15:55491469-55491491 GGGGGTGGAGAGGAAGAAGAAGG + Intronic
1127161949 15:56197800-56197822 AGGGGTGGACTGCAGGAAGATGG + Intronic
1127259655 15:57318895-57318917 GGGGGAGGGAGGAAGGAAGAGGG + Intergenic
1127903556 15:63359169-63359191 GGGGGTAGCCAGCAGGCAGGTGG - Intronic
1128129040 15:65213376-65213398 GCTGGTGGCCAGGAGGGAGACGG - Intergenic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128806518 15:70535104-70535126 GGGGGTGCCTGGCAGGAAGAGGG + Intergenic
1129364376 15:75045194-75045216 GGGGGTGGCAATTAGGGAGAAGG - Intronic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1129947437 15:79551565-79551587 GGGAGGGGAAAGAAGGAAGAAGG + Intergenic
1130202970 15:81850597-81850619 AGGGGTGGTCAGGAGGCAGAAGG + Intergenic
1130797165 15:87221839-87221861 GGGGTTAGCCAGTAGAAAGAGGG - Intergenic
1131119426 15:89813679-89813701 AGGGGTGACCAGGAGGAAGTGGG - Intronic
1131232739 15:90671518-90671540 GGTGGAGGCAAGAAGCAAGATGG + Intergenic
1131251428 15:90833056-90833078 TGGGGTGGGCAAGAGGAAGAGGG + Intergenic
1131434364 15:92411368-92411390 GGGGGTGTTGAAAAGGAAGAGGG + Intronic
1131858828 15:96629437-96629459 ATAAGTGGCCAGAAGGAAGAAGG - Intergenic
1132201266 15:99956236-99956258 GGGGGTGGCTGGAAGGATGGGGG + Intergenic
1132238514 15:100239737-100239759 TGGTGTGGCCAGGAGGAAGGTGG + Intronic
1132423847 15:101697298-101697320 GGTGGTGGGCAGAAGCTAGAAGG + Intronic
1132588386 16:715862-715884 CGGCGTGGCCTGCAGGAAGAGGG - Exonic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1132717888 16:1301240-1301262 GGGGGCGGGCAGAGGCAAGAGGG - Intergenic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1132781096 16:1626071-1626093 TCTGGTGGCGAGAAGGAAGAAGG + Exonic
1133249931 16:4474352-4474374 GGGGGAGGCGGGAAGGAGGAGGG - Exonic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1134134161 16:11668606-11668628 GGGGGAGGCCAGGACGAGGAGGG + Intronic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134845232 16:17434357-17434379 GGCTGTTGCCAGAAGGAAGAGGG - Intronic
1135627263 16:24006836-24006858 GGGGGTGGGGAGGGGGAAGAAGG + Intronic
1136521631 16:30800357-30800379 GGGGCTGGGCAGAAGCAGGAGGG + Intergenic
1137369999 16:47896223-47896245 GGGGCTGGGCAATAGGAAGAGGG + Intergenic
1138199565 16:55078704-55078726 GGGCCTGGGCAGAAGGAAGGAGG + Intergenic
1138229235 16:55325232-55325254 GGGGGAAGCCAGAAGGAGCAAGG + Intronic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138600530 16:58051494-58051516 AGGGATGGAAAGAAGGAAGAAGG + Intergenic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140063011 16:71587778-71587800 GGGCATGGCCAGAGGCAAGAGGG - Intergenic
1140266513 16:73426017-73426039 TGGGTTGGCTGGAAGGAAGAAGG - Intergenic
1140942084 16:79731441-79731463 AGGGTTGGACAGAAGGCAGAAGG + Intergenic
1141023143 16:80516900-80516922 GGTGGTGGCCAGTGGCAAGATGG - Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421548 16:83921062-83921084 GTGGGTGGAAGGAAGGAAGATGG + Exonic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1141527196 16:84618738-84618760 GGGGGTGGGGAGAATGAGGAAGG - Intergenic
1141700138 16:85638698-85638720 GGGGGTGGCAAGAATGGGGAAGG - Intronic
1142138694 16:88463042-88463064 GCAGGTGCCCAGAAGGAAGTGGG - Intronic
1142176101 16:88646161-88646183 GATGGTGGCCAGCAGGAAGCCGG + Exonic
1142231779 16:88903487-88903509 GCGGGTGGCCAGGAGGAGCAGGG - Intronic
1142411452 16:89919114-89919136 GGGGGTGCCCAGATGGAAGGAGG + Exonic
1142661857 17:1435962-1435984 ATGGCTGGCCAGAAGGAAGTGGG + Intronic
1142867063 17:2797534-2797556 GGGGGTGGCACGAAGGGCGAGGG + Intronic
1142973861 17:3631340-3631362 GGGGGTGGGGGGCAGGAAGAAGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143504072 17:7354278-7354300 AGGGCTGGCCAGGGGGAAGAGGG + Exonic
1143646593 17:8234456-8234478 TGGGCTGGGCAGAAGGCAGAGGG + Exonic
1143962615 17:10733160-10733182 GGGAGTGTCCAGCAGGATGAAGG - Intergenic
1145038178 17:19555829-19555851 GGGGATGGCCAGGCGGAGGAAGG - Exonic
1145260974 17:21354614-21354636 GGGGGTGGTCAGCAGGCACAAGG - Intergenic
1145294724 17:21579060-21579082 TGAGGTGGCCAGAAGCAGGAAGG + Intergenic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1145735743 17:27230294-27230316 GGGGGTGGAGAGATGGAAGCAGG - Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146612306 17:34318711-34318733 GGGCGTGGCAAGAAGGAACCAGG - Intergenic
1146647552 17:34585101-34585123 GCATGTGGCCAGAAGAAAGATGG - Intronic
1146693606 17:34892977-34892999 TGGGGGAGCCAGAAGGAAGGGGG - Intergenic
1146821550 17:35986832-35986854 GTTGGTGGCCTGAAGGAAGCAGG + Intronic
1147039841 17:37710086-37710108 GGGGATGGTAAGGAGGAAGAGGG + Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147196238 17:38768683-38768705 GGAGGAGGTCAGAAGGAAGAAGG + Exonic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147426095 17:40346604-40346626 GGGTGAGGCCAGGAGGCAGAGGG - Intronic
1147602296 17:41754175-41754197 GGTGGTGGGGGGAAGGAAGAGGG + Intergenic
1147982185 17:44281472-44281494 GGGGCAAGCCAGAGGGAAGATGG - Intergenic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148747570 17:49927200-49927222 GGGGATGGCGGGAAGGAAGGAGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148794260 17:50189608-50189630 GGGGGCTGCCAGAAGGATGGTGG - Intronic
1148845881 17:50529525-50529547 GGGAGGGGCCAGAAGGGAGAGGG + Intronic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149594754 17:57858144-57858166 GGAGGTGGCCAGGCGGGAGAGGG - Intergenic
1150023062 17:61640269-61640291 AGGGGAGGCCAGAAGGGAGTTGG + Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150922374 17:69496858-69496880 GGGGGTGGCCAGTGGGGAAAGGG - Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1152073323 17:78144796-78144818 GGGAGTGGCCAGAAGGATGGTGG - Intergenic
1152216171 17:79033952-79033974 GGGCGGGGCCAGCAGGAGGAGGG + Intronic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152461158 17:80443257-80443279 GTGGGTGGCCACCAGGCAGAGGG + Intergenic
1152621526 17:81367244-81367266 GGTGGTGGTAAGAAGGAAGGTGG + Intergenic
1152970636 18:158396-158418 AGGGGTGGCGGGAAGGAAGGAGG - Intronic
1152982994 18:296507-296529 TGGGGTGGCCCTAAGGAACATGG + Intergenic
1153310175 18:3669679-3669701 TGAGGAAGCCAGAAGGAAGATGG - Intronic
1153774020 18:8437188-8437210 GGTGGCAGCCAGAATGAAGAGGG - Intergenic
1154156670 18:11949192-11949214 GGGGGTGGCAGGAAGAGAGAGGG - Intergenic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1154425093 18:14265889-14265911 GGTGGTGGGCAGTAGGAAGAGGG + Intergenic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1156263503 18:35466476-35466498 GGGGGTGTCCAGGAGGGGGATGG - Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157573046 18:48725513-48725535 GGGGGTGGTGGGAAGGCAGAAGG - Intronic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159012049 18:63066837-63066859 GGGAAGGGTCAGAAGGAAGAGGG - Intergenic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1160231699 18:77053969-77053991 GGAGGGGGCCAAGAGGAAGAAGG - Intronic
1160590192 18:79940230-79940252 GGGGGTGGAGAGCAGGAGGAGGG + Intronic
1160726756 19:620898-620920 GGGGGAGGGGAGGAGGAAGACGG + Intronic
1160726775 19:620939-620961 GGGGGAGGGGAGGAGGAAGACGG + Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160943073 19:1629145-1629167 GGGCCTGGCCAGCAGGAAGCAGG - Intronic
1161568506 19:5016920-5016942 GGGTGTGGCCAGAAGGGATGAGG - Intronic
1161638106 19:5401925-5401947 GGAGGAGGGAAGAAGGAAGAGGG + Intergenic
1162027590 19:7903302-7903324 GGGGCTGGCAAGAAGGGAAAGGG + Intergenic
1162182794 19:8882185-8882207 GGAGCTGGCCAGAAGGGAAAGGG + Intronic
1162452538 19:10763718-10763740 GGGAGGGGCCAGAAGGCAGGAGG + Intronic
1162950160 19:14066699-14066721 GGAGGTGGCTGGAAGGAACAAGG + Intergenic
1162962345 19:14135785-14135807 GGGGGTCTCCAGAGGGAAAATGG + Intronic
1163315627 19:16538764-16538786 GGGGGTGGCCACTTGGAAGCTGG - Intronic
1163327985 19:16617602-16617624 TGGGGTGGAGAGAAGGGAGAGGG - Intronic
1163401683 19:17097621-17097643 GGGAGTGGCGACAGGGAAGAAGG - Intronic
1163462747 19:17448609-17448631 GGGGGTCGCCAGACGGACGGGGG + Intronic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163576304 19:18112834-18112856 GGAGGTGGCCAGAGAGAAGGAGG + Intronic
1164574714 19:29398991-29399013 AGGGGTGGCAGGAAGGAAGTGGG + Intergenic
1164693718 19:30228300-30228322 GGGGGCGGCCAGAAGAGGGAAGG + Intronic
1165109641 19:33494187-33494209 GGGGGTGCTCAGAAACAAGAGGG - Intronic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1165460872 19:35943673-35943695 GGGGGTGGCTAGAAGACAAAAGG + Intronic
1165789482 19:38483055-38483077 GTGGGTGGGCAGGACGAAGACGG - Exonic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165832663 19:38737048-38737070 GGGCGGGGCCAGTGGGAAGAGGG - Intronic
1166231578 19:41428013-41428035 GAAGGTGGCCAGGAGGGAGAGGG + Intronic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166668531 19:44695989-44696011 GGGGGTGGGCAGCGGGGAGATGG + Intergenic
1166982335 19:46638780-46638802 GGAGGTGGCCACAGGGAGGAGGG + Intergenic
1167075405 19:47245501-47245523 GGGGGCAGCCGGAAGGATGAAGG + Intergenic
1168310278 19:55456492-55456514 GGGGGTGGGCAGAGGGACGGTGG + Intronic
1168311491 19:55463235-55463257 GGGGCTAGGCAGAAGGAAGGGGG + Intergenic
1168471230 19:56642818-56642840 CGGGGTGGGCGGAAGGGAGAAGG - Intergenic
1168642003 19:58037051-58037073 GGGGGTGGAGACCAGGAAGAGGG - Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925855069 2:8121497-8121519 GGGGGTGCCTGGAAGGTAGATGG + Intergenic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926240458 2:11081115-11081137 GGGGGAGGCCAGAGGGAGGGAGG - Intergenic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
926364366 2:12119745-12119767 GGGGGTGGACAGAAGTGAGCTGG - Intergenic
926644940 2:15280346-15280368 GGAGGAGGCAAGAAGGAAGAAGG + Intronic
926800755 2:16658376-16658398 AGGTCAGGCCAGAAGGAAGATGG + Intronic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927699634 2:25259663-25259685 GGGTGTGGCCAAAAGGAACCTGG + Intronic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929760690 2:44803510-44803532 GGGGGTGGGCAGACGGAGGGAGG - Intergenic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931133383 2:59366199-59366221 GGGGGAGAGAAGAAGGAAGAAGG + Intergenic
931286556 2:60836655-60836677 GGACTTGGCCATAAGGAAGAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931910765 2:66897254-66897276 GGAGGGGGCAAGAAGGAAGGAGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932336194 2:70932730-70932752 GGGGGTGTCAAGGAGGGAGATGG - Intronic
932356349 2:71071474-71071496 GGGGATGGACAGAAGAAAGAGGG - Intronic
932570360 2:72935303-72935325 GGGGGTGGCCAGAGGTGACAAGG - Intronic
932674852 2:73770807-73770829 GGGGCTGGGCAGAAGGGAGGTGG - Intronic
933257738 2:80099814-80099836 CGGGGTGGAGAGATGGAAGATGG + Intronic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933651945 2:84856689-84856711 GGGGGTGTCCAGGAGGCAGCGGG - Intronic
934511319 2:94946667-94946689 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935332241 2:101985712-101985734 AGGGGCAGCCAGAAGGCAGATGG + Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935629003 2:105196700-105196722 GGGGGAGGCCAGATGGAGGGTGG - Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
936690625 2:114884174-114884196 GGTGATGGCAAGAAGGAAAAAGG + Intronic
936971046 2:118176589-118176611 GGGGGTGGGGAGAAGGAGCAAGG - Intergenic
937123222 2:119455173-119455195 GGAGGTGGGCAGAGGGTAGAGGG - Intronic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
938015483 2:127863695-127863717 GAGAGTGGCCAGTTGGAAGAAGG - Exonic
938029876 2:127982910-127982932 GGAGGTGGGAAGAAAGAAGATGG + Intronic
938030239 2:127986008-127986030 GGGGGAAGCCAGAAGGGAGATGG - Intronic
938121449 2:128636984-128637006 GGGAGAGGCCAGGAGCAAGAGGG + Intergenic
938317705 2:130341637-130341659 GGGGTTCTGCAGAAGGAAGAGGG + Intronic
938595531 2:132783982-132784004 GGGCCTGGCCAGCAGGGAGACGG + Exonic
939436214 2:142181055-142181077 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940478082 2:154192024-154192046 GGGGGAAGCCAGAAAGGAGATGG + Intronic
940481681 2:154240876-154240898 GGGGGAAGCCAGAAAGGAGATGG + Intronic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941379420 2:164775213-164775235 GGTGGTAGCCAGATGGAAGTGGG - Intronic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
942109602 2:172667220-172667242 TGGGGTGGTCAGAAAGCAGAGGG + Intergenic
942360637 2:175168237-175168259 GAGGGGCGCCAGAAGGAAGGTGG - Intronic
942671932 2:178385085-178385107 GGGGGTGGCGAGCAAGAGGAGGG + Intronic
942866967 2:180688119-180688141 GGGGAAGGGCAGACGGAAGAGGG + Intergenic
943364664 2:186957827-186957849 GGGGGTGTCCATATGGAACATGG + Intergenic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
945185019 2:207131518-207131540 GAGGGTGGCTTGAAGAAAGAAGG - Intronic
945742625 2:213681842-213681864 GGGAGTGGAAAGAAGAAAGAGGG - Intronic
946346928 2:219118456-219118478 GGGGGTAGGCAGTGGGAAGATGG + Intronic
946413358 2:219526721-219526743 GGTGCTGGCCAGAAGGAAGGTGG + Intronic
947187308 2:227466855-227466877 GGGGCTGGGGGGAAGGAAGAGGG + Intergenic
947590539 2:231382780-231382802 GCGGGTGGCTGGCAGGAAGAGGG - Intergenic
947593673 2:231398237-231398259 GGCCGTGCCCAGCAGGAAGAGGG - Exonic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
948119961 2:235522654-235522676 GAGGCTGGCCACAAGGCAGAGGG + Intronic
948126430 2:235567713-235567735 GGTGGTGGCCAGGAGGAACGTGG + Intronic
948200198 2:236124221-236124243 GGAGGTGGCCACCAGGAAGAGGG - Exonic
948231210 2:236350891-236350913 AGGTCTGGCCAGAAAGAAGATGG + Intronic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948702473 2:239768888-239768910 GGGGGTGGCCAGTAGCCACAGGG - Intronic
948802705 2:240440082-240440104 GAAGGTGGCCAGGAGGGAGAAGG + Intronic
948821936 2:240554288-240554310 GGGGCTGGGCAGATGGAACAAGG + Intronic
1168753187 20:297940-297962 GGAGGCGGGCAGGAGGAAGAAGG + Exonic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1168889002 20:1281714-1281736 GGGGTTGGGCAGAAGAGAGAGGG - Intronic
1168975589 20:1963144-1963166 AGGGGTGGATAGAGGGAAGAAGG + Intergenic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170621440 20:17999767-17999789 AGGGGTGGCCAGAAGGCAGTGGG + Intronic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1171884081 20:30639238-30639260 GGTGGTGGGCAGTAGGAAGGGGG - Intergenic
1172442601 20:34976732-34976754 GGGGGTCCCCAGAAAGAGGATGG + Intronic
1172612149 20:36260298-36260320 GGAAGTGGACAGAGGGAAGAGGG - Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172856654 20:38009471-38009493 GGGAAGGCCCAGAAGGAAGAAGG - Intronic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1173521815 20:43705491-43705513 CGTGGTGGCCAGAAAGGAGAGGG - Intronic
1174045459 20:47729740-47729762 GGCGATGGCCAGGAGGCAGAGGG + Intronic
1174080834 20:47969629-47969651 GGGTGTGGCCAGAATGAAGGCGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176240925 20:64075510-64075532 GGGGGTGGCCAGGGGGCAGTCGG - Intronic
1176373775 21:6077358-6077380 GTGGGTGGGAAGAAGGGAGAGGG + Intergenic
1176451689 21:6867899-6867921 GGGGGTGGGCAGCTGGGAGAGGG + Intergenic
1176614301 21:9015752-9015774 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1176710896 21:10148117-10148139 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1176829859 21:13732950-13732972 GGGGGTGGGCAGCTGGGAGAGGG + Intergenic
1176844259 21:13864619-13864641 TGTGGTGGGCAGTAGGAAGAGGG - Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179358258 21:40682177-40682199 GGAGGTGGCCAGAGGGATGCGGG + Intronic
1179423071 21:41251417-41251439 GGGTGTGGCTACAAGGAAAAGGG + Intronic
1179583169 21:42357791-42357813 AGGGATGGCCATTAGGAAGAAGG - Intergenic
1179749702 21:43460885-43460907 GTGGGTGGGAAGAAGGGAGAGGG - Intergenic
1179784115 21:43719940-43719962 GGAGGTGGCCGAAGGGAAGAGGG + Intronic
1179897374 21:44370196-44370218 GGGCGTGGCCAGCAGGCAGCTGG + Intronic
1179947191 21:44686425-44686447 GGGGGTGGCCAGGTGGCAGCAGG - Intronic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180304678 22:11065108-11065130 GAGGGTGGCAAGAAGGAAAGAGG - Intergenic
1180699985 22:17775984-17776006 TGGGGTGGCCTGAAGGCAGGAGG + Intergenic
1180760412 22:18198157-18198179 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180770725 22:18382454-18382476 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180775257 22:18426539-18426561 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180808331 22:18737594-18737616 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180828669 22:18885413-18885435 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180857830 22:19059440-19059462 GGGGGTGTCCAGGAGGAAGTGGG - Intronic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1181071253 22:20342559-20342581 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181194328 22:21171508-21171530 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181215115 22:21321270-21321292 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181333584 22:22113472-22113494 GGGGGTGGAAAAGAGGAAGAAGG - Intergenic
1182048959 22:27298787-27298809 GGGAGGGGGCAGGAGGAAGAGGG + Intergenic
1182048981 22:27298913-27298935 GGGAGAGGCAAGGAGGAAGATGG + Intergenic
1182489694 22:30663162-30663184 GATGGTGCCCAGAAGAAAGAGGG - Exonic
1183385441 22:37511494-37511516 GGAGGAGGAAAGAAGGAAGAAGG + Intronic
1183735639 22:39643419-39643441 GGGGCTGGCCAGGAAGAGGAGGG - Intronic
1184249032 22:43249805-43249827 GGGGGTGGCCAGGACATAGATGG + Intronic
1184320660 22:43739964-43739986 GGGGGTGGCCAGGAGCCAGTCGG - Intronic
1184396749 22:44246815-44246837 GGGGGTGACCTGCAGGAAGGAGG + Exonic
1184867398 22:47209348-47209370 GCTGGTGGCCAGGAGGAACATGG - Intergenic
1185015052 22:48338338-48338360 GGGGGTGGCCATGAGGATGGGGG + Intergenic
1185104072 22:48857557-48857579 GGGGGTGGCATAAAGAAAGAGGG - Intergenic
1185324353 22:50218405-50218427 GGCGGAGGGCAGAAGGCAGAGGG + Intronic
1203232561 22_KI270731v1_random:123626-123648 GAGGGTTGCCACAAGGACGACGG + Intergenic
1203278760 22_KI270734v1_random:111401-111423 GAGGGTTGCCACAAGGACGACGG + Intergenic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
950163938 3:10779690-10779712 GGGGCTGGCCAGGTGGAAGAAGG - Intergenic
951648927 3:24926619-24926641 GGGGGTGGCAAGGAGAAAGATGG + Intergenic
951913760 3:27777919-27777941 GGGGGTGGTCAGGAAGCAGAAGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953496728 3:43393919-43393941 GGGGCTGGGCAGCAGGTAGAGGG - Intronic
953697883 3:45173734-45173756 TGGTGTGGCCTGAAGGAAGGAGG + Intergenic
953884786 3:46709042-46709064 GGGGCGGGCCTGAAGGAAGGCGG + Intronic
954296460 3:49677049-49677071 GAGGGTGGTCAGCAAGAAGATGG + Intronic
954441018 3:50521983-50522005 GGGGGCTGCCTGAAGGAAGCTGG + Intergenic
954638287 3:52083478-52083500 GGAGGTGGCCAGCAGGAGAAAGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
954852627 3:53616549-53616571 GGGGGTGGGTAGGAAGAAGACGG - Intronic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
955201954 3:56859503-56859525 GGGGGTGGCAAGAGGGATGTGGG - Intronic
955873932 3:63470695-63470717 GGAGGTGGGCAAGAGGAAGAGGG - Intronic
956753497 3:72363648-72363670 GAGGATGGGCAGAAGGAATAAGG + Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
959224973 3:103568721-103568743 GGAGGTGGCCAGTAGGTAGTTGG + Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959555404 3:107711836-107711858 GTGGGTGGCCAAAGGAAAGAAGG - Intronic
959757806 3:109919728-109919750 TAAGGTGGCCAGAAGGAAAAAGG + Intergenic
959829849 3:110847796-110847818 GAGGTTTGCCAGAAGAAAGAAGG + Intergenic
959854601 3:111136080-111136102 TGAGGTGGCCAGAAGAAAGATGG + Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961345358 3:126260363-126260385 GGAGGAGGGGAGAAGGAAGAGGG - Intergenic
961683296 3:128613244-128613266 GGGGGTGCGCAGAAGGCACATGG - Intergenic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962340437 3:134577762-134577784 GGGGGTGGACGGAAAGATGAGGG - Intergenic
963310683 3:143706993-143707015 GGGTGGGGGCAGTAGGAAGATGG + Intronic
963497954 3:146092700-146092722 AGGGGTGGTGTGAAGGAAGAAGG + Intronic
963771268 3:149388728-149388750 TGGGGTGGCCAGGAGGCAGAGGG + Intergenic
964784906 3:160385778-160385800 GGTGGGGGCCTGATGGAAGAGGG - Intronic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
967422907 3:189293435-189293457 AGGGATTGCCAGAGGGAAGATGG + Intronic
967584916 3:191201179-191201201 TGGAGTGGCAATAAGGAAGAAGG - Intronic
968120564 3:196123039-196123061 GGTGGTGGGCAGCAGGGAGATGG - Intergenic
968504364 4:965116-965138 GGGGGTGGCCAGAGGGAGGTCGG - Intronic
968937213 4:3617538-3617560 GGGAGGGGCAAGAAGGAAGAAGG - Intergenic
968937301 4:3617794-3617816 GGAGGTGGTCAACAGGAAGAAGG - Intergenic
969057205 4:4409527-4409549 AGGGGTGGCCGGAAGGCAGCAGG - Intronic
969274977 4:6128788-6128810 AGGGGTGGCTAGGAGGAGGAGGG - Intronic
969518936 4:7664690-7664712 CGTGGTGGCCAGAAGGGAGGTGG - Intronic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969569910 4:8002198-8002220 GGGGGTTGCCAGGGGGCAGACGG - Intronic
969723645 4:8906869-8906891 GAGGGAGGCAAGAAGGAAGGGGG - Intergenic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970261214 4:14227021-14227043 GGGGTTGGTTAGAAGGCAGAGGG - Intergenic
971447346 4:26765210-26765232 GGGGTTTGCAAGAAGGAAGGAGG + Intergenic
971464963 4:26947648-26947670 AGGGCTGGCGAGCAGGAAGATGG - Intronic
971823287 4:31587351-31587373 GAGGCTGACCAGAAGGAAAACGG + Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972108573 4:35525650-35525672 TGGGGAGGCCAGAAAGAGGATGG + Intergenic
972584005 4:40419924-40419946 GGGAGTTTCCAGAAGGCAGAGGG + Intergenic
972640023 4:40916901-40916923 GGGGAAGGTCAGAGGGAAGAGGG + Intronic
972902974 4:43708022-43708044 GGAAGAGGACAGAAGGAAGAAGG + Intergenic
973936655 4:55853531-55853553 GGGCGTGGCCAGGCGGAACAAGG - Intergenic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974046960 4:56906801-56906823 GGGGTTTGCCAGTAGGAAGATGG - Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974778171 4:66515430-66515452 GGGAGAGGGAAGAAGGAAGAGGG + Intergenic
974958546 4:68672883-68672905 GAGGGCGGCGAGAATGAAGAAGG - Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
977071791 4:92399342-92399364 GGAGTGGGCCTGAAGGAAGACGG - Intronic
978895760 4:113885460-113885482 GGGAGTGGGGGGAAGGAAGAAGG + Intergenic
979087817 4:116435967-116435989 GGGGCTGGCGAGAAAGAGGAGGG + Intergenic
979189230 4:117835663-117835685 TGGGGAGGCCAGTAGGAAGGTGG + Intergenic
979378871 4:119984544-119984566 GGGATTGGTCAGAAGGCAGAGGG + Intergenic
979543260 4:121910671-121910693 GGGGGTGAGGAGAAGAAAGAAGG + Intronic
980015295 4:127643415-127643437 GGGGCTGGGGAGCAGGAAGATGG - Intronic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
981044635 4:140253462-140253484 GGGGGTGGGGATAAGGAGGAAGG + Intergenic
981056427 4:140366868-140366890 GCGTTTGGCAAGAAGGAAGAAGG + Intronic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
981458855 4:144988734-144988756 GGGAGTGGGGAGAAGTAAGAAGG - Intronic
981633296 4:146846583-146846605 CAAGGTGGCCAAAAGGAAGAAGG - Intronic
982959447 4:161818273-161818295 TGGGGGAGCCGGAAGGAAGATGG - Intronic
982991520 4:162282457-162282479 TGGGGTTGCCAGTAAGAAGAAGG - Intergenic
983398071 4:167228084-167228106 GGGGGTGGCTAGATGGATGTTGG + Intronic
983941081 4:173534737-173534759 GGGGGTGGAAGGAAGAAAGAAGG - Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984752343 4:183289864-183289886 GGGCGTGGCCAGTAGGGTGAGGG + Intronic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
985531355 5:435565-435587 GGAGATGTCCAGAAGGAACAGGG - Exonic
985701771 5:1377936-1377958 GGGGGGGGCCAAAAGGATGCAGG - Intergenic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988431892 5:31128761-31128783 TGGGGTGGGAAGGAGGAAGAAGG + Intergenic
989177604 5:38544111-38544133 GGGGGTGGCAATGAGGATGATGG - Intronic
989264465 5:39456969-39456991 AGGGTTGTCCAGAAGGAAGAAGG + Intronic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
990955341 5:61333435-61333457 GGCGGGGGCCAGAAAGAAAAAGG - Intronic
991144939 5:63290165-63290187 GAGAGTGGCAAGAAAGAAGAAGG - Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
991574686 5:68090667-68090689 GGGGGTGGGCAGAGGGCACATGG - Intergenic
994008422 5:94870173-94870195 GGGGGTGGTCAGAAAGGAAAGGG - Intronic
994133211 5:96255111-96255133 GGGGGTTGGCAGGGGGAAGAAGG + Intergenic
994886128 5:105564108-105564130 TGTGGTAGCCAGAAGGGAGATGG - Intergenic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
995858603 5:116618873-116618895 GGGAGTAGCCAGAGGGAAGGAGG + Intergenic
996343755 5:122467604-122467626 GGAGGAGGAAAGAAGGAAGAAGG + Intergenic
996430571 5:123371617-123371639 GAGGATGGCCTGAAGGAAGCTGG + Intronic
998138103 5:139685017-139685039 GGGGGTGTCCAGCAGGGAGTAGG + Intergenic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
999495356 5:152091266-152091288 GGGGCGCGCCAGAAGGAAAAAGG - Intergenic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1000610398 5:163367367-163367389 GGGGGTGGTCAGGAAGTAGAGGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000757990 5:165184559-165184581 GAGGGTGGCCAGAAGAGTGAGGG - Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001534879 5:172491306-172491328 GTGGGTGGCCAGTAGGCAGCCGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001817822 5:174685283-174685305 GGGGGTTGCCAGAAGCTGGAGGG + Intergenic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002426655 5:179180771-179180793 AGGGGTGGTCAGGAGGCAGAGGG - Intronic
1002433494 5:179217858-179217880 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002433503 5:179217896-179217918 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002843354 6:924546-924568 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1002956582 6:1871152-1871174 GGGGCTGGCCAGAAAGGGGAGGG + Intronic
1003221741 6:4166464-4166486 GGGGTGGGTCAGAAGGCAGAGGG + Intergenic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1003666726 6:8118357-8118379 TGTTGTGGCCAGAAGGTAGATGG - Intergenic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005116354 6:22342317-22342339 GAGGGTGGCGAGTAGGAAGAAGG - Intergenic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006731013 6:36236144-36236166 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
1007337188 6:41162325-41162347 GGAGGTGGTCAGATGGGAGAGGG - Intronic
1007386371 6:41522980-41523002 GGGGGAGGCGGGAAGGAAGGAGG - Intergenic
1007474312 6:42108645-42108667 AGGGGTGTGCAGAAGGAAGGTGG + Intronic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1009688380 6:66992426-66992448 GGGGGTGGCTAGAGTGAAGCTGG + Intergenic
1010831926 6:80541520-80541542 GTGGGAGGCAAGAAGGAAGATGG - Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012606811 6:101167930-101167952 TGGGGATGCCAGAAGGGAGATGG - Intergenic
1012647496 6:101704659-101704681 GGGGGTGGGGAGAAGGGAGGAGG - Intronic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1014553358 6:122814710-122814732 GGGGTGGGACAGAATGAAGAGGG - Intergenic
1015121739 6:129708022-129708044 GGGGATGGATAGAAGGAAGGAGG - Intronic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016808589 6:148237840-148237862 GGGGGAGGCCAGAGAGAAAATGG - Intergenic
1017008200 6:150043421-150043443 GGGAGGGGGCAGAAGGAAGGCGG - Intergenic
1018212018 6:161491260-161491282 GGGTGATGCCTGAAGGAAGAAGG + Intronic
1018265799 6:162023415-162023437 TGGGGCAGCAAGAAGGAAGACGG + Intronic
1018612735 6:165661038-165661060 GGGGTTCGCTAGAAGGAAGCAGG - Intronic
1018903776 6:168063799-168063821 GGGGCTGGCAAGGAGGAAGGGGG - Intronic
1019313457 7:373946-373968 GAGGGTGGGCAGGAGGGAGAGGG + Intergenic
1019405511 7:881828-881850 GGGGCCGGCCTGAGGGAAGAGGG - Intronic
1019415620 7:925445-925467 AGGGGAGGCCGGAGGGAAGAGGG - Intronic
1019920043 7:4157540-4157562 GTGGGTGGGCAGATGGAAGCGGG + Intronic
1020012681 7:4815296-4815318 GGGTGTGGCCAGCAGGTTGAGGG + Exonic
1020106424 7:5424189-5424211 GGGGGAGGGGAGAAGGAAAAGGG - Intronic
1021149706 7:17134666-17134688 GGGGGTGGCAGGAAGGATGTTGG - Intergenic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022189306 7:28001623-28001645 GGGGGTGGCAAGAAGTCAGTGGG + Intronic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022517811 7:30987045-30987067 GGGGGGAGCCAGAAGGGAGCGGG + Intronic
1022653742 7:32299345-32299367 GGCAGTGGCTAGAAGGAAGTGGG - Intergenic
1022695841 7:32704715-32704737 GGGGGTTGGCAGAGGGCAGAGGG + Intergenic
1022972607 7:35531227-35531249 GGGAGTGGGGAGAAGGAAGTGGG + Intergenic
1023125134 7:36947781-36947803 GGTGGAGGCCAGAAGAGAGAAGG - Intronic
1023619140 7:42051986-42052008 GGGGGCTGGGAGAAGGAAGAAGG - Intronic
1023864435 7:44232160-44232182 GGCACTGGCCAGAAGGAAGTGGG + Intronic
1023865460 7:44236185-44236207 GGGGGTGGTCAGCAGGCAGCAGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1027297545 7:76793242-76793264 GGAGGAGGGCTGAAGGAAGAAGG - Intergenic
1027916765 7:84334641-84334663 GGGGGTGACCAGGAGGCAGCAGG - Intronic
1029139765 7:98401248-98401270 GGGCGTGGCCAGAGGGAAGCGGG + Intergenic
1029477040 7:100791353-100791375 GGAGGAGGAAAGAAGGAAGAAGG - Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030282421 7:107790817-107790839 GGGTCTAGACAGAAGGAAGAAGG - Intronic
1030282993 7:107796489-107796511 GTGGGTGGAGAGATGGAAGAGGG - Intronic
1030319336 7:108147267-108147289 GGGGGTGGAGAGAAGGGAGAGGG + Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1031043456 7:116862593-116862615 GTTTGTCGCCAGAAGGAAGATGG + Exonic
1031327714 7:120422661-120422683 GGTGGAGGGCAGACGGAAGAAGG - Intronic
1031731052 7:125300841-125300863 AAGGGTGGCCAGAAGAAAAACGG - Intergenic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1032702965 7:134398072-134398094 GAGGGTGGCCAGCTGGGAGATGG + Intergenic
1032878864 7:136067111-136067133 GGGGGTGGGGAGAAGGTAGGAGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033483221 7:141762220-141762242 GGAGTTGGTCAGGAGGAAGAAGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034228629 7:149501765-149501787 TGGAGAGGCCAGAAGGAGGATGG + Intergenic
1034550214 7:151815578-151815600 GGGGTTGGGCAGGAGGCAGAGGG - Intronic
1034633936 7:152552475-152552497 GGGGGTGAGCAAGAGGAAGAAGG + Intergenic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1034879827 7:154754976-154754998 GTGGGTGGGCGGAAAGAAGAGGG + Intronic
1035331868 7:158101844-158101866 AGGGTGGGCCAGAATGAAGAAGG - Intronic
1035395069 7:158529393-158529415 AGGGGAGGCCAGCAGGAGGACGG + Intronic
1035606277 8:931676-931698 GGGCGTGGCCACCAGGACGACGG - Intergenic
1035688991 8:1547523-1547545 GGGGCCTGCCAGAAGGAGGAAGG + Intronic
1035748297 8:1977405-1977427 GGAGGTGGCCAGGACAAAGATGG - Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1036645085 8:10607754-10607776 GGGGAGGCCCAGAAGGCAGAAGG - Exonic
1036705812 8:11045795-11045817 GGGGGTTACCACAAGGAAAATGG + Intronic
1036744826 8:11399195-11399217 AGGGGTGGACAGAAGGATGGAGG + Intronic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037065233 8:14568233-14568255 GGGGGTGGGGAGAAAGAGGAGGG + Intronic
1037516338 8:19635525-19635547 GGGGGAGGCAACAAGGAAGTTGG - Intronic
1037584001 8:20264002-20264024 GGGAGTGGGGAGAAGGAATAGGG - Intronic
1037787668 8:21912229-21912251 GGGGAAGGCCAGGAGGCAGATGG + Exonic
1038476279 8:27870734-27870756 GGGGGTGGGGAGTAGGAATAAGG - Exonic
1038566987 8:28627908-28627930 GGGGGTTGCCAGAAGCTAGGGGG + Intronic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039043478 8:33429578-33429600 GGGGGAGGGCAGATGGAGGAAGG + Intronic
1039475737 8:37838595-37838617 GGGGGTGACCAGGAAGGAGAAGG - Intronic
1039824525 8:41161732-41161754 GAGGGAGGCAAGAAAGAAGAAGG - Intergenic
1039836238 8:41258551-41258573 GGGGGTGGGAAGAAGGAGAAAGG - Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1040946767 8:52893043-52893065 CGGGTTGCCCAGCAGGAAGACGG + Intergenic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041207242 8:55511425-55511447 GGGGGAAGGCAGAAGGTAGAGGG - Intronic
1041219716 8:55637110-55637132 GGGGATGGACACATGGAAGATGG + Intergenic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042077782 8:65015298-65015320 GGGAGTGGGCAGTAGGAAGTGGG - Intergenic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044429745 8:92095281-92095303 AGGGGTGGCCAGGAGGAAGGGGG - Intronic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1046049939 8:109010853-109010875 GGGGGTTGCAAGAAGAAAGATGG - Intergenic
1046097548 8:109579060-109579082 AGGGATGCCCAGCAGGAAGAAGG + Intronic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1046345594 8:112922498-112922520 GGGGGCGGCTAGGAGGGAGAGGG - Intronic
1046749008 8:117907104-117907126 GGGGATGGAGAAAAGGAAGAAGG - Intronic
1046777999 8:118184361-118184383 GGTGGAGGCAGGAAGGAAGAGGG - Intergenic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047629069 8:126686206-126686228 GGGGGTGGTAAGAAGGAAAATGG - Intergenic
1048006294 8:130422030-130422052 GGGGGTGGGCACAAACAAGAAGG + Intronic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048354230 8:133640411-133640433 GGCAGTGGCCAGATGGAAGACGG + Intergenic
1048748544 8:137644074-137644096 GTTGGTGGCTATAAGGAAGAAGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049246858 8:141567457-141567479 GGGGGTTGCCACCTGGAAGATGG - Intergenic
1049392693 8:142380312-142380334 GGTGGTGCCCGGAAGGAGGAAGG - Intronic
1049419347 8:142510128-142510150 GGGGGTGGAGAGGAGGAGGAGGG + Intronic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049501515 8:142970243-142970265 GGGGGTGTGCAGGAGGAAGTGGG + Intergenic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1049931832 9:464415-464437 GGGGGTGGCGGGATGGAGGATGG + Exonic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050483968 9:6114605-6114627 GGGGGTGGCCTGAAGGCTGGGGG + Intergenic
1050517617 9:6461372-6461394 GGGGGAGGAGAGAAGGAGGAGGG - Intronic
1050631928 9:7568895-7568917 GGGGGGGGGGAGAAGGAAGAGGG - Intergenic
1050985637 9:12078657-12078679 GGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1051061781 9:13053458-13053480 GGTGGAGACCAGAAGTAAGAAGG + Intergenic
1051103580 9:13550957-13550979 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1051173658 9:14343725-14343747 GGGGCTGGCCACAAGAGAGAGGG + Intronic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1051724881 9:20078635-20078657 AGGAGTAGCCAGAAGGGAGATGG - Intergenic
1052018495 9:23498157-23498179 GGGGGTGGCATCCAGGAAGAGGG + Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052865696 9:33463528-33463550 GAGGGTGGTCAGATGGAAGGAGG - Intronic
1053007790 9:34615461-34615483 GGGGGTAGGTAGAAGGCAGAAGG + Intronic
1053647879 9:40133813-40133835 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1053654056 9:40197600-40197622 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1053757853 9:41330033-41330055 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1053904443 9:42826776-42826798 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054328853 9:63731765-63731787 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1054366171 9:64343816-64343838 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054453852 9:65419878-65419900 GGAGGTGGTCAACAGGAAGAAGG + Intergenic
1054453933 9:65420138-65420160 GGGAGGGGCAAGAAGGAAGAAGG + Intergenic
1054530542 9:66178738-66178760 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
1054536701 9:66242357-66242379 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1054673801 9:67833546-67833568 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1056709879 9:88983840-88983862 GGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1056887168 9:90454616-90454638 GGTGGTGGCTAGAGGGAAGGAGG - Intergenic
1057127669 9:92631900-92631922 GGGGTTGGCAAGGAGGAACAAGG - Intronic
1057825912 9:98371935-98371957 AGGGCTGGGCAGCAGGAAGAAGG - Intronic
1057836808 9:98451855-98451877 GGGGCTGGCCAGAGGGAGCATGG - Intronic
1058014002 9:100009467-100009489 GGGGGTGGGGAGAGGGGAGATGG - Intronic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059375125 9:113875878-113875900 GGGGGAGGGCAGAAGGGAGCCGG + Intergenic
1059396216 9:114035617-114035639 GGAGGAGGAGAGAAGGAAGAGGG - Intronic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060585245 9:124781460-124781482 GGGGCTGGCCATGAGGAAAAAGG + Intronic
1060701625 9:125756512-125756534 GGGTATGGTTAGAAGGAAGAGGG + Intronic
1061362961 9:130155329-130155351 TGGGGTTGGCAGAAGGCAGAGGG - Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061498357 9:130988692-130988714 GGCAGTGGGCAGAAGGATGAGGG + Intergenic
1061543531 9:131290759-131290781 GGCGGTGGCCTCAAGGGAGACGG + Intronic
1061781084 9:132996414-132996436 TGGGCTGGCCAGAAGTGAGAAGG + Intergenic
1061811965 9:133167417-133167439 GGGGGTGGGCAGCAGCAGGAGGG + Intergenic
1061881864 9:133572765-133572787 GGGGGCAGCCACCAGGAAGAAGG - Intronic
1062121338 9:134835571-134835593 GGGAGTGGCCAGAACTAAGCTGG + Intronic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1062607306 9:137353987-137354009 GGGCGAGGCCGGAAGGAGGAAGG - Intronic
1202795654 9_KI270719v1_random:117105-117127 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1203517493 Un_GL000213v1:16618-16640 GGGGGTGGGCAGCTGGGAGAGGG - Intergenic
1203625226 Un_KI270750v1:11589-11611 TGAGGTAGCCAGAAGGGAGACGG - Intergenic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185953099 X:4458174-4458196 GAGGGTGGCAAGGAGGAAAATGG - Intergenic
1186147522 X:6640070-6640092 GGGGCTGGAGAGTAGGAAGAGGG - Intergenic
1186180734 X:6970433-6970455 GGGGGTTGCCGGATGGATGATGG + Intergenic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189103993 X:38218986-38219008 GGTGGTGGCAAGCAGGAACATGG + Intronic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1190002733 X:46705196-46705218 GGAGGTTGGCACAAGGAAGATGG + Intronic
1190338092 X:49275083-49275105 GGTGCTGGCCAGAAGCAGGAGGG - Intronic
1190708443 X:53049035-53049057 GGCGGCGGCCAGCAGGCAGACGG + Intergenic
1192180261 X:68911937-68911959 GGGGTTGGCCAGCAGGCAGGAGG - Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192639455 X:72848106-72848128 GGGGGAGGCAAGATGGGAGATGG + Intronic
1192642256 X:72872699-72872721 GGGGGAGGCAAGATGGGAGATGG - Intronic
1193215437 X:78857996-78858018 GGAGCTAGCCAGAAGGAAGAGGG - Intergenic
1193492955 X:82171917-82171939 GGAGCTGACCAGAAGGTAGATGG + Intergenic
1193693926 X:84682506-84682528 GCTGGGGGCCAGAAGGAAAAGGG + Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1194046996 X:89020158-89020180 GGGGGTGGTCAGAAACGAGATGG + Intergenic
1194221625 X:91200367-91200389 TGGGGGAGCCAGAAAGAAGATGG - Intergenic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1195000480 X:100638695-100638717 GGGGGTGGGGAGATGGAAGTGGG - Intronic
1195155903 X:102124964-102124986 GGAGATGGCAAGAAGGAAGTTGG + Intergenic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196151083 X:112375211-112375233 GGAGCTGGCTAGGAGGAAGAGGG + Intergenic
1196931019 X:120682133-120682155 TGTAGGGGCCAGAAGGAAGATGG - Intergenic
1197278490 X:124507642-124507664 GGGGATGGCAAGAAGGCTGAGGG + Intronic
1198321503 X:135521912-135521934 GGAGGGGACCAGGAGGAAGAGGG - Intronic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199580063 X:149351857-149351879 TGAGGAGGCCAGAAGGGAGATGG + Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199886679 X:152027606-152027628 GGAGGGGGCCAGCAGCAAGAAGG - Intergenic
1200558139 Y:4664123-4664145 TGGGGGAGCCAGAAGGAAGGTGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic
1202131609 Y:21617348-21617370 GGTGGTGGCAAGAGGGAATAAGG - Intergenic